ID: 1127987239

View in Genome Browser
Species Human (GRCh38)
Location 15:64083329-64083351
Sequence CTTAGGGTTTGGAGGTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127987239_1127987242 -9 Left 1127987239 15:64083329-64083351 CCTTCTGACCTCCAAACCCTAAG 0: 1
1: 0
2: 2
3: 17
4: 259
Right 1127987242 15:64083343-64083365 AACCCTAAGACCGTTCCCATTGG 0: 1
1: 0
2: 0
3: 1
4: 48
1127987239_1127987249 22 Left 1127987239 15:64083329-64083351 CCTTCTGACCTCCAAACCCTAAG 0: 1
1: 0
2: 2
3: 17
4: 259
Right 1127987249 15:64083374-64083396 TGCCTTCAGCCATTCTTATCTGG 0: 1
1: 0
2: 1
3: 26
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127987239 Original CRISPR CTTAGGGTTTGGAGGTCAGA AGG (reversed) Intronic
900721035 1:4175982-4176004 CAGAGGGGTCGGAGGTCAGAGGG - Intergenic
900721046 1:4176025-4176047 CAGAGGGGTCGGAGGTCAGAGGG - Intergenic
901125895 1:6928520-6928542 GTTAGGGTGGGGAGGGCAGATGG - Intronic
901751783 1:11414404-11414426 ATGAGGGATTGGAGGGCAGAGGG + Intergenic
901796767 1:11684071-11684093 TTTAGGGGTTTGGGGTCAGATGG - Intronic
902255285 1:15185042-15185064 TTTGGGGTGTGGGGGTCAGATGG - Intronic
902466174 1:16620104-16620126 CTGAGGGTATGGGGGCCAGATGG - Intergenic
902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG + Intronic
902688858 1:18097035-18097057 ATTGGGTTTTGGAGGGCAGAAGG - Intergenic
903780577 1:25817815-25817837 CATCTGGTCTGGAGGTCAGAGGG - Exonic
904870975 1:33617973-33617995 CTTAGGGTAAGGAAGACAGAGGG - Intronic
905234757 1:36538311-36538333 CTTAGGGGATTGAGATCAGAAGG + Intergenic
907035766 1:51214887-51214909 CTTAGAGTCTGGAGGGCAGTTGG - Intergenic
907235847 1:53046774-53046796 TTTAGGCTTTGCAGGTCAGTAGG - Intronic
907710817 1:56879131-56879153 TTTAGGCTTTGCAGGTCACAGGG - Intronic
907748569 1:57239597-57239619 CTTATTGTTTTGAGGACAGATGG - Intronic
909407331 1:75306203-75306225 TTTAGGTTTTGCAGGCCAGATGG - Intronic
909775125 1:79474878-79474900 CTCAGGGTATGAAGGTCAAACGG + Intergenic
909856414 1:80538812-80538834 CTTAGGGTTTTGAGCAAAGAAGG - Intergenic
909924294 1:81420718-81420740 CTTAGGGTCTAAAGGCCAGATGG + Intronic
910992159 1:93067545-93067567 CTTACTGTATGGAGATCAGAGGG + Intergenic
911467082 1:98268888-98268910 CTTCGAGTTTGGAGGAGAGATGG - Intergenic
912512530 1:110198815-110198837 CTTAGGGCTGTGGGGTCAGATGG + Exonic
916056866 1:161074041-161074063 CTAAGGGTCTGGAGCACAGATGG - Intronic
917963936 1:180166774-180166796 CTTAAGGCTTGGAGGTCAAGAGG - Intronic
918861027 1:189826447-189826469 ACTATGGTTTGGAGGTAAGAAGG - Intergenic
918940191 1:190984374-190984396 CTTAGGGTTTCCAGCTCTGAGGG + Intergenic
920584941 1:207149433-207149455 CCTAGTGTTCTGAGGTCAGATGG - Intergenic
921122993 1:212152904-212152926 AATAGGGTGTGGAGGGCAGAAGG + Intergenic
921422635 1:214966141-214966163 CTTAGGGGTTGGAGGGAAGGTGG + Intergenic
1063987483 10:11520817-11520839 CTTTGGCTTTGTAGGTCATACGG - Intronic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1065651294 10:27894774-27894796 CTCAGGATTTTGAGGTCAGCTGG - Intronic
1067077733 10:43197678-43197700 CTGTGGGATTGGAGGTCAGGAGG - Intronic
1070112341 10:73497753-73497775 CCTAAGGTTTGGAGGGCACAGGG + Exonic
1070537070 10:77387185-77387207 TTTAGTGTTTGGAGAGCAGAGGG - Intronic
1071944180 10:90622896-90622918 CTTAGTGTTTGGAGTCCAGAAGG + Intergenic
1072474047 10:95741716-95741738 CTTAGAATTTGGAGGAGAGAGGG + Intronic
1073118030 10:101103343-101103365 GTTAGGGATAGGAGGTCAAAAGG + Intronic
1076772667 10:132675055-132675077 CTTTGGGTATGGAGGACTGAGGG - Intronic
1077621444 11:3728340-3728362 CTTAGGGTTTTGAGGAGAAAAGG + Intronic
1080850887 11:36068846-36068868 CCTAGGGTTAAGAGGTCAGAAGG - Intronic
1083599512 11:63938332-63938354 CTCAGGGTTTAGAGGGGAGACGG - Intergenic
1089744975 11:120610283-120610305 TTTAGCGTTTGGAAGTTAGAGGG + Intronic
1090672455 11:128958337-128958359 CTTAGGGTGTGGAACTGAGAAGG - Intergenic
1090879455 11:130820873-130820895 CTGAGGGTGAGGAGGTCAGCTGG - Intergenic
1091322224 11:134659837-134659859 CTTAGAGGCTGGAGGACAGATGG + Intergenic
1092392234 12:8090958-8090980 TTTAGGTTTTGCAGGTCAGGTGG + Intronic
1093623161 12:21316192-21316214 TTTAGTGTTGGGTGGTCAGATGG - Intronic
1094321603 12:29190015-29190037 CTCATGGATTGGAGGTCTGAAGG + Intronic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1097567015 12:61283284-61283306 CATAGGGTTTGGACTTCAGAAGG + Intergenic
1101828235 12:108237351-108237373 CTTAGAGTTTGAGGGTCACATGG + Intronic
1102138395 12:110594323-110594345 CTCAGGATTTCGAGGTCAGCAGG - Intergenic
1102568576 12:113813276-113813298 TTTAGGCTTTGCAGGTCATAAGG + Intergenic
1104450003 12:128861302-128861324 CTTTGGGTTCGTGGGTCAGAGGG - Intronic
1108155339 13:47578543-47578565 CTTAAGGGTTAGAGGTAAGATGG - Intergenic
1109030873 13:57185320-57185342 TTTAGGGTTTGCAGGTCATATGG + Intergenic
1110732203 13:78891573-78891595 CTTAGGAATTCTAGGTCAGATGG - Intergenic
1111178733 13:84635100-84635122 CTTAGAGTTTGAAGGCAAGATGG + Intergenic
1111209617 13:85060697-85060719 TTTAGGGTTTGAAGGCCATATGG - Intergenic
1111378095 13:87407574-87407596 CTAAGGGTTTTGAGATGAGAAGG - Intergenic
1114172820 14:20290834-20290856 TTTAGGCTTTGTAGGTCATATGG + Intronic
1115634612 14:35279622-35279644 TTTAGGAGTTGGAGATCAGAGGG - Intronic
1115730038 14:36258789-36258811 CTTAGGCTTTGCAGGCCATATGG - Intergenic
1116676579 14:47913787-47913809 TTTAGGCTTTGTAGGTCAAATGG + Intergenic
1117754963 14:58965163-58965185 TTTAGGCTTTGGAGGCCACAAGG - Intergenic
1118059922 14:62124840-62124862 GTTTGGGTTTTGAAGTCAGATGG - Intergenic
1120416085 14:84220077-84220099 CCTAGTATTTGGAAGTCAGAAGG - Intergenic
1120825892 14:88955023-88955045 CCTAGGGTTGGGAGGAAAGAAGG - Intergenic
1123778418 15:23602784-23602806 CATGGGGTGTGGAGGTCAGTGGG - Intronic
1124406913 15:29401098-29401120 CTCTGGGTTTGCAGGTCAGCTGG - Intronic
1125537410 15:40449953-40449975 AGGAGAGTTTGGAGGTCAGAGGG + Intronic
1127230570 15:56989298-56989320 CTTAGGCTTTGCAGGTCAAGAGG - Intronic
1127987239 15:64083329-64083351 CTTAGGGTTTGGAGGTCAGAAGG - Intronic
1128992320 15:72271599-72271621 CTTAAGGTTAGGAGTACAGAAGG + Intronic
1129790153 15:78335730-78335752 CTCAGCGTTTAGGGGTCAGATGG - Intergenic
1130261879 15:82360905-82360927 TTTAGGGTCTGTAGGTCATATGG - Intergenic
1130279356 15:82508106-82508128 TTTAGGGTCTGTAGGTCATATGG + Intergenic
1131723450 15:95196742-95196764 CTCAGGGTTTGGAGGTGGGGTGG - Intergenic
1133320302 16:4909379-4909401 CTGAGGGTGGGGAGGTCAGGAGG - Intronic
1133583386 16:7167821-7167843 TTTAGGCTTTGCAGGCCAGATGG - Intronic
1134590618 16:15450087-15450109 TTTAGGGTGTGCAGGTCATATGG + Intronic
1135861957 16:26064344-26064366 CTTAGGGTATAGAGGGTAGAAGG + Intronic
1136125265 16:28174944-28174966 ATCAGGATTTGGAAGTCAGAAGG - Intronic
1137897982 16:52234701-52234723 CTTAGGTTTTGTGGGCCAGATGG + Intergenic
1138421163 16:56900116-56900138 GTTAGGGCTAGGAGGTCAGGAGG - Intronic
1139138490 16:64233460-64233482 CTTTGGGTTTGGGGGGCTGAAGG + Intergenic
1139599783 16:67979766-67979788 CTGGGGGTGTGAAGGTCAGATGG + Intronic
1140766928 16:78168548-78168570 CTTGGAGTTTGGAAGCCAGATGG - Intronic
1140867544 16:79077112-79077134 CTTAGGGGTTGGAGAGCAGTGGG - Intronic
1142403209 16:89871876-89871898 CGTGGGGCCTGGAGGTCAGAAGG + Intergenic
1142509928 17:386682-386704 TTTAGGGTTAGGAGGTGAGGAGG - Intergenic
1143023833 17:3929769-3929791 ATTAGGGTCTGGGGGTCAGTGGG - Intronic
1143298228 17:5887423-5887445 TTTAGGCTTTGGAGGCCATATGG - Intronic
1144436359 17:15246226-15246248 TTTAGGCTTTGCAGGTCATACGG + Intronic
1144688810 17:17245435-17245457 CTTAGGCTTTGGAGGTCATATGG - Intergenic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1145898369 17:28473964-28473986 CTGAGGGCTAGGAGGTCAAAGGG + Intronic
1145940483 17:28740996-28741018 CTTGGGCTCTGGAGGTCAGAGGG + Intronic
1145944573 17:28763541-28763563 CTTCTGTTTTGAAGGTCAGAGGG + Intronic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1147351189 17:39845640-39845662 TTTAGGCTTTGCAGGTCATATGG - Intronic
1147637197 17:41971339-41971361 CTTAGAGTTTGGAGAAGAGATGG + Intronic
1148475119 17:47923515-47923537 CTTTGCGTTTGGATGTCAGTTGG - Intronic
1149132020 17:53314206-53314228 CTTAGGGTTTGGAGCCAAGTAGG - Intergenic
1150866305 17:68853858-68853880 TTTTTGCTTTGGAGGTCAGATGG + Intergenic
1151145432 17:72036083-72036105 TTTAGGCTTTGTAGGTCATATGG + Intergenic
1153861974 18:9220700-9220722 GTTTGGGTTTGGAGCTCAAAAGG + Intronic
1154355316 18:13619971-13619993 CCTAGGGTGTGGGGGTCTGAGGG + Intronic
1155348701 18:24884593-24884615 TTTAGGGTTTGTAAGGCAGAGGG + Intergenic
1155618057 18:27744100-27744122 CTTAGGCTTTTGAGGCCATATGG - Intergenic
1157681230 18:49608671-49608693 CTTAGGATTTGGAGCTCAGAAGG + Intergenic
1157728728 18:49985738-49985760 CTTAGGGTTTTCAGGGAAGAGGG - Intronic
1158673694 18:59499936-59499958 CCTAGGGATTGGAGTTCAGGGGG + Intronic
1160275746 18:77433285-77433307 TTTTGGGTTTGCAGGCCAGATGG - Intergenic
1162283658 19:9720801-9720823 ATTAGGGACTGGAGGCCAGATGG - Intergenic
1163608465 19:18288585-18288607 CAGAGGGTTTGGGGATCAGAAGG + Intergenic
1164543755 19:29142167-29142189 TTTAGGGTTTGTAGGTCATGTGG - Intergenic
1165159918 19:33810052-33810074 CTTAGGGCCTGTAGGTCAGGGGG + Intronic
1165186302 19:34025370-34025392 CTTTGGGTTTGGAGATGGGAGGG - Intergenic
1165771917 19:38385190-38385212 CTTAGGGATTGGATGCCATAGGG + Intronic
926245334 2:11118963-11118985 CTTAGTGTTTGGAGATCCGTAGG - Intergenic
926416271 2:12652657-12652679 CTTATGGATTTGAGATCAGAGGG - Intergenic
926807595 2:16725497-16725519 TTTAGGATTTGAAGGGCAGAAGG - Intergenic
927009885 2:18892366-18892388 CTTGGAATTAGGAGGTCAGAGGG - Intergenic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
931029271 2:58153940-58153962 TTTAGGTTTTGCAGGTCATATGG + Intronic
931066812 2:58596834-58596856 CAGAGGCTTTGGGGGTCAGATGG + Intergenic
931812079 2:65863887-65863909 ACTTGGGTTTGGAGGTCAAATGG + Intergenic
931922381 2:67034981-67035003 TTTAGGGTTTGGGGGTTAGGAGG + Intergenic
932091773 2:68812108-68812130 TTTAGGCTTTGCAGGCCAGATGG + Intronic
932344304 2:70985591-70985613 CTTAGGGCTGGGAGGGCAGTGGG - Intronic
933633963 2:84686829-84686851 TTTAGGCTTTGCAGGTCATATGG - Intronic
936482271 2:112894794-112894816 CTTAGGGTTTGGAGATGAAGAGG - Intergenic
939186846 2:138871215-138871237 TTTAGGTTTTGCAGGTCATATGG + Intergenic
942050698 2:172137819-172137841 CTTAGGGAATGGAGTTTAGAAGG - Intergenic
942245293 2:174002639-174002661 GCTAGGGTTTGGAGGGAAGAAGG + Intergenic
942860168 2:180599686-180599708 GTTAGAATTTGGAAGTCAGAAGG - Intergenic
944058712 2:195548896-195548918 CCTAGGGTTTGGAGTTTATATGG + Intergenic
946127092 2:217572461-217572483 CTAAGGGTCTGGAGGGCACAGGG + Intronic
947742787 2:232492502-232492524 CTTAGGATTTGGAGACCAGATGG - Intergenic
947755501 2:232561063-232561085 CTTGGAGTTTGGAGGAAAGAAGG + Intronic
1169040132 20:2486925-2486947 TTTAGGGTTTGTAGGTGACATGG + Intronic
1169967313 20:11232305-11232327 CTGAGGGTGGGGAGTTCAGATGG - Intergenic
1171063538 20:21990333-21990355 ATTACTGTTTGGAGGTCAGCTGG + Intergenic
1171385082 20:24764438-24764460 CTGTGGGCTTGGAGGTCAGGCGG + Intergenic
1174709014 20:52685441-52685463 CTTGGGGTTTGGGAGTCAGTTGG + Intergenic
1174820336 20:53721366-53721388 TTTAGGCTTTGGAGGCCAGATGG + Intergenic
1175151477 20:56938315-56938337 TTCAGGCTTTGCAGGTCAGAAGG - Intergenic
1175504282 20:59470735-59470757 CGTGGGGATTGGAGGCCAGAAGG - Intergenic
1175614596 20:60385329-60385351 CTTAGGGTTTGGGAGTGAGAAGG + Intergenic
1177919113 21:27128427-27128449 CTTAGGCTTTGTAGGCCATAAGG - Intergenic
1178750325 21:35296733-35296755 CTTTTGGTTTGGAGGTGATACGG + Intronic
1178816806 21:35938074-35938096 TTTAGGCTTTGTAGATCAGACGG + Intronic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179159208 21:38878119-38878141 CTCTGGCTTTGGAGGTCATATGG + Intergenic
1179264528 21:39791439-39791461 CCTAGGGTTTGGAGGCTGGAAGG - Intronic
1181279346 22:21707828-21707850 TTTAGGCTTTGGAGGACATATGG + Intronic
1181432892 22:22893901-22893923 CTTAAGGCTGGGAGGACAGAGGG - Intronic
1181463061 22:23096630-23096652 CTCAGGGTGTGGAGGCCACAGGG + Intronic
1181541394 22:23574865-23574887 CTTAAGGCTGGGAGGGCAGAGGG + Intronic
1181551280 22:23640200-23640222 CTTAAGGCTTGGAGGGCAAAGGG + Intergenic
1182352079 22:29704804-29704826 CTCAGGGTTGGGAGGGCAGTGGG + Intergenic
1182637134 22:31737063-31737085 TTTAGGCTTTGCAGGTCATATGG - Intronic
1183176069 22:36225593-36225615 CTTGGGGTTTTGAGGTCTCAGGG + Intergenic
1183484920 22:38083624-38083646 TTTGAGGTTTGGAGGGCAGAAGG - Intronic
950176353 3:10877575-10877597 CTGAGAGTCTGGAAGTCAGAGGG - Intronic
950249922 3:11456148-11456170 CTCAGGGTTAGGGGGCCAGAGGG - Intronic
951028148 3:17851095-17851117 CTAAGATTTTGGTGGTCAGAGGG - Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952943379 3:38459710-38459732 CTCAGGGTGTGGTGGCCAGATGG + Intronic
953336956 3:42101590-42101612 TTTTAGGTTTGCAGGTCAGAAGG + Intronic
954454131 3:50587922-50587944 CTGAGGGTTTGGATGTGAGATGG + Intergenic
955004102 3:54953484-54953506 CTTCGCGCTTGGTGGTCAGATGG + Intronic
955043226 3:55336449-55336471 ATAAGGGTTTGGAGGGCTGATGG + Intergenic
955429606 3:58828923-58828945 CTTAGGATTTGGAGACCAGCTGG + Intronic
955730626 3:61981646-61981668 GGTGGGGTTTGGAGGTCAGCTGG + Intronic
956331669 3:68116931-68116953 TTTAGGTTTTGCAGGCCAGATGG - Intronic
956455655 3:69418360-69418382 CACAGGGTGTGGAGGTCATAGGG - Intronic
956673131 3:71709988-71710010 CTAAAGGTTTAGAGGTCACATGG - Intronic
959247305 3:103888695-103888717 CTTATGGTTTAGATGTCAAAAGG - Intergenic
959436784 3:106325128-106325150 CTTACAGGTTTGAGGTCAGAAGG + Intergenic
960156629 3:114302929-114302951 TTTTGGGTTTGTAGGTCATATGG + Intronic
960634098 3:119766642-119766664 ATTAGGGTTTGCGGGTCTGATGG + Exonic
961515581 3:127431775-127431797 CTGTTGGTTTGGAGGTCAGCTGG + Intergenic
963337190 3:143988638-143988660 CTTATGATTTTGAGGTAAGAGGG - Intronic
965231023 3:166052770-166052792 CTTAGGATTGGGATGCCAGAGGG - Intergenic
965694759 3:171396115-171396137 CTTAGGGTTGGGGGGGCAGTGGG - Intronic
966856295 3:184196175-184196197 CCTAGCTTTTGGAGGTGAGAGGG + Intronic
967340191 3:188388841-188388863 TTTAGGCTTTGTAGGCCAGATGG + Intronic
967912831 3:194556278-194556300 CTTAGGGTTTGGGGGACACCAGG - Intergenic
969106714 4:4811933-4811955 CGCAGGCTTTGGGGGTCAGATGG - Intergenic
969224273 4:5784502-5784524 CTTACAGTTTTGAGGCCAGAAGG - Intronic
969909356 4:10429030-10429052 GTTTGGGTTTGAAGATCAGAAGG - Intergenic
970818974 4:20190937-20190959 TTTAGGGTTTGGAGGACGGTGGG - Intergenic
973633935 4:52844560-52844582 CTTAGAGTTAGGAAGTCAAAAGG - Intergenic
973657274 4:53061710-53061732 TTCAGGGCTGGGAGGTCAGATGG + Intronic
975328634 4:73088868-73088890 TTTAGGCTTTGCAGGTCACATGG + Intronic
976077090 4:81312144-81312166 CTGAGGATTTGGAGGCAAGAAGG + Intergenic
978612665 4:110560925-110560947 GTAGGGCTTTGGAGGTCAGAGGG + Intronic
980383239 4:132054656-132054678 TATATGATTTGGAGGTCAGATGG + Intergenic
982092138 4:151889516-151889538 CTCAGTGTTTGGAAGTCAGCTGG - Intergenic
983606557 4:169593226-169593248 TTTAGGTTTTGCAGGCCAGATGG + Intronic
984473009 4:180200977-180200999 CCTAGGATTTGGAGGGCAGGGGG - Intergenic
985699337 5:1361110-1361132 CTAGGGGTTTTGAGGGCAGAGGG + Intergenic
986765560 5:10922837-10922859 TTTCCAGTTTGGAGGTCAGATGG + Intergenic
990191375 5:53263901-53263923 TTTAGGCTTTGAAGGTCATATGG - Intergenic
991275504 5:64842155-64842177 TTTAGGGTTTGTAGGCCACATGG - Intronic
991911454 5:71566577-71566599 TTTTGGGTTTGCAGGCCAGATGG + Exonic
992015302 5:72569115-72569137 ACTTGGCTTTGGAGGTCAGATGG - Intergenic
992128475 5:73666952-73666974 CTACGGCTTTTGAGGTCAGAGGG - Intronic
992357834 5:76003816-76003838 CATAGGGTGTGGAGCTCAGAGGG + Intergenic
992920027 5:81505257-81505279 TTTAGGCTTTGCAGGTCACACGG - Intronic
992931469 5:81651998-81652020 CTTAGGGTTTAGAAGCCACATGG - Intronic
993193499 5:84708803-84708825 TTTAGCCTTTGGAGGTCATAAGG - Intergenic
995341411 5:111065220-111065242 TTTAGGCTTTGCAGGCCAGATGG + Intergenic
995374099 5:111453921-111453943 CCTGGGGTGTGTAGGTCAGATGG + Intronic
997253389 5:132408822-132408844 CTTCAGGTTTTGGGGTCAGATGG + Intergenic
997762547 5:136463476-136463498 CACAGTGATTGGAGGTCAGAGGG - Intergenic
999934153 5:156467028-156467050 TTTAGGCTTTGCAGGCCAGATGG + Intronic
1000330305 5:160200311-160200333 CTGAGAGTTCAGAGGTCAGATGG - Intronic
1001235417 5:170025385-170025407 TTTAGGCTTTGGAGGCCAGATGG - Intronic
1001240571 5:170066851-170066873 TTTAGGATTTGCAGGCCAGATGG - Intronic
1002829229 6:804241-804263 CTTAGGGTCTGCTGGTGAGATGG + Intergenic
1004286946 6:14329982-14330004 CTCAGGGATTGGAGTTCAGAGGG + Intergenic
1004873128 6:19927724-19927746 TTTAGGCTTTGCAGGTCAGGAGG - Intergenic
1006884600 6:37370620-37370642 CTCAGGGCTTGGTGGGCAGAGGG - Intronic
1006938862 6:37738116-37738138 GTTAGGGTTTGGAGGGTGGATGG + Intergenic
1007214073 6:40222584-40222606 AGTAAGGTTTGGAGGGCAGAAGG + Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1009872657 6:69469933-69469955 TTTAGGGTTTGTGGGTCAAATGG - Intergenic
1010386832 6:75289887-75289909 CTTATGGTGTGCTGGTCAGAGGG - Intergenic
1011052053 6:83162825-83162847 ATTCAGGTTTGGAAGTCAGAAGG + Exonic
1012195053 6:96331201-96331223 TTTAGGCTTTGCAGGCCAGATGG + Intergenic
1015630553 6:135228089-135228111 TTCAGGTTTTGGAGGTCACATGG - Intergenic
1019864126 7:3689125-3689147 GTTAGGGTTTGCAGGCCATATGG - Intronic
1022416157 7:30178883-30178905 CTCAGATTTTGGAGTTCAGAGGG - Intergenic
1023868749 7:44251665-44251687 TTGAGGGTTTGGAGCTCAAATGG - Intronic
1024120402 7:46231307-46231329 CTTGGGGTTTGGAGCTCATTGGG + Intergenic
1028229777 7:88292696-88292718 GTTAGGGTTGGTAGTTCAGAGGG - Intronic
1030540787 7:110828130-110828152 TTTAGGCTTTGTAGGCCAGATGG + Intronic
1031016763 7:116584051-116584073 TTTAGGCTTTGCAGGTCATATGG + Intergenic
1031275199 7:119712520-119712542 TCTAGGGTCTGGAGGACAGATGG + Intergenic
1031456135 7:121981661-121981683 TTCAGGGTTTGAAGGCCAGATGG + Intronic
1033192665 7:139296247-139296269 GTTAGGCTTTGCAGGTCATATGG + Intronic
1033480441 7:141735001-141735023 CTTAGGGATGGGAGGCCAGGCGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1039405304 8:37307625-37307647 TTTAGGCTTTGGAGGTCATATGG - Intergenic
1039736514 8:40338396-40338418 CAAAGGGTTTGGAGGTTTGAAGG - Intergenic
1042564993 8:70102058-70102080 CATAGGGTCTGAAGATCAGATGG + Intergenic
1042723755 8:71850336-71850358 CTTTAGAATTGGAGGTCAGAGGG - Intronic
1044429045 8:92087180-92087202 CTCAGGGTTGGGAGGTGGGATGG - Intronic
1046604040 8:116350950-116350972 CTCAGGGTTTGGAGTAGAGACGG - Intergenic
1048350270 8:133610262-133610284 TTTAGGTTTTGTAGGTCACAGGG - Intergenic
1048407319 8:134136902-134136924 CTTGGGGTGTGGAGGTCATATGG + Intergenic
1049622485 8:143604914-143604936 CTTAGGATTGGGAGGAAAGAGGG + Exonic
1052243082 9:26298407-26298429 GTTAGGTTGTGGAGTTCAGAAGG - Intergenic
1053380817 9:37648872-37648894 CTCTGGGTTTGGAAGACAGAAGG + Intronic
1056939628 9:90944286-90944308 TTTAGGCTTTGAAGGTCATAGGG - Intergenic
1059029247 9:110672448-110672470 CATAGGGTAGGGAGGACAGATGG + Intronic
1060036675 9:120261756-120261778 CTTAGGACTTAGAGGTGAGAAGG - Intergenic
1060221783 9:121767965-121767987 CTTAGGGTAGGGAGCTCAGGAGG + Intronic
1061826447 9:133261108-133261130 GTTGGGGACTGGAGGTCAGAAGG + Intronic
1062092011 9:134683276-134683298 CAGAAGGTTTGGAGGTGAGACGG - Intronic
1062093180 9:134689255-134689277 CAGAAGGTTTGGAGGTGAGATGG - Intronic
1062517451 9:136943707-136943729 CTCAGAGCTTGGAGGCCAGAGGG - Intronic
1186691485 X:11981061-11981083 TTTAGGCTTTGTAGGCCAGATGG - Intergenic
1186703176 X:12113361-12113383 CTTGTAGTTTGGAGGTCAGATGG + Intergenic
1190567977 X:51750574-51750596 GTGAGGGTTTGAAGGTCAGGAGG + Intergenic
1191953487 X:66619494-66619516 CTTAGGTTGTGGAGGTGAGAGGG - Intronic
1192919835 X:75694946-75694968 CTTGTTGTTTGGAGGTAAGAAGG - Intergenic
1195939966 X:110159874-110159896 CTTAGGGTGAGGAGGTGAAAGGG + Intronic
1197801423 X:130353689-130353711 CATGGTGTTTTGAGGTCAGAGGG - Intronic
1198441188 X:136664890-136664912 CTTGGGGTTTGGTGGCCAGCAGG - Intergenic
1198496680 X:137200321-137200343 CTCACGGATTGGAGGTCTGAAGG - Intergenic
1198508663 X:137327187-137327209 CTTGGAGTTTTGAAGTCAGATGG - Intergenic
1198514397 X:137390108-137390130 TTTAGGCTTTGCAGGTCATATGG + Intergenic
1202086446 Y:21141686-21141708 CTAAGGGTTTGGAGGCAGGAGGG - Intergenic