ID: 1127988832

View in Genome Browser
Species Human (GRCh38)
Location 15:64096156-64096178
Sequence ACTCACGACCACCGCGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 24}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127988832_1127988847 28 Left 1127988832 15:64096156-64096178 CCGGCGCCGCGGTGGTCGTGAGT 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1127988847 15:64096207-64096229 GGCACCCCGAAAGGGAAGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 171
1127988832_1127988839 3 Left 1127988832 15:64096156-64096178 CCGGCGCCGCGGTGGTCGTGAGT 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1127988839 15:64096182-64096204 CACCCCTCGGGGTAGCAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 108
1127988832_1127988842 6 Left 1127988832 15:64096156-64096178 CCGGCGCCGCGGTGGTCGTGAGT 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1127988842 15:64096185-64096207 CCCTCGGGGTAGCAGGCGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 148
1127988832_1127988845 19 Left 1127988832 15:64096156-64096178 CCGGCGCCGCGGTGGTCGTGAGT 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1127988845 15:64096198-64096220 AGGCGGGAGGGCACCCCGAAAGG 0: 1
1: 0
2: 0
3: 5
4: 104
1127988832_1127988844 7 Left 1127988832 15:64096156-64096178 CCGGCGCCGCGGTGGTCGTGAGT 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1127988844 15:64096186-64096208 CCTCGGGGTAGCAGGCGGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 151
1127988832_1127988846 20 Left 1127988832 15:64096156-64096178 CCGGCGCCGCGGTGGTCGTGAGT 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1127988846 15:64096199-64096221 GGCGGGAGGGCACCCCGAAAGGG 0: 1
1: 0
2: 0
3: 4
4: 85
1127988832_1127988834 -10 Left 1127988832 15:64096156-64096178 CCGGCGCCGCGGTGGTCGTGAGT 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1127988834 15:64096169-64096191 GGTCGTGAGTTTGCACCCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 53
1127988832_1127988837 -1 Left 1127988832 15:64096156-64096178 CCGGCGCCGCGGTGGTCGTGAGT 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1127988837 15:64096178-64096200 TTTGCACCCCTCGGGGTAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 53
1127988832_1127988838 2 Left 1127988832 15:64096156-64096178 CCGGCGCCGCGGTGGTCGTGAGT 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1127988838 15:64096181-64096203 GCACCCCTCGGGGTAGCAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 137
1127988832_1127988836 -8 Left 1127988832 15:64096156-64096178 CCGGCGCCGCGGTGGTCGTGAGT 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1127988836 15:64096171-64096193 TCGTGAGTTTGCACCCCTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1127988832_1127988835 -9 Left 1127988832 15:64096156-64096178 CCGGCGCCGCGGTGGTCGTGAGT 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1127988835 15:64096170-64096192 GTCGTGAGTTTGCACCCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127988832 Original CRISPR ACTCACGACCACCGCGGCGC CGG (reversed) Exonic
900123867 1:1060907-1060929 GCTCAGGAACACCGCGGTGCCGG - Intergenic
907947195 1:59146882-59146904 GCTCCCCACCAGCGCGGCGCGGG + Intergenic
1070327579 10:75398760-75398782 ACTGACCACCGCCTCGGCGCTGG - Exonic
1077325118 11:1960381-1960403 ACTCACGTACACCGCAGCCCAGG - Intronic
1077325543 11:1962384-1962406 ACTCACGTACACCGCAGCCCAGG - Intronic
1202808100 11_KI270721v1_random:15560-15582 ACTCACGTACACCGCAGCCCAGG - Intergenic
1202808523 11_KI270721v1_random:17563-17585 ACTCACGTACACCGCAGCCCAGG - Intergenic
1102300427 12:111767164-111767186 ACTAAGGCCCACGGCGGCGCGGG - Intronic
1122625621 14:103084131-103084153 ACTCACGCCCACCGCGGGGCTGG - Intergenic
1127988832 15:64096156-64096178 ACTCACGACCACCGCGGCGCCGG - Exonic
1128582046 15:68817718-68817740 AGTCACGGCGGCCGCGGCGCCGG - Intronic
1134202708 16:12212094-12212116 ACACACCACCACCGAGGCCCAGG - Intronic
1142409759 16:89910017-89910039 AATCACGACGACCGCTGTGCGGG - Intronic
1142591868 17:1009833-1009855 CCTCACGACCACAGGGGCCCTGG - Intronic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1165345676 19:35247952-35247974 AGTCACGCCCAGCGCTGCGCAGG + Intergenic
936944094 2:117915052-117915074 ACACACGGCCACCTCGGAGCTGG + Intergenic
1169342949 20:4810140-4810162 ACTCAGGACCAGCCTGGCGCTGG + Intronic
1185309616 22:50146690-50146712 CCTCACGACCACCGTGACGCTGG - Intronic
973159073 4:46993561-46993583 ACACACGCCCACCGCGGCTCGGG - Exonic
983904749 4:173170228-173170250 GCTCACGACCGCCGAGGCGGCGG + Intronic
990557835 5:56952485-56952507 ACCCACAGACACCGCGGCGCGGG + Intronic
996900860 5:128539227-128539249 ACTCCCCAGGACCGCGGCGCCGG - Intronic
998849583 5:146340258-146340280 ACGCACGTCCATCGCGGCGCCGG + Exonic
1035301888 7:157902546-157902568 TCTCCAGACCACCGCGGGGCTGG - Intronic
1035761081 8:2069343-2069365 TCTCACCACCACCGCCGCGTTGG - Exonic
1049989300 9:976863-976885 ACACACGACCACCGGGGCTGCGG + Intergenic
1061490069 9:130939610-130939632 ACTCGCGACCACAGCGCCGGCGG - Intergenic
1062232781 9:135491400-135491422 ACTTACTCCCACAGCGGCGCCGG - Intergenic