ID: 1127992452

View in Genome Browser
Species Human (GRCh38)
Location 15:64130804-64130826
Sequence GACAGAAGACCCATAGCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127992449_1127992452 19 Left 1127992449 15:64130762-64130784 CCCTCTTTGCCTTAAACATGCTG 0: 1
1: 0
2: 2
3: 15
4: 240
Right 1127992452 15:64130804-64130826 GACAGAAGACCCATAGCATGAGG 0: 1
1: 0
2: 0
3: 11
4: 118
1127992450_1127992452 18 Left 1127992450 15:64130763-64130785 CCTCTTTGCCTTAAACATGCTGA 0: 1
1: 0
2: 1
3: 24
4: 194
Right 1127992452 15:64130804-64130826 GACAGAAGACCCATAGCATGAGG 0: 1
1: 0
2: 0
3: 11
4: 118
1127992451_1127992452 10 Left 1127992451 15:64130771-64130793 CCTTAAACATGCTGATAATTAGA 0: 1
1: 0
2: 0
3: 24
4: 363
Right 1127992452 15:64130804-64130826 GACAGAAGACCCATAGCATGAGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127992452 Original CRISPR GACAGAAGACCCATAGCATG AGG Intronic
900416826 1:2539210-2539232 GACAGAAGGCCCATCTCCTGCGG + Intergenic
901138109 1:7010631-7010653 CACAGAAGGCTCATAGCATGGGG + Intronic
901562470 1:10083651-10083673 GACAGAAGCCCCAAGGCCTGAGG + Intronic
904451438 1:30615356-30615378 GACAAAAGACCCATGCCCTGGGG - Intergenic
905678977 1:39853061-39853083 GACAGAAGACTTACAGCATAGGG + Intronic
907012146 1:50973758-50973780 TGCGGAAGACCCATAGGATGGGG - Intronic
913286007 1:117227445-117227467 CACAGATTACCCATAGGATGTGG + Intergenic
915197482 1:154200643-154200665 GACAAAAAACCCATAGAGTGAGG + Intronic
917427639 1:174931695-174931717 CACAGAAGACCGATGGCAAGTGG - Intronic
918038065 1:180894723-180894745 GAGAGAAGAGGCATAGGATGTGG - Intergenic
920692598 1:208158487-208158509 GACACCAGCCCCAGAGCATGGGG + Intronic
920754963 1:208720810-208720832 GACAGATGACCAAAAGAATGTGG + Intergenic
921290349 1:213651102-213651124 GAGAGAAGACCCCCAGAATGGGG + Intergenic
921824123 1:219652573-219652595 GCTAGAAGACCCGTGGCATGGGG - Intergenic
922248212 1:223821180-223821202 GACAGAAGAACTAAAGCACGAGG + Intronic
1065967083 10:30779328-30779350 GACAGAAAAGCCATAACATTGGG + Intergenic
1072398625 10:95072296-95072318 GAGAGAATACGCAGAGCATGGGG - Intergenic
1073943768 10:108728402-108728424 AACAGACAACCTATAGCATGGGG + Intergenic
1075583312 10:123638808-123638830 GACATAAGGCCCAGAACATGTGG - Intergenic
1077489872 11:2855881-2855903 CATAGAAGAGCCATAGGATGGGG + Intergenic
1078187926 11:9068201-9068223 GACAGAAGACCCCTGCCATTTGG - Intronic
1081589085 11:44408442-44408464 AAAAGAAGACCCAGGGCATGAGG - Intergenic
1081731253 11:45373306-45373328 GACAGCAGCCCGATGGCATGGGG - Intergenic
1082095610 11:48127031-48127053 GACAGGAGGCCCAGAGCAGGAGG + Intronic
1090265885 11:125352621-125352643 GAAAGAAGCCCCACAGCATCTGG - Intronic
1095361033 12:41339635-41339657 AACAGACAACCCATAGAATGGGG + Intronic
1095837383 12:46653602-46653624 GACAGAAGACACATGGAAAGAGG + Intergenic
1098192203 12:67961216-67961238 GTCAGAGGAGCCATATCATGTGG + Intergenic
1101958556 12:109231215-109231237 GACAGCAGCCCCATCGCAGGGGG - Intronic
1102160927 12:110768191-110768213 AACAGAAAACCCACAGCTTGAGG - Intergenic
1106407448 13:29486248-29486270 TACAGCAGACCCATGGCATTAGG - Intronic
1107405846 13:40112492-40112514 GAAGGAAGAGCCATGGCATGAGG - Intergenic
1109246554 13:59961316-59961338 GACATAATACCCATATCATGAGG - Intronic
1109658918 13:65432993-65433015 GTCAGAAAACCCATAGCAAGTGG + Intergenic
1119645722 14:76346867-76346889 GACAGGAAATCTATAGCATGTGG - Intronic
1120242671 14:81967232-81967254 GACAGAACACCCCTGGAATGAGG - Intergenic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1125735282 15:41920530-41920552 GGGAGACGACCCCTAGCATGGGG - Intronic
1127992452 15:64130804-64130826 GACAGAAGACCCATAGCATGAGG + Intronic
1132032543 15:98450401-98450423 GAAAGAAGGCTCAAAGCATGGGG + Intronic
1132756678 16:1488548-1488570 GACACAAGCCTCATAACATGTGG - Intronic
1133254884 16:4510474-4510496 GAGAGTAGACCCAGAGCAGGAGG - Intergenic
1133994992 16:10741345-10741367 GACAGAAGATGGATAGCATCAGG + Intergenic
1138193188 16:55033421-55033443 GGAAGAAGACCCATAGCCTGGGG - Intergenic
1138580641 16:57938719-57938741 GGCTGAAGACCCATTGCGTGGGG + Intronic
1139833346 16:69818701-69818723 GACAGAAAACCCACAGATTGTGG - Intronic
1141944804 16:87302683-87302705 GACAGCAGACCCACTGGATGAGG - Intronic
1144229505 17:13187020-13187042 GAAGGAAAACCCACAGCATGCGG + Intergenic
1144267438 17:13584924-13584946 GACAGAAGCCACATGGCATGGGG - Intronic
1144733159 17:17540251-17540273 GACAGAAGACCCCCAACATGGGG + Intronic
1145790132 17:27621464-27621486 GAGAGAAGAGCCACAGCATGTGG + Intronic
1146950144 17:36900011-36900033 GGCAGAAGACCCAGGGCAGGTGG + Intergenic
1147794658 17:43033850-43033872 GACAGAAGACAGAAAGCAGGAGG + Intergenic
1150908005 17:69359207-69359229 GACAGAAGAGCTATGGCATTGGG + Intergenic
1151437655 17:74108007-74108029 GGCAGCAGAGCCTTAGCATGGGG - Intergenic
1152343046 17:79735710-79735732 AAAAGAAGACCCAGAGCCTGGGG - Intronic
1157047049 18:44113984-44114006 GAGAGAAGACCCATGGCGGGGGG - Intergenic
925983965 2:9200114-9200136 GAGAGAAGACCCCCATCATGGGG + Intergenic
926465549 2:13182034-13182056 GACAGAAGACCCAGAGCAACAGG + Intergenic
926551505 2:14306988-14307010 GACAGAAGAGTCATTGCAAGGGG - Intergenic
931160260 2:59682115-59682137 GACAGAATACCAAAAGCATTTGG - Intergenic
938250694 2:129813370-129813392 CACAGCAGACACAGAGCATGGGG + Intergenic
938638689 2:133256834-133256856 GAGAGAAGACACAGAGGATGAGG - Intronic
941027750 2:160476967-160476989 GAAAGAAAAGGCATAGCATGAGG - Intronic
943525872 2:189016761-189016783 GAGAGAAGAGCAATAGCATGAGG + Intergenic
945307660 2:208274162-208274184 GACAGAAGGCCAAGAGCAAGTGG - Intronic
948749761 2:240124879-240124901 GACAGAACATCCCTAACATGGGG - Intergenic
1170837555 20:19897599-19897621 CACAGAAGAACCAGAGCAGGAGG - Intronic
1179941277 21:44639915-44639937 GGCAGAAGACACATCGAATGAGG - Intronic
1183412357 22:37662380-37662402 GACAGGAGGCCCAGAGCATTTGG + Intronic
1185000316 22:48241613-48241635 TGCAGAACACCCAGAGCATGTGG + Intergenic
1185202688 22:49517673-49517695 TACAGAAGACCCTTAGAAGGGGG + Intronic
953177686 3:40566683-40566705 GACAAAAGCCTCATAGGATGGGG + Intronic
953643912 3:44735930-44735952 CACAGAAGTCCCACAACATGAGG - Exonic
955239689 3:57167601-57167623 AACAGATGTCCCTTAGCATGGGG - Intronic
958698609 3:97558493-97558515 GACAAAACACTCATAGCATTGGG - Intronic
958918034 3:100071542-100071564 GACAGAAGACCCACACCCTTGGG - Intronic
961678088 3:128580222-128580244 GGCAGTAGACCCAAAGCAAGAGG - Intergenic
962240049 3:133744565-133744587 GAAAGAAGACTGTTAGCATGAGG - Intergenic
962670070 3:137695779-137695801 AACATAAGACCCATAGCCTATGG + Intergenic
967781917 3:193449647-193449669 GACAGAAAACCCATGGCTAGTGG - Intronic
976773805 4:88684679-88684701 AACAGAAAACCTATAGAATGGGG + Intronic
977099201 4:92787823-92787845 GATAGAAGACCGATGACATGTGG + Intronic
981945921 4:150343940-150343962 GAGAGTAGACGGATAGCATGGGG - Intronic
982356784 4:154478580-154478602 GACACAAGAACCTTAGCATAGGG + Intronic
983070403 4:163261265-163261287 CTCTGAAGACCCATAGCACGGGG + Intergenic
987534769 5:19170434-19170456 GCCAGAAGACCCAGAGCAACAGG - Intergenic
989457036 5:41656440-41656462 CACAGCAGAGCCCTAGCATGAGG + Intergenic
994643356 5:102437736-102437758 GACAGAAAACAAAAAGCATGTGG - Intronic
995070677 5:107918167-107918189 GGCAGAAGACCCAGAGCAATGGG + Intronic
999821119 5:155230006-155230028 GAAAGAAGACTCATAGGTTGGGG - Intergenic
1001435292 5:171695079-171695101 GACAGAAGCCCCACAGCAGAGGG - Intergenic
1004169535 6:13285219-13285241 GACAGAAGACAGGAAGCATGGGG + Intronic
1008649045 6:53544874-53544896 GGCAGAAGACCGAGAGCAGGCGG + Exonic
1012607597 6:101177209-101177231 GAAAGAAGACCCTTCTCATGGGG - Intergenic
1012726706 6:102822948-102822970 GAGAGAAGAAACATTGCATGAGG - Intergenic
1016265172 6:142224120-142224142 GACAGCAGACCTATAGGATTAGG - Exonic
1016429642 6:143969281-143969303 GAGAGAAAACCAATTGCATGAGG - Intronic
1017031937 6:150231368-150231390 GACGGAAGACACAGAGCATTAGG - Intronic
1017039994 6:150300430-150300452 GACACCAGACCCTTAGGATGTGG + Intergenic
1019278505 7:188529-188551 GACAGAAGACCCCAGGCCTGAGG - Intergenic
1019919951 7:4157214-4157236 CACAGGAGACCCATTGCATGTGG + Intronic
1020115782 7:5475618-5475640 GACACAAGACCCAAAGCGGGGGG - Intronic
1023113657 7:36839337-36839359 ATCAGAAGACCTAGAGCATGAGG - Intergenic
1026955183 7:74372450-74372472 CACAGGAGACCCACAGGATGAGG - Intronic
1028299045 7:89173695-89173717 GACAGAAGACAGATAACAGGTGG - Intronic
1028573578 7:92319971-92319993 GACAAAAGACCCATAGCTCCAGG - Intronic
1028707163 7:93863081-93863103 GAGAGAAGAGCCACAGCATTAGG + Intronic
1029016048 7:97316364-97316386 CACAGGAGGCCCATAGCCTGGGG - Intergenic
1030996931 7:116370919-116370941 GGCATTAGGCCCATAGCATGGGG - Intronic
1031319629 7:120307951-120307973 GACAGAAGAACTAAAGCTTGTGG + Intronic
1033811224 7:145014286-145014308 CAGAGAAGACGCACAGCATGAGG - Intergenic
1034131567 7:148722951-148722973 GACAGACGACCTTGAGCATGTGG - Intronic
1036477877 8:9110128-9110150 GGCAGAGGATTCATAGCATGTGG + Intronic
1036525881 8:9534442-9534464 GACATAGGACCCATAGCAAGGGG + Intergenic
1037812360 8:22094668-22094690 GACAGAAGACCCAGAGCCCTGGG + Intronic
1040894353 8:52350142-52350164 GACAGAAAACCCAAAGTGTGTGG + Intronic
1047480326 8:125276029-125276051 GACAGAAGACCCAGTGCGGGGGG - Intronic
1049229826 8:141476158-141476180 GACAGAGGGCCATTAGCATGGGG + Intergenic
1049679407 8:143910982-143911004 GCCAGAAGACCCTGACCATGGGG + Intergenic
1050737334 9:8779137-8779159 GACAGTATACCCATAGCAGAAGG + Intronic
1058807412 9:108605699-108605721 GACAGAAGCCAACTAGCATGGGG + Intergenic
1061453447 9:130681288-130681310 GGCAGATGACGCATCGCATGCGG - Exonic
1185887487 X:3795973-3795995 GACACAAGTCCTATAGGATGAGG + Intergenic
1186652447 X:11575522-11575544 GACAGGTGACTCATATCATGTGG + Intronic
1189726591 X:43973371-43973393 GACAGAAGAACAAAAGCATTTGG - Exonic
1191938179 X:66448284-66448306 GACCGAAGACCCAGAGAATAAGG + Intergenic
1194671076 X:96733393-96733415 GAGAGAAGAGCCAGTGCATGTGG + Intronic
1200855680 Y:7935539-7935561 GTCAGAAGACCCACATCATCTGG + Intergenic
1200859010 Y:7970171-7970193 GGCAGAAGAGCCATATCATCTGG + Intergenic