ID: 1127994482

View in Genome Browser
Species Human (GRCh38)
Location 15:64145160-64145182
Sequence GGGTCATGAGTGCACCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127994482_1127994489 13 Left 1127994482 15:64145160-64145182 CCTGCAGGGTGCACTCATGACCC 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1127994489 15:64145196-64145218 GTTCAGGGAGCTGAAGCAGCTGG 0: 1
1: 0
2: 12
3: 55
4: 749
1127994482_1127994490 19 Left 1127994482 15:64145160-64145182 CCTGCAGGGTGCACTCATGACCC 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1127994490 15:64145202-64145224 GGAGCTGAAGCAGCTGGCCCAGG 0: 1
1: 2
2: 8
3: 76
4: 712
1127994482_1127994488 -2 Left 1127994482 15:64145160-64145182 CCTGCAGGGTGCACTCATGACCC 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1127994488 15:64145181-64145203 CCACACTAAGGACAGGTTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 134
1127994482_1127994486 -3 Left 1127994482 15:64145160-64145182 CCTGCAGGGTGCACTCATGACCC 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1127994486 15:64145180-64145202 CCCACACTAAGGACAGGTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 109
1127994482_1127994484 -9 Left 1127994482 15:64145160-64145182 CCTGCAGGGTGCACTCATGACCC 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1127994484 15:64145174-64145196 TCATGACCCACACTAAGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127994482 Original CRISPR GGGTCATGAGTGCACCCTGC AGG (reversed) Intronic
902162088 1:14538900-14538922 GGGTCCTGGGTGCCCCTTGCTGG + Intergenic
902724244 1:18324444-18324466 GGCTCATGACCGCCCCCTGCAGG - Intronic
904385857 1:30141678-30141700 TGCTCATGAGTGGACTCTGCTGG + Intergenic
904478548 1:30779756-30779778 GGGTCAAGGGCGCCCCCTGCTGG + Intergenic
904617876 1:31759775-31759797 GGGTCATCAGTGCCCCCAGGAGG - Intronic
904841932 1:33377967-33377989 AGGTCAAGAGTGCAGCTTGCAGG - Intronic
905463161 1:38134410-38134432 GGATCTTGATTGCACCCAGCAGG - Intergenic
906065630 1:42978454-42978476 GGGACAGGAGTCCACCCTGGGGG + Intergenic
907597384 1:55732438-55732460 AGGCCATCAGTGCACCCTGTGGG - Intergenic
915250691 1:154586220-154586242 GGGTCAACAGTGCCCCTTGCAGG + Exonic
915443636 1:155962165-155962187 GGTACAGGAGTGCATCCTGCTGG - Exonic
915471931 1:156130784-156130806 GGGCCATGGGTGGGCCCTGCAGG - Intronic
923386851 1:233473281-233473303 GGGTCATGCGTGAACCCTGTGGG + Intergenic
1063457061 10:6191309-6191331 GGGTCTTGAGCGGTCCCTGCTGG - Intronic
1065484877 10:26227944-26227966 GGGTGATGAGTGCTCTGTGCTGG + Intronic
1069829913 10:71276781-71276803 GGACCATGAGTGGACTCTGCTGG - Intronic
1071599947 10:86954183-86954205 GGGAGATGAGGGCACCCAGCAGG - Intronic
1072804983 10:98418520-98418542 CGCTCAGGAGGGCACCCTGCAGG + Intronic
1076873064 10:133202968-133202990 GGGGGCTGAGTGCTCCCTGCTGG - Intronic
1078198152 11:9153902-9153924 GGGTAATGAGTGAGCCCAGCTGG + Intronic
1078889730 11:15543732-15543754 GGGTCTTGAATGGACCGTGCAGG + Intergenic
1079175419 11:18135802-18135824 GGATCATGAGTCAGCCCTGCTGG + Intronic
1079266279 11:18936156-18936178 GGATCATGAGTCAGCCCTGCTGG - Intronic
1079268427 11:18958388-18958410 GGATCATGAGTCAGCCCTGCTGG - Intergenic
1079269855 11:18974075-18974097 GGATCATGAGTCAGCCCTGCTGG - Intergenic
1079455961 11:20636479-20636501 GGGTCCTGGGTTCACCCTTCAGG + Intronic
1084512835 11:69616807-69616829 GGCTCAGCTGTGCACCCTGCAGG - Intergenic
1084943689 11:72627603-72627625 GGGACATGAGGGGACCCAGCAGG + Intronic
1085034245 11:73290745-73290767 GGGTCATGGGTGCACCTGGGAGG - Intronic
1085574590 11:77590574-77590596 AGGTGATGAGTGCAGCCAGCAGG - Exonic
1090416175 11:126542008-126542030 GGGTCCTGAGGGCCCGCTGCAGG - Intronic
1091827124 12:3521153-3521175 GGGACATGGGTGCTCCCTGATGG + Intronic
1094818715 12:34209052-34209074 GGCTCACGAGAGCACCCTGTGGG + Intergenic
1096489517 12:52006250-52006272 GGGGCTTGAGTGATCCCTGCTGG - Intergenic
1098756084 12:74365185-74365207 GGGTCAGGAGTTCATGCTGCCGG - Intergenic
1105624881 13:22103183-22103205 GCCTCATGAGGGCCCCCTGCTGG + Intergenic
1106417761 13:29559575-29559597 AGGACATGACTGCACACTGCTGG + Intronic
1108766500 13:53637091-53637113 GGGAGATGAGTGTACCCTACTGG - Intergenic
1113513959 13:110876689-110876711 GGGTCAAGAGTGCCCCCTCTAGG + Intergenic
1113627337 13:111856777-111856799 AGGCCCTGAGTGCACCCGGCAGG + Intergenic
1118251959 14:64170587-64170609 GGGTGGTGACTGCACCTTGCTGG - Intronic
1120948739 14:90021913-90021935 GGGTCATGACGGAAGCCTGCTGG - Intronic
1122003256 14:98682211-98682233 GCCACATGAGTCCACCCTGCTGG - Intergenic
1123132392 14:105999418-105999440 GGTTCCTGAGTGCCCCCTGGTGG + Intergenic
1123132669 14:106000521-106000543 TGGTCCTGAGTGCCCCCTGGTGG + Intergenic
1123132730 14:106000760-106000782 TGGTCCTGAGTGCCCCCTGGTGG + Intergenic
1123132754 14:106000841-106000863 TGGTCCTGAGTGCCCCCTGGCGG + Intergenic
1123132797 14:106001019-106001041 TGGTCCTGAGTGCCCCCTGGTGG + Intergenic
1123132821 14:106001100-106001122 TGGTCCTGAGTGCCCCCTGGTGG + Intergenic
1123132845 14:106001181-106001203 TGGTCCTGAGTGCCCCCTGGTGG + Intergenic
1123132869 14:106001262-106001284 TGGTCCTGAGTGCCCCCTGGTGG + Intergenic
1123132893 14:106001343-106001365 TGGTCCTGAGTGCCCCCTGGTGG + Intergenic
1123137771 14:106045395-106045417 GTGTCCTGAGTGCCCCCTGCTGG + Intergenic
1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG + Intergenic
1123187077 14:106530524-106530546 GTGTCCTGAGTGCCCCCTGGTGG + Intergenic
1123203645 14:106691887-106691909 GTGTCCTGAGCGCCCCCTGCAGG + Intergenic
1123218152 14:106831426-106831448 GGTTCCTGAGTGCCCCCTGGTGG + Intergenic
1123223596 14:106879324-106879346 GTGTCCTGAGTGCCCCCTGGTGG + Intergenic
1123401896 15:19995527-19995549 GGGTCCTGAGTGCCCCCAGCTGG + Intergenic
1123511236 15:21002190-21002212 GGGTCCTGAGTGCCCCCAGCTGG + Intergenic
1123582700 15:21730866-21730888 GTGTCATGAGCGCCCCCTGGTGG + Intergenic
1123582920 15:21731789-21731811 TGGTCCTGAGTGCCCCCTGGTGG + Intergenic
1123619350 15:22173462-22173484 GTGTCATGAGCGCCCCCTGGTGG + Intergenic
1123619570 15:22174385-22174407 TGGTCCTGAGTGCCCCCTGGTGG + Intergenic
1127994482 15:64145160-64145182 GGGTCATGAGTGCACCCTGCAGG - Intronic
1131218530 15:90560780-90560802 GGCTCCTGATTGCACCCTGCAGG + Intronic
1132415679 15:101617165-101617187 GGGCCAAGTGGGCACCCTGCTGG - Intergenic
1132676958 16:1124874-1124896 GGGTCCTGAGTGGGCCCAGCTGG + Intergenic
1133139284 16:3732405-3732427 GGGCCTTGAGTGGACCCCGCAGG - Intronic
1135487577 16:22879492-22879514 GGGTGATGAGCACACTCTGCTGG + Intronic
1136275368 16:29176653-29176675 GGCTCATCAGCTCACCCTGCGGG + Intergenic
1136691953 16:32039163-32039185 GTGTCCTGAGTGCCCCCTGGTGG - Intergenic
1136692056 16:32039504-32039526 GTGTCCTGAGTGCCCCCTGGTGG - Intergenic
1136792537 16:32982725-32982747 GTGTCCTGAGTGCCCCCTGGTGG - Intergenic
1136792599 16:32982942-32982964 GTGTCCTGAGTGCCCCCTGGTGG - Intergenic
1136877257 16:33871112-33871134 GTGTCCTGAGTGCCCCCTGGTGG + Intergenic
1138386105 16:56636568-56636590 TGGCCCTGAGTGCACCCTTCTGG + Intergenic
1138584758 16:57962595-57962617 GGTTCATCTGTGCACCCTGCAGG + Exonic
1142079728 16:88142718-88142740 GGCTCATCAGCTCACCCTGCGGG + Intergenic
1142351879 16:89584329-89584351 GGGTCATGAGTGGTCCCCACAGG - Intronic
1203094743 16_KI270728v1_random:1244190-1244212 GTGTCCTGAGTGCCCCCTGGTGG - Intergenic
1203094814 16_KI270728v1_random:1244421-1244443 GTGTCCTGAGTGCCCCCTGGTGG - Intergenic
1143633607 17:8152144-8152166 GGGTCAGGAGTGCAGACTCCCGG + Intronic
1144667617 17:17112578-17112600 CGGTCCTGAGTGAGCCCTGCAGG - Intronic
1144794185 17:17880014-17880036 GTGTCAGGAGTGCACCAAGCTGG + Intronic
1146194486 17:30799846-30799868 GGGTGATGAGTGTACACTCCTGG + Intronic
1148189079 17:45666390-45666412 GGGTCTTTACTGCACCCTGCTGG + Intergenic
1148838986 17:50482636-50482658 GGGTACTGAGCGCCCCCTGCGGG - Exonic
1152512490 17:80799814-80799836 TGGTCCTGAGTGCAGGCTGCAGG + Intronic
1153922434 18:9803778-9803800 GGGGCATGAGGGGACCCTGACGG + Intronic
1161632817 19:5367419-5367441 GGGTGATGAGTGCTGCCTCCTGG + Intergenic
1161984725 19:7647090-7647112 GGGTCAGGAGTGCCCCCCACGGG - Intronic
1162295560 19:9811081-9811103 GGGTGACGAGGGGACCCTGCAGG + Exonic
1163411006 19:17154452-17154474 GGGCCATGCGTGCCCCCTGTAGG - Intronic
1164577353 19:29413305-29413327 GGCCCATGAGTGAGCCCTGCCGG + Intergenic
1164722855 19:30444861-30444883 GGGTCATGAAGCCACTCTGCAGG - Exonic
1167211982 19:48139238-48139260 GGGTGATTAATGCCCCCTGCAGG + Intronic
931615602 2:64153567-64153589 GGGTTATGTGGGCACCCAGCTGG - Intergenic
932657164 2:73620129-73620151 GAGCCATGAGTGCCCCCTGGAGG - Intergenic
936172104 2:110185581-110185603 GGGTCCTCAGGGCACCCTGGTGG - Intronic
938263685 2:129911861-129911883 GAGGCATGAGTGGACCCTGGGGG + Intergenic
938798501 2:134738704-134738726 GGGTCATGTGTCCACACTGTGGG + Intergenic
939850814 2:147302067-147302089 GGGTCAAAACTACACCCTGCAGG - Intergenic
942481301 2:176391529-176391551 GGGTGATGAGTGCAGCCTGGGGG - Intergenic
948629809 2:239294811-239294833 GGGTCATGTGAGCACCATCCAGG + Intronic
1170474309 20:16699814-16699836 GGGTGCCGAGTCCACCCTGCTGG + Intergenic
1175268943 20:57720255-57720277 GTGACCTGAGTGCAGCCTGCAGG + Intergenic
1175410460 20:58764338-58764360 GGGTCATGCCTGCACTGTGCTGG + Intergenic
1175820308 20:61905547-61905569 GGGGCAGGAGGGCACCCTCCTGG - Intronic
1176250435 20:64117839-64117861 GGGGCATGAGGGCACCGTGATGG + Intergenic
1179955459 21:44735770-44735792 GGGTCACGGGTGCTCCCTGCAGG + Intergenic
1182349295 22:29690009-29690031 CGTTCCTGAGTGCCCCCTGCTGG - Intronic
1183374907 22:37457492-37457514 GATGCATGAGTGCCCCCTGCTGG + Intergenic
1184168223 22:42743244-42743266 GGGTCCTGGGAGGACCCTGCAGG + Intergenic
1184474429 22:44712848-44712870 TGGTCATGAGTGCCCGCTGCTGG - Intronic
1185380820 22:50506862-50506884 GGGCCACTAGTGCACCCAGCAGG + Exonic
950362865 3:12462230-12462252 GGGCCATGGGTGCACACAGCTGG + Intergenic
950534779 3:13572473-13572495 GGGTCAGGAGTGCAGGCTCCAGG - Intronic
952512244 3:34069267-34069289 GGGTCATGGGAGGCCCCTGCTGG - Intergenic
952722185 3:36545072-36545094 GGGAGATGAGTGCACCCACCTGG - Intronic
952863450 3:37833963-37833985 GAGGCATGAGGGCACCCTGCTGG + Intergenic
954581007 3:51702931-51702953 GGATGATGAGAGCACTCTGCTGG - Intronic
956423732 3:69111356-69111378 GGGGTATGACTGCACCCTGCAGG + Intronic
958765887 3:98367633-98367655 GGGTGATGGGTGCACCCTTGTGG + Intergenic
960148208 3:114225858-114225880 GGGTCATGAGACCCACCTGCAGG + Intergenic
962688204 3:137867792-137867814 GGGTCATGGGTACAGGCTGCAGG - Intergenic
962843526 3:139255823-139255845 GGCTGATGGGTGCACCCAGCAGG - Intronic
968473923 4:794226-794248 GGGCCATGCCTGCATCCTGCAGG + Intronic
969056963 4:4408141-4408163 GGCTCAGGAGGGCACTCTGCTGG + Intronic
969260955 4:6033200-6033222 GGGACATCACTGCACCCTGTGGG + Intronic
969315118 4:6377287-6377309 GGGAGATGTGTCCACCCTGCTGG + Intronic
976828174 4:89283625-89283647 GTGTTATGAGTGCACAATGCTGG + Intronic
986139793 5:5018691-5018713 GTGTCATCACTGCACCATGCCGG + Intergenic
989526944 5:42464573-42464595 GGGTCATGAATCCATTCTGCAGG + Intronic
990721614 5:58702037-58702059 AAGTCATGAGTGCTCCATGCAGG - Intronic
992011463 5:72531881-72531903 TGGTCATTAGTTCACCCTGGTGG - Intergenic
992231735 5:74670712-74670734 GGGTCATGGGTGCACCTGCCCGG + Intronic
997587847 5:135054396-135054418 GGGTCATCAGTTAACCTTGCTGG + Intronic
998261494 5:140635161-140635183 GGCTCATCACTGCCCCCTGCGGG + Intergenic
998570406 5:143251773-143251795 GCATCATCAGTCCACCCTGCAGG - Intergenic
1002170198 5:177370602-177370624 GGATCAGGACTGCACCGTGCTGG + Exonic
1002574167 5:180162064-180162086 GGGACATGAGGCCACCCTGAAGG - Intronic
1006800709 6:36757968-36757990 GGGTCATCAGAGTTCCCTGCAGG - Intronic
1011671047 6:89683276-89683298 CAGTCCTGAGTGAACCCTGCCGG - Exonic
1018374088 6:163194914-163194936 TGGTCATCAGTGCACTTTGCAGG + Intronic
1018652400 6:166003124-166003146 GGCTCCTGGGTGCAGCCTGCTGG - Intergenic
1019608257 7:1921050-1921072 GGGTCCTGAGTCCCCACTGCTGG - Intronic
1022281885 7:28919395-28919417 GGGTCATGAGTGGACAATGAAGG - Intergenic
1022347128 7:29527496-29527518 GGGTCATGAGTGCTTCCTCATGG + Intergenic
1029129976 7:98322517-98322539 GGGACATGGCTGCACCCTACAGG - Intronic
1029732405 7:102447022-102447044 CGGGCATGAGCGCAGCCTGCAGG + Exonic
1035291915 7:157844626-157844648 TGGTGATGAGGGCACACTGCTGG + Intronic
1042922389 8:73932577-73932599 GGGTAATGAGCTCACCCTGCAGG + Intergenic
1044080145 8:87873263-87873285 GAGTCATGATTGCAAACTGCTGG + Exonic
1049154865 8:141060278-141060300 GGGTCCTGAGTGGACACGGCGGG + Intergenic
1049289748 8:141795492-141795514 GGGCCAGGAGTTCAACCTGCAGG + Intergenic
1049432991 8:142573866-142573888 GGGTCATGAGAGGGACCTGCGGG + Intergenic
1049560257 8:143306800-143306822 GGGACGTGAGAGCCCCCTGCTGG + Intronic
1050276834 9:4009436-4009458 GGGCCATGGCTGCACCTTGCTGG - Intronic
1056712484 9:89002003-89002025 GGGGCACGCCTGCACCCTGCAGG - Exonic
1056957675 9:91095654-91095676 GGGTCATGGCTGCAGCTTGCTGG + Intergenic
1057064414 9:92035276-92035298 TGGTCATAAGTCCAGCCTGCAGG - Intronic
1060277406 9:122192547-122192569 GTGACATTAGTGCAGCCTGCAGG - Intronic
1062524568 9:136973022-136973044 GGGCCAGGAGAGCACCCAGCTGG - Intergenic
1185777464 X:2816196-2816218 GGGTCATGAGGACCACCTGCTGG + Intergenic
1192159301 X:68770909-68770931 AGGTCATGAATGCATCCTCCTGG - Intergenic
1200239550 X:154486536-154486558 GGGCCGCGAGTGCAGCCTGCAGG - Exonic
1201292523 Y:12434932-12434954 GGGTCATGAGGACCACCTGCTGG - Intergenic
1201638608 Y:16153822-16153844 GGGTCATGGGTGCAACTGGCTGG - Intergenic
1202107448 Y:21385594-21385616 TGGTCATGAGTGGACCCAGAGGG + Intronic
1202368564 Y:24182833-24182855 GGGGCATGAGTGCACCTGGTGGG + Intergenic
1202502221 Y:25487284-25487306 GGGGCATGAGTGCACCTGGTGGG - Intergenic