ID: 1127988744

View in Genome Browser
Species Human (GRCh38)
Location 15:64095851-64095873
Sequence CTTAGGCGCTGGGGGCGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 412}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127988744_1127988768 25 Left 1127988744 15:64095851-64095873 CCGCCCCGCCCCCAGCGCCTAAG 0: 1
1: 0
2: 2
3: 47
4: 412
Right 1127988768 15:64095899-64095921 GGATCCCACGGGGTCCCTTGCGG 0: 1
1: 0
2: 0
3: 5
4: 104
1127988744_1127988757 4 Left 1127988744 15:64095851-64095873 CCGCCCCGCCCCCAGCGCCTAAG 0: 1
1: 0
2: 2
3: 47
4: 412
Right 1127988757 15:64095878-64095900 GCCCCTAGGTCTCCGCCCCTCGG 0: 1
1: 0
2: 1
3: 6
4: 123
1127988744_1127988761 13 Left 1127988744 15:64095851-64095873 CCGCCCCGCCCCCAGCGCCTAAG 0: 1
1: 0
2: 2
3: 47
4: 412
Right 1127988761 15:64095887-64095909 TCTCCGCCCCTCGGATCCCACGG 0: 1
1: 0
2: 1
3: 10
4: 118
1127988744_1127988763 15 Left 1127988744 15:64095851-64095873 CCGCCCCGCCCCCAGCGCCTAAG 0: 1
1: 0
2: 2
3: 47
4: 412
Right 1127988763 15:64095889-64095911 TCCGCCCCTCGGATCCCACGGGG 0: 1
1: 0
2: 0
3: 1
4: 60
1127988744_1127988752 -10 Left 1127988744 15:64095851-64095873 CCGCCCCGCCCCCAGCGCCTAAG 0: 1
1: 0
2: 2
3: 47
4: 412
Right 1127988752 15:64095864-64095886 AGCGCCTAAGCCCCGCCCCTAGG 0: 1
1: 0
2: 1
3: 21
4: 112
1127988744_1127988762 14 Left 1127988744 15:64095851-64095873 CCGCCCCGCCCCCAGCGCCTAAG 0: 1
1: 0
2: 2
3: 47
4: 412
Right 1127988762 15:64095888-64095910 CTCCGCCCCTCGGATCCCACGGG 0: 1
1: 0
2: 0
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127988744 Original CRISPR CTTAGGCGCTGGGGGCGGGG CGG (reversed) Intronic
900102374 1:967374-967396 CACAGGGGCTGGGGGGGGGGTGG - Intronic
900118808 1:1040014-1040036 CTTAGGCGCAGGGAGCGGTCAGG + Intronic
900751319 1:4399671-4399693 CTTAGGGGCTGGGAGCAGGTGGG + Intergenic
900996154 1:6124654-6124676 CATAGGCTCTGGGGTGGGGGGGG + Exonic
901176565 1:7304047-7304069 CTCAAGGGCTGGGGGAGGGGAGG + Intronic
901199166 1:7457039-7457061 CGGCGGCGCAGGGGGCGGGGCGG - Intronic
901799787 1:11701353-11701375 CCGAGGCTCTGGGGGCGAGGGGG - Intronic
903321083 1:22543539-22543561 CTCAGGCGCTGTGGGGGGTGAGG - Intergenic
903322572 1:22551867-22551889 CCTAGGGGCTGGGGGCGCTGGGG - Intergenic
903324869 1:22563845-22563867 CCTCGGCCCGGGGGGCGGGGTGG + Intronic
903663520 1:24993201-24993223 CTTAGGGGCTGGGAGGGGGGTGG - Intergenic
903788402 1:25875971-25875993 CTCGGGAGCAGGGGGCGGGGTGG - Intergenic
904190058 1:28736691-28736713 CTGGGGCGGTGGGGGCGGGGAGG + Intronic
904311600 1:29632820-29632842 CTGAGGGGCTGGGGGCTGGGAGG - Intergenic
904690917 1:32292645-32292667 CTCAGAGGCTGGGGGAGGGGAGG - Intronic
905375078 1:37514591-37514613 CTTGGGGCCTGGAGGCGGGGCGG + Intronic
905662584 1:39738819-39738841 GCTAAGCGTTGGGGGCGGGGCGG + Intronic
905874315 1:41422499-41422521 CTCAGGTCCTGGGGGCGTGGAGG + Intergenic
905971328 1:42144656-42144678 CTTAGGCACTGGGGCCCTGGAGG + Intergenic
906532158 1:46530189-46530211 CCCAGGGCCTGGGGGCGGGGGGG - Intergenic
909391640 1:75127337-75127359 AGGAGGCTCTGGGGGCGGGGAGG - Intergenic
910426176 1:87121930-87121952 CCTAGGGGGTGGAGGCGGGGAGG - Intronic
910667290 1:89739233-89739255 CTTAGGCTGTGGGGAGGGGGAGG - Intronic
911150381 1:94592499-94592521 ATGTGGGGCTGGGGGCGGGGTGG - Intergenic
911275432 1:95853268-95853290 CTTAGGAGCTGGGAGCAGGCAGG + Intergenic
913429629 1:118776559-118776581 CTTTGGCGGTGGGGTGGGGGGGG - Intergenic
915951116 1:160190528-160190550 AATAGGAGCAGGGGGCGGGGAGG - Intergenic
917829100 1:178859822-178859844 CTTGGGCGGTTGGGGGGGGGGGG - Intronic
919767218 1:201135181-201135203 CTGAGGCGCTGGGGCTGGGAGGG + Exonic
919923704 1:202181428-202181450 CTGAGGAGCTGGGTGCAGGGAGG + Intergenic
919935465 1:202247930-202247952 CTGAGGCGCTGGGGAGGAGGAGG - Intronic
920259160 1:204677303-204677325 CATGGGGGCTGGGGGCAGGGAGG + Intronic
920303637 1:205004973-205004995 CTTCTGTGCTGGGGGCGGGATGG + Intronic
920367468 1:205455663-205455685 CAAAGGCAATGGGGGCGGGGAGG + Intronic
921160466 1:212468704-212468726 CTAAGGCGGTGGGGGTGGGGGGG - Intergenic
922741293 1:228015707-228015729 CTTGGGCGGCGGGGGTGGGGGGG - Intronic
922799585 1:228359123-228359145 CTTATGCCGTGGGGGTGGGGTGG - Intronic
922899322 1:229123888-229123910 CTGAGGGGCTGGAGGCTGGGTGG - Intergenic
923014061 1:230112368-230112390 CAGAGGCGCCGGGGGAGGGGGGG + Intronic
923550112 1:234957177-234957199 TTTAGGGCCTGGGGGAGGGGAGG - Intergenic
924803869 1:247347583-247347605 CATAGGAGCGGGGGGGGGGGGGG - Intergenic
1063115120 10:3067474-3067496 CATTGGCGCTGGGGCCGGGCGGG + Intronic
1063115546 10:3069030-3069052 CGTAGGCGCTCGTGGCGGGCGGG - Intronic
1067110307 10:43395944-43395966 AGAAAGCGCTGGGGGCGGGGAGG + Intronic
1068103842 10:52590333-52590355 CTCTGGGGCTGGGGGTGGGGTGG + Intergenic
1069683456 10:70301246-70301268 CCTGGGGGCTGGGGGCGGGTGGG - Exonic
1069769485 10:70888364-70888386 CTCTGTCGCTGGCGGCGGGGAGG - Intronic
1069822185 10:71234998-71235020 CCTGGGCGCTGGGGGTGGGAAGG - Intronic
1069874810 10:71555275-71555297 CCTGGGCGCTGGGGCCAGGGTGG + Intronic
1070027876 10:72649459-72649481 TTTTGGCGGGGGGGGCGGGGTGG + Intergenic
1071526680 10:86363419-86363441 CTGAGGCTCTGGGGGCCGCGGGG + Intronic
1071566579 10:86674367-86674389 GCTGGGGGCTGGGGGCGGGGAGG - Intronic
1071835678 10:89415036-89415058 CTTAGGCGCTGGGGAGGGGCCGG - Intronic
1073141993 10:101254225-101254247 CCTAGGGGATGGGGGAGGGGTGG + Intergenic
1074095107 10:110304751-110304773 GTGTGGGGCTGGGGGCGGGGCGG + Exonic
1075095521 10:119468513-119468535 CTTGGGAGCTGGGGGTGGGGGGG - Intergenic
1075571667 10:123550876-123550898 CTTGGGCCCTGGAGGCGGGTTGG + Intergenic
1076696483 10:132249718-132249740 CTTTGGGGCTGGGGTCGGGAGGG - Intronic
1076749890 10:132537420-132537442 CCGCGGCGCGGGGGGCGGGGCGG + Intergenic
1077241701 11:1513988-1514010 CTTGGGCACTGGGAGTGGGGAGG - Intergenic
1077297085 11:1831429-1831451 CTCAGGTGCTGTGGGCTGGGGGG - Intronic
1077377822 11:2213623-2213645 GTCAGGGGCTGGGGGAGGGGTGG - Intergenic
1077380538 11:2234996-2235018 CAGAGCTGCTGGGGGCGGGGAGG - Intergenic
1077553757 11:3216057-3216079 CTTAGGCTTTGAGGGCAGGGTGG - Intergenic
1077877665 11:6321209-6321231 CTTGGGTGCTGGGGCCGGGGCGG - Intergenic
1079599897 11:22298372-22298394 CTTATGGGGAGGGGGCGGGGAGG + Intergenic
1080030657 11:27657279-27657301 CTTAGGGGATGGGGGATGGGGGG - Exonic
1080268367 11:30424731-30424753 CTTGGGAGTTGGGGGTGGGGTGG - Intronic
1081489848 11:43558740-43558762 CTTTTGCGCTGGGGGTGCGGGGG + Intronic
1081938135 11:46918590-46918612 CTGCGGCGCGGGGGGCGGGGCGG - Exonic
1083298964 11:61730356-61730378 CTGCAGCCCTGGGGGCGGGGTGG - Intronic
1083300528 11:61737640-61737662 CTAAGGCCAAGGGGGCGGGGTGG - Intronic
1083470697 11:62881811-62881833 CTTAGGCGCTGGGAGAAGGGAGG + Intronic
1083538244 11:63491134-63491156 CTTGGGCACTGGGGGCGGCTCGG + Exonic
1083766460 11:64843751-64843773 CTGTGGCGCCGGGGCCGGGGAGG - Intronic
1084035765 11:66509322-66509344 TTTAGGGGCTGGGGAGGGGGAGG + Exonic
1084065921 11:66704544-66704566 CTTGGGAGGTGGGGGTGGGGGGG - Intronic
1084313450 11:68330227-68330249 ACAAGGGGCTGGGGGCGGGGTGG - Intronic
1084665322 11:70573265-70573287 CTGCAGCGGTGGGGGCGGGGGGG + Intronic
1085328697 11:75628507-75628529 GTGAGGAGCTGGGGGAGGGGAGG + Intronic
1088650012 11:111949219-111949241 CCCAAGAGCTGGGGGCGGGGTGG - Intronic
1088675438 11:112188057-112188079 CCCAAGAGCTGGGGGCGGGGTGG - Intronic
1089127853 11:116190023-116190045 CTCAGGAGCTGGGGGTGGAGGGG + Intergenic
1089618949 11:119711555-119711577 CTCAGGTGCTGGGTGAGGGGAGG + Intronic
1091094629 11:132808974-132808996 TTTGGTCGGTGGGGGCGGGGGGG + Intronic
1092378182 12:7973056-7973078 CCAAGGAGCGGGGGGCGGGGGGG - Intergenic
1093728662 12:22543978-22544000 CTGAGGGGCTGGGGGCGAGGTGG + Intronic
1095499264 12:42818741-42818763 CTTAGGCGGTGGGGGGGGGGGGG - Intergenic
1095703771 12:45216582-45216604 CTGAGGCGCGGGGCGCGTGGTGG + Intronic
1096134407 12:49187892-49187914 CTGATGTGGTGGGGGCGGGGCGG + Intronic
1096428562 12:51524450-51524472 CTCAGGAGCTGGGGTGGGGGTGG - Intergenic
1096475636 12:51907329-51907351 CTGAGGGGCTGGGAGCGGCGCGG + Intronic
1096548288 12:52356283-52356305 CCTAGGGGCTGGGCGCCGGGAGG - Intergenic
1096770844 12:53934958-53934980 CATATGGGCGGGGGGCGGGGGGG - Intergenic
1096781305 12:53993846-53993868 CTTATGCGCTCTCGGCGGGGAGG - Intronic
1096996874 12:55843602-55843624 CTAAGGGGCTTGGGGCTGGGGGG + Intergenic
1097037454 12:56133230-56133252 GGTAGGGGCTGGGGGTGGGGAGG - Intronic
1097182387 12:57178875-57178897 ATTGGGAGCTGGGGGCAGGGTGG - Exonic
1097190488 12:57217110-57217132 GCTCGGAGCTGGGGGCGGGGCGG - Intronic
1098559605 12:71857118-71857140 CTTAAGAGATGGGGGTGGGGGGG + Intronic
1099979658 12:89583784-89583806 CTTTGGCGGGGGGGGGGGGGGGG + Intergenic
1100678941 12:96898007-96898029 CAAAGGGCCTGGGGGCGGGGGGG + Intergenic
1101428362 12:104606160-104606182 CTCTGGGGCGGGGGGCGGGGGGG + Intronic
1101713285 12:107288473-107288495 GATTGGCGGTGGGGGCGGGGGGG - Intergenic
1102229754 12:111254289-111254311 TTTAGGCACTGGGGGAGGGCTGG + Intronic
1102532653 12:113558200-113558222 CTTAGACTCTTGGGGAGGGGAGG + Intergenic
1102844284 12:116161939-116161961 CTTAGGTGACGGGGGCAGGGGGG + Intronic
1102952954 12:117042278-117042300 CTGGGGGGCTGGGGGAGGGGAGG - Intronic
1103558440 12:121779655-121779677 CTCAGGCCCTGGGTGGGGGGAGG + Exonic
1103878274 12:124146183-124146205 CTTTGGGGCTGGGCGCGCGGTGG + Intronic
1104001507 12:124863528-124863550 GTTGGGCGCTGGGCGCCGGGAGG - Intronic
1104348990 12:128028653-128028675 CTCAGGGGCTGTGGGCAGGGCGG + Intergenic
1105454078 13:20525037-20525059 CGTAGGGGTGGGGGGCGGGGTGG + Intronic
1106125682 13:26898315-26898337 GGTAGGCGCTGGGGCAGGGGTGG - Intergenic
1106890629 13:34241839-34241861 CTGAGGTGCTGGGGTAGGGGAGG + Intergenic
1110692124 13:78443044-78443066 CTTAGGGGCTGTGGGTGGAGCGG - Intergenic
1113737583 13:112689773-112689795 CGCAGGCGCTGGGCGCGGCGGGG - Intergenic
1113771288 13:112910997-112911019 TTTGGGGGGTGGGGGCGGGGCGG + Intronic
1114271870 14:21105241-21105263 CTGAGGCGGGGGGCGCGGGGCGG - Intergenic
1115395165 14:32900420-32900442 CCTAGGGGCTGGGGGAGGTGGGG + Intergenic
1115658636 14:35468087-35468109 CTGAGGCAGTGGGGGTGGGGGGG + Intergenic
1116876121 14:50113786-50113808 CTTGGGGGCGGGGGGGGGGGGGG + Intronic
1117987393 14:61400951-61400973 CTGAGGAGTTGGGGGTGGGGGGG + Intronic
1118119121 14:62818094-62818116 ACCAGGAGCTGGGGGCGGGGGGG + Intronic
1118253699 14:64186321-64186343 ATTAGACTCTGGGGGAGGGGAGG - Intronic
1118749225 14:68794450-68794472 CCAAGGCGCAGGGGGCGGGTGGG - Intronic
1118786731 14:69052230-69052252 TTCAGGCACTGGGGGTGGGGGGG - Exonic
1119177545 14:72580313-72580335 CTGTGGCCCTGGGGTCGGGGTGG - Intergenic
1119470950 14:74898812-74898834 CTGTGGAGCTGGGGGAGGGGAGG - Intronic
1119726490 14:76924720-76924742 CTTAGAGGCTGGGGGATGGGGGG + Intergenic
1120590463 14:86368138-86368160 CTGAGACCCTGGGGTCGGGGCGG + Intergenic
1122900007 14:104778523-104778545 CTGAGGGGCTGGGGTTGGGGTGG - Intronic
1122978630 14:105181323-105181345 CGTGGGCGCGCGGGGCGGGGCGG + Intronic
1124239342 15:28017055-28017077 CTGGGGAGCGGGGGGCGGGGGGG + Intronic
1124641242 15:31397859-31397881 CTTTGGGGGTGGCGGCGGGGGGG + Intronic
1125180649 15:36878510-36878532 CTCAGCCGGTGGGGGCGGGGGGG + Intergenic
1125672505 15:41484325-41484347 CTCAGGCACTGGGGATGGGGAGG - Intergenic
1126340374 15:47634810-47634832 CTTCGGGGGTGGGGGCGGGGTGG + Intronic
1126837036 15:52678648-52678670 GTTTGGGGCTGGGGGCTGGGCGG - Intronic
1127988744 15:64095851-64095873 CTTAGGCGCTGGGGGCGGGGCGG - Intronic
1128322483 15:66703228-66703250 CTTTGGCGCCAGGGGTGGGGGGG - Exonic
1128566073 15:68700986-68701008 CTGAGGAGCTGGGGGCGGGATGG + Intronic
1129701865 15:77772901-77772923 CTTCGGCTCTGGGGACTGGGAGG + Intronic
1130121292 15:81049956-81049978 GTTAGGAGCTGGTGGGGGGGGGG - Intronic
1130923369 15:88367218-88367240 CTGAGGCTCAGGGGGTGGGGTGG + Intergenic
1131277404 15:90994034-90994056 CTGAGACGCTGCGGGCGGGGAGG + Intronic
1131819911 15:96261941-96261963 GGGAGGGGCTGGGGGCGGGGTGG - Intergenic
1132683481 16:1153085-1153107 CTGAGCGGCGGGGGGCGGGGCGG - Intergenic
1132808879 16:1788274-1788296 CTTGGGCACTGGGGGCATGGAGG - Intronic
1133197862 16:4183875-4183897 CGTGGGCGCTGGGGGCGGGGCGG - Intergenic
1133272857 16:4619176-4619198 CTTAGGGGATGGGGGTGAGGGGG - Intronic
1133416330 16:5609865-5609887 CAGAGACGGTGGGGGCGGGGTGG + Intergenic
1133597012 16:7303315-7303337 GTTAGGGGCTGGGGGCAGGAGGG - Intronic
1135040394 16:19113706-19113728 CTTGTGCGGTGGGGGTGGGGAGG + Intergenic
1136465323 16:30439166-30439188 CTTAAGCCCAGGAGGCGGGGAGG - Intergenic
1137509163 16:49082945-49082967 CTTAGGCCCTGGAGGCTGGGTGG + Intergenic
1137815233 16:51392202-51392224 TTTGGGAGCTGGGGGTGGGGGGG + Intergenic
1138515431 16:57533326-57533348 CTGGTGTGCTGGGGGCGGGGTGG - Intronic
1139691874 16:68646357-68646379 CCCAGACGCTGGGGGCGGGGTGG - Intronic
1139957501 16:70700158-70700180 CTTTGGGGCTGGGGGTGGGGAGG - Intronic
1140171298 16:72607621-72607643 TGTAGGGGCGGGGGGCGGGGTGG + Intergenic
1140865724 16:79060143-79060165 CTTGGGCAGTGGGGGTGGGGAGG + Intronic
1140961154 16:79914373-79914395 TTTGGGGGTTGGGGGCGGGGTGG + Intergenic
1141490269 16:84368135-84368157 CTAAGGCGCCGGGAGCGAGGTGG - Intergenic
1141617827 16:85220266-85220288 GTTAGGAGCTGGGGGCAGGCGGG + Intergenic
1141713452 16:85713691-85713713 CTGAGGCCCTGGGGGCGAGGAGG + Intronic
1141990200 16:87604920-87604942 CTGGGGCGCTGAGGGCCGGGCGG + Intronic
1142130712 16:88430441-88430463 CTAGGGCGCCGGGGACGGGGTGG - Exonic
1142212319 16:88814196-88814218 CTGAGGCGCCGTGGGCGAGGAGG + Exonic
1142212328 16:88814232-88814254 CTGAGGCGCCGTGGGCGAGGAGG + Exonic
1142374900 16:89701727-89701749 CCGTGACGCTGGGGGCGGGGCGG + Intergenic
1142577672 17:920359-920381 CCCAGGCGCTCGGGGCTGGGAGG - Intronic
1142699180 17:1649185-1649207 CCGAGGCGGTGAGGGCGGGGCGG - Exonic
1142753467 17:2001918-2001940 CTTCAGCCCTGGGGGAGGGGAGG + Intronic
1142795395 17:2303494-2303516 AGTAGGCGCTGGGGCCGCGGCGG - Intronic
1142980560 17:3668754-3668776 CGCAGGCGCGGAGGGCGGGGCGG + Intronic
1143231940 17:5363584-5363606 CTTAGGCGGAAGGGGCAGGGTGG - Intronic
1143792340 17:9307604-9307626 CTTAGGGCCTGGAAGCGGGGTGG + Intronic
1144839744 17:18178619-18178641 CTCAGGCCCTGGGGGAGGTGGGG + Intronic
1145312649 17:21708874-21708896 CTTAGGTGAGGGGGGTGGGGCGG + Intergenic
1147161675 17:38572491-38572513 CTAATGCGGTGGGGGAGGGGAGG + Intronic
1147864839 17:43545505-43545527 AGTAGGGGCTGGGTGCGGGGCGG + Intronic
1147968195 17:44205550-44205572 CCTTGGTGCTGGGGGTGGGGAGG - Exonic
1148189068 17:45666347-45666369 CTCAGGAGCTGGGGGAGAGGAGG - Intergenic
1148233456 17:45951688-45951710 TTGAGGCCCGGGGGGCGGGGTGG - Intronic
1148601725 17:48899280-48899302 CTGGGGCGGCGGGGGCGGGGGGG + Intergenic
1148818576 17:50347222-50347244 CAGGGGCGCTGGGGGCAGGGAGG - Intronic
1148857386 17:50586231-50586253 CTGAGGCCCTGGGGGCGGGTGGG - Intronic
1148899661 17:50866391-50866413 CGGAGGGGATGGGGGCGGGGAGG - Intronic
1149955433 17:61044158-61044180 CTTAAGAGGTGGGGGCGCGGTGG + Intronic
1150150724 17:62807354-62807376 CTTAAGAGTTGGGGGCGGGGTGG + Intronic
1150228651 17:63538050-63538072 CATCAGGGCTGGGGGCGGGGCGG - Exonic
1150488911 17:65561344-65561366 CGTGGGCGCGGGGGGCGGGAGGG - Intronic
1151426239 17:74032759-74032781 GTTAGAGGCTGGGGGAGGGGAGG - Intergenic
1151556051 17:74847275-74847297 CATAGCTGCTGGGGGTGGGGGGG - Intronic
1151657426 17:75502444-75502466 CTGAGGCGCTTGGGGGGCGGGGG + Exonic
1151765645 17:76132044-76132066 CCTGGGGGCTGTGGGCGGGGTGG + Intergenic
1152097002 17:78278318-78278340 CTGAGGCCCTGGGGGTGGGCAGG - Intergenic
1152345508 17:79748402-79748424 CTCAGGCGCTCCGGGCGGCGGGG - Intergenic
1152353869 17:79797587-79797609 CCTGGGCGGTGGGGGTGGGGCGG - Intronic
1152443507 17:80325675-80325697 CTGGGGCGCGGGGGGCTGGGGGG - Intronic
1152789954 17:82273529-82273551 TTGAGGCGCTGGGAGCGGCGGGG - Exonic
1152840671 17:82566055-82566077 GCCAGGGGCTGGGGGCGGGGAGG + Intronic
1153439838 18:5104194-5104216 TTTGGGCGCTGGGGGAAGGGGGG - Intergenic
1155556998 18:27030995-27031017 CTTATGGGATGGGGGTGGGGTGG - Intronic
1155760378 18:29558152-29558174 CTTTGGCGATGGGGGTGGGCAGG - Intergenic
1156325533 18:36071506-36071528 CCAAGGGGCTGGGGGCGGGGGGG + Intergenic
1159298224 18:66523898-66523920 CTCCGGGGGTGGGGGCGGGGGGG + Intronic
1160454847 18:78992959-78992981 CTGCGGCGCTGGCGCCGGGGCGG - Exonic
1160499184 18:79394121-79394143 CTGAGGAGCCGGGGCCGGGGCGG - Intergenic
1160789866 19:918396-918418 CAGGGGCGCTGGGGGAGGGGGGG + Intronic
1160914552 19:1490418-1490440 CTATGGCGCCGGGGGCGGGTCGG - Intronic
1161068883 19:2250801-2250823 CTCAGGGGCTGGGGGCCCGGGGG - Intronic
1161200020 19:3009480-3009502 CCCAGGGGCTGGGGGCCGGGAGG - Intronic
1161283517 19:3457785-3457807 CTGAGCGGATGGGGGCGGGGAGG + Intronic
1161394401 19:4037638-4037660 CGTTGACGCTGGGGGCGGGCAGG - Exonic
1161582089 19:5086649-5086671 CAGAGGCCCTGGGGGCTGGGGGG - Intronic
1161610146 19:5237886-5237908 CTGAGCCGCTGGGATCGGGGGGG - Intronic
1162032859 19:7924962-7924984 CTTACACGCTGGGGAGGGGGCGG + Exonic
1162079030 19:8208219-8208241 CAGGGGCGCGGGGGGCGGGGCGG - Intronic
1162315637 19:9936564-9936586 AAGAGGAGCTGGGGGCGGGGCGG - Intergenic
1163424880 19:17235862-17235884 CTTCGGCGCAGGGGGCGGCGCGG - Exonic
1163566153 19:18052324-18052346 GGTGGGGGCTGGGGGCGGGGAGG + Intergenic
1163672462 19:18636975-18636997 CCGAGACGCGGGGGGCGGGGCGG - Exonic
1164162128 19:22634200-22634222 CTCAGGGCCTGAGGGCGGGGGGG + Intergenic
1164707399 19:30330476-30330498 CTTTGGAGCTGGGGATGGGGAGG + Intronic
1165862427 19:38916191-38916213 CTGTGCCGCTGGGGACGGGGTGG - Intronic
1165944892 19:39436082-39436104 CTTAGGCGCTCAGAGCGGGCGGG + Intergenic
1165949313 19:39465045-39465067 CTCAGGTGCCCGGGGCGGGGTGG + Exonic
1166529557 19:43534384-43534406 CCTAGGGGCAGGGCGCGGGGCGG - Exonic
1166997808 19:46728119-46728141 CTCTGGCCCTGGGGGAGGGGGGG + Intronic
1167019049 19:46860983-46861005 CCTCGGGGCGGGGGGCGGGGAGG - Intergenic
1167066517 19:47190355-47190377 GTTTGGCTCTTGGGGCGGGGCGG + Intronic
1167368161 19:49065338-49065360 CTCAGGCGCCTGGGGCTGGGGGG - Intergenic
1167476107 19:49701739-49701761 CTTGGGGGCTGGGGGCGTGTGGG - Intronic
1167914076 19:52725913-52725935 CAGAGGCGCTGGGTGCGAGGCGG - Intronic
1168251990 19:55146736-55146758 GTTAGGAGCTGGGGGAGGGATGG + Intronic
1168277847 19:55286944-55286966 CATAGGCGCTGGGGACGAAGGGG + Intronic
1168675967 19:58278475-58278497 CTTAGCGGCTGGAAGCGGGGAGG - Intronic
926058953 2:9793338-9793360 CTTAGCCTCAGGGGGCAGGGAGG - Intergenic
926321236 2:11749513-11749535 CTTAGCAGCTGGGGTTGGGGTGG + Intronic
928118853 2:28567050-28567072 CTTGGGGGCCGGGGGCGGGGAGG + Intronic
928421774 2:31142759-31142781 TATAGGGGCTGGGGGGGGGGTGG - Intronic
930025917 2:47029095-47029117 CCCAGGCACTGGGGGCAGGGAGG - Intronic
930700514 2:54455606-54455628 CTTGGGCGCTGGAGGATGGGTGG - Intergenic
930730748 2:54725175-54725197 CTTTGTGGCTGGGGTCGGGGTGG + Exonic
934646179 2:96060470-96060492 CTTAGCTGCAGGGGGCGGGATGG + Intergenic
934977659 2:98816032-98816054 CATAGGGGCTGGTGGTGGGGGGG + Intronic
935710832 2:105896708-105896730 CTTAGGGGTTGGGAGCAGGGTGG + Intergenic
935969759 2:108519270-108519292 GTTAGGAGTTGGGGGCGGGGAGG + Intergenic
936133424 2:109867504-109867526 GTTAGGTGTTGGGGGCGGGGAGG + Intergenic
936211273 2:110503981-110504003 GTTAGGTGTTGGGGGCGGGGAGG - Intergenic
936420412 2:112358550-112358572 GTTAGGAGTTGGGGGTGGGGAGG - Intergenic
937360693 2:121227864-121227886 ATTAGGCCCTGTGGGAGGGGCGG - Intronic
941111104 2:161419060-161419082 CCTAGGGGCTGGGGGCGAGGCGG + Intronic
942150893 2:173075613-173075635 TTAAGGTGCTGGGGGCGAGGGGG + Intronic
943369596 2:187001495-187001517 CTCGGGGGCTGGGGGCAGGGAGG + Intergenic
943702741 2:191004150-191004172 CTTAGCAGATGGGGGCAGGGTGG - Intronic
943798561 2:192029157-192029179 CTTAGGGGTTGGGGGAAGGGAGG + Intronic
945878606 2:215304147-215304169 CTTAGGGACTGTGGGTGGGGAGG - Intergenic
946190917 2:218007551-218007573 CTGAGGCTCGGGGGGTGGGGGGG + Intergenic
946322470 2:218961804-218961826 CTGAGGCGCCGCGGCCGGGGTGG - Exonic
947435390 2:230068324-230068346 CTTGGGAGCTGCGGGCGGGCAGG - Intronic
948002729 2:234581606-234581628 CTGAGGGGCTGGGGACGGGGAGG - Intergenic
948505024 2:238422660-238422682 CTTGGGAGCTGGAGGAGGGGAGG + Intergenic
948571213 2:238918366-238918388 CTTAGGCTGTGGGGGGTGGGTGG - Intergenic
948690408 2:239699012-239699034 GTTAGGGGCTGGGGGCTGGGGGG - Intergenic
1168756771 20:324177-324199 CCGCGGCGCGGGGGGCGGGGTGG - Intergenic
1168965088 20:1894251-1894273 CGGGGGCGCGGGGGGCGGGGGGG - Exonic
1169345283 20:4823772-4823794 CTTCCGGGCTGGGGGTGGGGAGG + Intergenic
1170847870 20:19977175-19977197 CTTAGGGGCTGGGGTCAGAGGGG + Intronic
1172366781 20:34356062-34356084 CTTGTGGGGTGGGGGCGGGGGGG - Intergenic
1172944092 20:38674558-38674580 CCGGGGCTCTGGGGGCGGGGTGG - Intergenic
1173672110 20:44805991-44806013 CTGTTGGGCTGGGGGCGGGGTGG - Intronic
1173981891 20:47230850-47230872 GTCAGGCGCTGGGGGAGCGGGGG - Intronic
1174367915 20:50067592-50067614 CTTAGGAGATGGGGTGGGGGAGG - Intergenic
1174647827 20:52101315-52101337 CTTAGGGGCAGGAGGAGGGGTGG + Intronic
1175346022 20:58276721-58276743 CTTTGTTGGTGGGGGCGGGGGGG + Intergenic
1175762644 20:61571793-61571815 CTGAGGATCTGGGGGCAGGGAGG - Intronic
1175798664 20:61788328-61788350 CTGAGGGGCTGGGGGAGGGCTGG + Intronic
1175872813 20:62216479-62216501 CGTAGGCGCTGAGGCCGGGGAGG - Exonic
1175938701 20:62527233-62527255 CGTAGGGGGCGGGGGCGGGGGGG - Intergenic
1176042230 20:63071968-63071990 CTTTGGGGGCGGGGGCGGGGAGG - Intergenic
1176197126 20:63842506-63842528 CACAGGGGCTGGGGTCGGGGAGG + Intergenic
1176363150 21:6015761-6015783 TTGAGGTGCTGGGGGTGGGGAGG - Intergenic
1179605523 21:42513465-42513487 CTTTGGGGGTGGGGGCGCGGCGG + Intronic
1179760368 21:43522784-43522806 TTGAGGTGCTGGGGGTGGGGAGG + Intergenic
1179788557 21:43743052-43743074 CTCAGGAGCTGGGGGGAGGGAGG - Intronic
1179788588 21:43743152-43743174 CTCAGGAGCTGGGGGGAGGGAGG - Intronic
1179788709 21:43743506-43743528 CTCAGGGGCTGGGGGGAGGGAGG - Intronic
1179950035 21:44704189-44704211 CCTAGCCCCTGGGGGTGGGGAGG + Intronic
1179981821 21:44899853-44899875 CTCAGGCAATGGGGGCAGGGAGG + Intronic
1180042768 21:45288402-45288424 CTCTGGAGCTGGGGTCGGGGCGG + Intergenic
1180843530 22:18970107-18970129 CTTCTGTGCAGGGGGCGGGGGGG + Intergenic
1180846212 22:18983895-18983917 ATTAGCCAGTGGGGGCGGGGGGG - Intergenic
1181026612 22:20131127-20131149 CGACGGCGCTGTGGGCGGGGTGG - Intronic
1181854537 22:25772537-25772559 CTGAGGGGCTGAGGGCAGGGGGG + Intronic
1183258070 22:36775896-36775918 ATCGGGCGCTGGGGGCGGGTGGG + Exonic
1183299425 22:37051711-37051733 CCCGGGCGCTGGGGGCGGGCGGG - Intergenic
1183390969 22:37545651-37545673 CTAAGGGGCTGGGGTCCGGGAGG + Intergenic
1184035897 22:41917938-41917960 ATTGGGAGCTGGGGGCGGGGCGG - Intergenic
1184386132 22:44175669-44175691 CTGAGGCGTTGGGTGTGGGGGGG + Intronic
1184503645 22:44888548-44888570 CATAAGCAGTGGGGGCGGGGAGG - Intronic
1184606622 22:45578098-45578120 CTTAGGCGCTGGAGTCCGGGAGG + Intronic
1184766497 22:46575369-46575391 CCAAGGCTCTGGGGGAGGGGGGG - Intergenic
1184769669 22:46589861-46589883 CTGAGGGGCTGAGGGAGGGGAGG - Intronic
1184779274 22:46638205-46638227 CACAGGGGCTGGGGGCGTGGGGG + Intronic
949748689 3:7326042-7326064 CTTTGGGGCCGGGGGCGGGGAGG - Intronic
950634892 3:14307745-14307767 CTTAGGCGCTGGCCTCGAGGAGG - Intergenic
950831572 3:15879914-15879936 CTGGGGGGCTGGGGGCAGGGAGG - Intergenic
951577689 3:24130446-24130468 CTCAGGGGCTGGGGGGGCGGTGG + Intronic
952816790 3:37453118-37453140 TGTAGGAGCTGGGGGGGGGGGGG - Intronic
953761342 3:45689520-45689542 CTGAGGCGCGGCGGGCGGGGCGG + Intronic
954003894 3:47577921-47577943 CTCACGCGCTGCGGGCGGGAGGG + Exonic
955082052 3:55666628-55666650 ACTAGGGGCTGGGGGTGGGGTGG + Intronic
955082175 3:55668002-55668024 ACTAGGGGCTGGGGGTGGGGTGG - Intronic
955186058 3:56716601-56716623 GTTGGGCGGGGGGGGCGGGGGGG - Intergenic
955560882 3:60189225-60189247 TTTAGAAGCTGGGGGTGGGGGGG + Intronic
957833534 3:85554129-85554151 ATTAGGGGCTGGGGGGCGGGAGG + Intronic
960972559 3:123150242-123150264 CGTGGGCTCTGGGGGCGGGGGGG - Exonic
961525817 3:127496728-127496750 CATGGTCGGTGGGGGCGGGGGGG - Intergenic
963486164 3:145936531-145936553 CTTGTGTGCTGGGGGTGGGGAGG - Intergenic
963637365 3:147815682-147815704 GTGGGGCGGTGGGGGCGGGGAGG + Intergenic
963805024 3:149714256-149714278 CTTAGGGGCTGGGAGCAGGCAGG + Intronic
965264030 3:166518119-166518141 GTTGGGGGCTGGGGGAGGGGTGG - Intergenic
965615214 3:170585853-170585875 CTGGGGCGCGGGGGGCGCGGAGG + Intronic
966182289 3:177197848-177197870 CCGCGGCGGTGGGGGCGGGGCGG - Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968534467 4:1114108-1114130 ATGAGGCGGTGGGGGTGGGGGGG + Intergenic
968701179 4:2059007-2059029 CGTGGGAGCGGGGGGCGGGGCGG + Intergenic
968887153 4:3341158-3341180 TTTAGGGGCTGTGGGCGGAGGGG + Intronic
968907351 4:3460721-3460743 CTTACCTGATGGGGGCGGGGTGG + Intergenic
969309551 4:6345564-6345586 CTTGGCCGCTGTGGGCTGGGAGG + Intronic
969472605 4:7398152-7398174 CTTGTGCGGTGGGGGTGGGGTGG + Intronic
970142943 4:13002526-13002548 CCTAGGAGCTGGGGGCAGGGAGG - Intergenic
971479516 4:27101923-27101945 CTAAGGAGCTGGTGGCTGGGAGG + Intergenic
974069930 4:57114191-57114213 CTTAGGAGTTGGGGGTGGGGCGG + Intergenic
974626540 4:64433310-64433332 TTTAGGGGCTGGGGAGGGGGAGG + Intergenic
975664807 4:76725141-76725163 TTTTGGCGGTGGGGGTGGGGAGG - Intronic
975758802 4:77597832-77597854 CTTAGGTGCTGGTGGTGGGCAGG - Intronic
976287750 4:83386426-83386448 CTCTGGCGGTGGGGGTGGGGTGG - Intergenic
978619042 4:110621565-110621587 GTGCGGCGCTGGGGGAGGGGAGG - Intronic
980186309 4:129465170-129465192 CTTAAGTTCTGGGGGTGGGGGGG + Intergenic
980482542 4:133405551-133405573 ATTTGGGGCTGGGGGAGGGGTGG - Intergenic
981234569 4:142399850-142399872 CTTAGCAGGTGGGGGAGGGGTGG - Intronic
981422149 4:144563480-144563502 CTTACGCTCTGGAGGTGGGGTGG + Intergenic
984337745 4:178415028-178415050 CCTGTGCTCTGGGGGCGGGGAGG + Intergenic
985761720 5:1752324-1752346 TGCAGACGCTGGGGGCGGGGGGG + Intergenic
985877337 5:2609988-2610010 CTTGGGGGCGGGGGGGGGGGGGG + Intergenic
990509922 5:56481004-56481026 CTTGGGGGGTGGGGGCGGGGCGG - Intronic
991591027 5:68251566-68251588 TGTAGGTGGTGGGGGCGGGGTGG + Intronic
991970192 5:72133343-72133365 GTGAGGCGCTGGAGGCGGGATGG + Intronic
992828087 5:80569517-80569539 GCTGGGCGCTGGGGGCGGGCTGG - Intronic
993807949 5:92436312-92436334 CTAAGCCCCTGGGGGAGGGGTGG + Intergenic
994735448 5:103548190-103548212 ATTAGGTTCTGGGGGGGGGGAGG - Intergenic
999237714 5:150109056-150109078 CTTGGGTGGTGGGGGGGGGGCGG - Intronic
1000915074 5:167071881-167071903 GTTGGGGGTTGGGGGCGGGGGGG - Intergenic
1000931765 5:167261113-167261135 CTTAGCAGCTGGGGATGGGGAGG - Intergenic
1002001057 5:176196489-176196511 CCTGGGAGGTGGGGGCGGGGGGG - Intergenic
1002253278 5:177942483-177942505 CCTGGGAGGTGGGGGCGGGGGGG + Intergenic
1002600390 5:180351422-180351444 ATTTGGGGCTGGGGGCAGGGTGG - Intronic
1002711175 5:181195789-181195811 CCTTGGCGCTGGGTGCTGGGGGG - Intronic
1003324297 6:5081128-5081150 CTTGGGCGGGGGGGGGGGGGGGG + Intergenic
1004256715 6:14071259-14071281 CTTATGTGCTGGGGGTGGGGAGG + Intergenic
1004869334 6:19888876-19888898 CATTGGCTCTGGGAGCGGGGAGG - Intergenic
1005999779 6:30955856-30955878 CCTGGGGGCTGGGGGCTGGGAGG - Intergenic
1006185570 6:32179887-32179909 CTCTGGCCCTGGGGGCGGGGTGG - Exonic
1006700459 6:35968777-35968799 GTAAGGGGCTGGGGGCGGGGGGG - Intronic
1006830337 6:36964420-36964442 TTTAGGGGCTGGGGACAGGGTGG - Exonic
1006906982 6:37539237-37539259 ATTAAGAGCTGGGGGCGGGGTGG - Intergenic
1007366727 6:41399336-41399358 GTTAGGGGCTGGGGGTGGGGTGG - Intergenic
1007788995 6:44298142-44298164 CTTAGGCCCTGCGGGAGGGAGGG + Intronic
1011472549 6:87722251-87722273 CTTTGGCGGTGGAGGAGGGGTGG - Intergenic
1013330440 6:109094993-109095015 AGAAGGCGCTGGGGCCGGGGCGG - Intergenic
1016035002 6:139375309-139375331 GACAGGAGCTGGGGGCGGGGAGG + Intergenic
1017743741 6:157428630-157428652 CTCGGGGGCTAGGGGCGGGGTGG - Intronic
1018186955 6:161273796-161273818 GGTAGGCTCCGGGGGCGGGGGGG - Intronic
1019492182 7:1320558-1320580 CTGAGGCTCTGGGGGGGTGGGGG + Intergenic
1019711889 7:2521605-2521627 CTTGAGTGCTGGGGGTGGGGGGG - Intronic
1019989550 7:4682244-4682266 CGGCGGCGCGGGGGGCGGGGAGG - Intergenic
1020109812 7:5441742-5441764 CTTTGGCTGTGGGGGCAGGGAGG - Intronic
1021381198 7:19968628-19968650 CTTAGTCTCTGTGGGAGGGGAGG - Intergenic
1022556995 7:31307993-31308015 CTGAGGGGCAGGGGGCGGAGAGG + Intergenic
1023981616 7:45073815-45073837 CTTGGGTCCTGGGGGAGGGGAGG + Intronic
1025197986 7:56946903-56946925 CTGAGGGGTTGGGGGTGGGGTGG + Intergenic
1025673961 7:63630032-63630054 CTGAGGGGTTGGGGGTGGGGTGG - Intergenic
1026055060 7:66976534-66976556 ATTAAGCGGTGGGGGGGGGGGGG + Intergenic
1026172618 7:67967554-67967576 CCTAGGGGCTGGGGGCATGGCGG - Intergenic
1026365409 7:69643641-69643663 GTTCTGTGCTGGGGGCGGGGTGG - Intronic
1029363025 7:100100849-100100871 CGTAGGCCCCGGGGGCGGGCAGG - Intronic
1029566711 7:101343358-101343380 CTTTGGTGGGGGGGGCGGGGAGG - Intergenic
1030257917 7:107531625-107531647 ATTAGTCGGTGAGGGCGGGGGGG + Intronic
1031010777 7:116524540-116524562 CTTGGGCGATGGGCGGGGGGTGG + Intergenic
1032076935 7:128840525-128840547 CTGAGGAGATGGGGGCAGGGTGG - Intronic
1032215188 7:129952365-129952387 CGTAGGCACTGGGGGAGGAGGGG + Intronic
1032218715 7:129977820-129977842 CTTGGGGCCTGGGGGAGGGGTGG + Intergenic
1033097324 7:138442572-138442594 CTGGGGGGCTGGGGGCAGGGAGG - Intergenic
1034448796 7:151126547-151126569 TTTGTGTGCTGGGGGCGGGGCGG + Intronic
1034649237 7:152676248-152676270 CACAGGAACTGGGGGCGGGGCGG - Intergenic
1035029835 7:155849818-155849840 CCTAGGACCAGGGGGCGGGGTGG + Intergenic
1035327677 7:158075491-158075513 CTGCTGCGTTGGGGGCGGGGAGG - Intronic
1035516615 8:239188-239210 CATTGGCAGTGGGGGCGGGGAGG - Intronic
1037542411 8:19885335-19885357 CTGAGTCTCTGGGGGCAGGGTGG - Intergenic
1038310978 8:26445998-26446020 ACTAGGCAATGGGGGCGGGGGGG - Intronic
1038540495 8:28386322-28386344 CGGAGGCGCGGGGGGCGGGCGGG - Intronic
1039572808 8:38600899-38600921 CTCTGGCCCTGGGGGCGGGGTGG + Intergenic
1042887425 8:73567841-73567863 CTTACTCGCTGGGGGGGAGGGGG + Intronic
1044801885 8:95965461-95965483 CTTAGGGGTTGGGGGATGGGTGG + Intergenic
1044821537 8:96158981-96159003 GCTCGGGGCTGGGGGCGGGGGGG + Intronic
1045296790 8:100878548-100878570 CTCAGGCCCTGGGGGAAGGGTGG - Intergenic
1049194381 8:141307729-141307751 CCGAGGAACTGGGGGCGGGGAGG + Intronic
1049330420 8:142047536-142047558 CTTCGGCATTGGGGGCAGGGAGG - Intergenic
1049419483 8:142510581-142510603 CGGAGGAGCTGGGGGCGGCGGGG + Intronic
1049439758 8:142603930-142603952 CTTAGGAGATGGGGACGGGCAGG + Intergenic
1049472816 8:142783880-142783902 CTGAGGGGCTGGGGGCGAGTGGG - Intergenic
1049531493 8:143157817-143157839 CGGAGGGGCTGGGGGCAGGGCGG - Intergenic
1049565282 8:143334915-143334937 GCTGGCCGCTGGGGGCGGGGCGG - Intronic
1049569301 8:143360928-143360950 TGCAGGTGCTGGGGGCGGGGGGG + Intergenic
1049743644 8:144253401-144253423 CTCAGGCCTTGGGGGCCGGGTGG - Intronic
1050035803 9:1434637-1434659 TTTGGGGGCTGGGAGCGGGGAGG + Intergenic
1050516931 9:6454556-6454578 CGTAGGTGATGGGGGCTGGGGGG - Intronic
1051200083 9:14607612-14607634 GCTATGGGCTGGGGGCGGGGGGG + Intergenic
1052051046 9:23850237-23850259 CGGGGGTGCTGGGGGCGGGGGGG - Intergenic
1052580567 9:30349412-30349434 CATGGGCGGTGGGGGAGGGGAGG + Intergenic
1053298098 9:36929488-36929510 CTTAGGGGCTGGGGTTGGCGGGG - Intronic
1054308519 9:63449482-63449504 CGTCGGCGGTGGGGGGGGGGGGG + Intergenic
1055187502 9:73474279-73474301 TTTAGGGGCTGGGGAGGGGGAGG - Intergenic
1055308171 9:74952164-74952186 GGTAGGGGCTGGGGGCGGGTGGG - Exonic
1056246142 9:84697287-84697309 CATGGGCTCTGGGGGCGGAGGGG + Intronic
1056979842 9:91299520-91299542 TTTAGGGGTTGGGGGTGGGGAGG + Intronic
1057274497 9:93669193-93669215 CTTAGCCACGGGGGGCTGGGGGG - Intronic
1057282373 9:93722105-93722127 CGTTGGGGCTGGGGGCAGGGTGG - Intergenic
1057623310 9:96655346-96655368 GTTGGGCGCGGGGGGCGGGGCGG + Intergenic
1058437302 9:104974868-104974890 GTCGGGGGCTGGGGGCGGGGAGG + Intergenic
1058893934 9:109383876-109383898 CTGAGGGGCTGGGGTCTGGGAGG - Intronic
1059274715 9:113088083-113088105 CTTAGGGGCTGGGAGCTTGGAGG - Intergenic
1060302572 9:122383803-122383825 CTGAGAAGTTGGGGGCGGGGGGG + Intronic
1060468768 9:123930240-123930262 CGTGGCCGGTGGGGGCGGGGCGG + Intergenic
1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG + Intronic
1060982685 9:127802856-127802878 CTGATTGGCTGGGGGCGGGGCGG + Exonic
1061529070 9:131196026-131196048 TTTTGGCGCGGGGGGGGGGGGGG - Intronic
1061601676 9:131674611-131674633 CTTGGGCGGTGGGCGCGTGGAGG + Intronic
1061726422 9:132584486-132584508 GTATGGCGCTGGGGGTGGGGTGG - Intronic
1061905176 9:133693006-133693028 CTTCGGGGCTGGGGGCTGGCAGG - Intronic
1062286977 9:135777730-135777752 CAGAGGAGCTGGGGGTGGGGAGG - Intronic
1062334247 9:136058090-136058112 ATCAGCCACTGGGGGCGGGGGGG + Intronic
1186765632 X:12767962-12767984 CACAGGGGCTGGGGGTGGGGAGG + Intergenic
1188927482 X:36062690-36062712 TTCAGGGGCTGGGGGTGGGGTGG + Intronic
1189160051 X:38802029-38802051 CTTAAGCACTGGGGGTTGGGTGG + Intronic
1189322352 X:40094606-40094628 GATAGGCGCGGGAGGCGGGGAGG + Intronic
1189330090 X:40139112-40139134 ATAAGGTGCTGGGGGCTGGGAGG + Intronic
1190203582 X:48383972-48383994 CTTTGGTGCTCTGGGCGGGGTGG - Intronic
1190206954 X:48411432-48411454 CTTTGGTGCTCTGGGCGGGGTGG + Intronic
1190303901 X:49071812-49071834 ATTATGGGCTGGGGGTGGGGTGG + Exonic
1192016543 X:67337753-67337775 CTTGGGGGGTGGGGGCGGGGTGG - Intergenic
1192329586 X:70164377-70164399 TCTAGGAGCTGGGGGCAGGGAGG + Intronic
1193148935 X:78104907-78104929 TTTAGTGGCGGGGGGCGGGGGGG - Intronic
1193533611 X:82686459-82686481 CTGAGTCCCTGGGGGAGGGGTGG - Intergenic
1197378265 X:125709245-125709267 CTTGGGGGCTGGGGGCAGGTGGG + Intergenic
1197769956 X:130083355-130083377 CTTAGGCTGGGGGGGCAGGGGGG - Intronic
1200049779 X:153422569-153422591 TTTAGGCACTGGTGGTGGGGCGG - Intergenic
1202115350 Y:21466069-21466091 CTTAGGGGAAGGGGGCGGGGTGG + Intergenic