ID: 1127996913

View in Genome Browser
Species Human (GRCh38)
Location 15:64158515-64158537
Sequence TAGGGCAGGCAGGCTGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 504}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127996913_1127996925 17 Left 1127996913 15:64158515-64158537 CCCCCAGCAGCCTGCCTGCCCTA 0: 1
1: 0
2: 5
3: 58
4: 504
Right 1127996925 15:64158555-64158577 CTGCCACCACATGACTCCCCTGG 0: 1
1: 0
2: 0
3: 43
4: 247
1127996913_1127996919 -8 Left 1127996913 15:64158515-64158537 CCCCCAGCAGCCTGCCTGCCCTA 0: 1
1: 0
2: 5
3: 58
4: 504
Right 1127996919 15:64158530-64158552 CTGCCCTAGCCTCCACATCCTGG 0: 1
1: 0
2: 1
3: 28
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127996913 Original CRISPR TAGGGCAGGCAGGCTGCTGG GGG (reversed) Intronic
900339450 1:2181114-2181136 AGGGCCAGGCAGGATGCTGGTGG - Intronic
900765617 1:4503184-4503206 TGGGGCAGGGAGAGTGCTGGGGG + Intergenic
900929995 1:5730396-5730418 TCTGGCCGGCAGGCTGCAGGCGG - Intergenic
901226293 1:7614712-7614734 TGGGCCAGGCAGGCTGATGGTGG - Intronic
901737179 1:11320007-11320029 TGGGGCAGGCACTCTGCTTGGGG - Intergenic
903284287 1:22267465-22267487 TTGGGCAGGGATGCTGCAGGTGG + Intergenic
903372784 1:22847602-22847624 GGGCCCAGGCAGGCTGCTGGAGG + Intronic
903741418 1:25560653-25560675 TGGGGCAGCAGGGCTGCTGGGGG + Intronic
904395198 1:30215676-30215698 CAGCACAGGCAGGCTGCTGATGG + Intergenic
904442460 1:30540633-30540655 ATGGACAGGCAGGCTCCTGGAGG - Intergenic
904675892 1:32199103-32199125 TATGGGAGACATGCTGCTGGTGG + Intergenic
904904375 1:33883989-33884011 TAGGCCAGGCAGGAAGCTAGAGG + Intronic
905638839 1:39575253-39575275 CAGGGCAGGCAGGAAGCAGGGGG - Intronic
905986114 1:42284074-42284096 TAGGGTAGGCAGTCTGCGGCTGG - Intronic
906101609 1:43267479-43267501 TGAGGAAGGCGGGCTGCTGGAGG + Intronic
906262914 1:44406954-44406976 TAGGGCAGCCAGGAGGCAGGGGG + Intronic
906477762 1:46181333-46181355 TATGGCAGCCTGGCTGCTGCTGG - Intronic
906521931 1:46472354-46472376 GGGGGCAGGCGGGCGGCTGGGGG - Intergenic
906607829 1:47183837-47183859 TAGGGCCGGCATGGGGCTGGAGG + Exonic
906804266 1:48764896-48764918 TGGGGCAGGCTTGCTTCTGGAGG + Intronic
906966047 1:50457653-50457675 TGAGGCAGGCAGACTGCTTGAGG + Intronic
907142988 1:52205603-52205625 CAAGGCAGGAAGGCTGCTTGAGG - Intronic
907548914 1:55287574-55287596 CTGGGCAGGCAGGATTCTGGGGG + Intergenic
908762448 1:67524619-67524641 AAGGGCAGGGAGGCAGCTTGAGG + Intergenic
908877312 1:68692114-68692136 TAGAAAAGGAAGGCTGCTGGAGG - Intergenic
909481508 1:76132321-76132343 GAGGGAAGGCAAGCTGCTGCTGG - Intronic
909496183 1:76281477-76281499 GAGTGCAGGCACACTGCTGGAGG - Intronic
911039673 1:93582024-93582046 GAGGGATGGCAGGCTGCTGCCGG - Intronic
911650024 1:100377270-100377292 TGGGGCAGGCAGACTGCCTGAGG - Intronic
912052368 1:105545252-105545274 TAGGCTTGGCAGGCTTCTGGTGG + Intergenic
913573025 1:120140421-120140443 TAAGGCAGGCAGACTACTTGAGG - Intergenic
915315385 1:155025938-155025960 TGAGGCAGGCAGACTGCTTGAGG - Intronic
915319360 1:155047777-155047799 TGGGGCAGGCAGGCTAGGGGAGG - Exonic
916212138 1:162367751-162367773 CAGGACTGCCAGGCTGCTGGAGG + Exonic
916726303 1:167526765-167526787 CAGGGCTGGCAAGCAGCTGGAGG + Intergenic
917932783 1:179835835-179835857 GAAGTCAGACAGGCTGCTGGCGG - Intergenic
919774797 1:201187486-201187508 TCGGCTAGGCAGGCAGCTGGGGG + Intergenic
919892146 1:201983135-201983157 AAGGGCAGGCAGGCAGCGGCGGG - Intronic
919927711 1:202200898-202200920 ATGGGCAGGCCGGCGGCTGGCGG + Intronic
920313409 1:205061528-205061550 TAGGGCAAGCAGGCTCATGCAGG - Intronic
920700959 1:208217813-208217835 TGAGGCATGCCGGCTGCTGGGGG + Exonic
920764771 1:208821667-208821689 AAGGGAAGGCAGGCTGCTGCTGG + Intergenic
920940434 1:210477147-210477169 TAAGGCAGGGAGGGTGCTGGAGG + Intronic
921152272 1:212412181-212412203 AAGGGCAGGGAGGCTGGTGAAGG + Intronic
922240285 1:223751157-223751179 GAAGGCACTCAGGCTGCTGGAGG - Intronic
923475133 1:234324945-234324967 CAAGGCAGGCAGGCGGCTGTGGG - Intergenic
923526720 1:234778562-234778584 TGGGGCTGGCGGGCTGCTGCTGG + Intergenic
923630306 1:235645255-235645277 CAGGGCAGGGAGGCTGCTGAGGG - Intronic
923778605 1:237001623-237001645 CATGGCATGCAGGCTGCTGCTGG - Intergenic
1063216584 10:3931085-3931107 AGGGCCAGGCATGCTGCTGGGGG - Intergenic
1063454054 10:6170750-6170772 CAGAGCAGGAAAGCTGCTGGGGG + Intronic
1063464420 10:6233599-6233621 AAGGGCAGGCTGGCTGCACGGGG + Exonic
1063588310 10:7372880-7372902 TAGGGCAGGCAGGGGGCTGCAGG - Intronic
1063720455 10:8575181-8575203 TAAGGCAAGCAGACTGCTTGAGG - Intergenic
1064254813 10:13734431-13734453 TGGGGCCTGCAGGCTCCTGGAGG - Intronic
1065047782 10:21759409-21759431 GAAGCCAGCCAGGCTGCTGGAGG - Exonic
1065123967 10:22555069-22555091 CAGGACAGCCAGGCTGCGGGGGG - Intronic
1065133297 10:22643933-22643955 TGGGGCAGGCTGGGTTCTGGAGG - Intronic
1065359673 10:24877851-24877873 TGAGGCAGGCAGACTGCTTGAGG - Intronic
1065974882 10:30833546-30833568 TGGAGCTTGCAGGCTGCTGGGGG + Intronic
1067462060 10:46465500-46465522 CTGGGAAGGCAGGCTGCAGGGGG - Intronic
1067526416 10:47041884-47041906 AATGGCAGACAGGCTGTTGGAGG + Intergenic
1067571776 10:47377000-47377022 ATGGCCAGGCAGGCTGCTGAAGG - Intronic
1067625135 10:47919098-47919120 CTGGGAAGGCAGGCTGCAGGGGG + Intergenic
1067848946 10:49743094-49743116 GAGGGCAGGGATGCTGCAGGAGG + Intronic
1069547828 10:69341391-69341413 TAAGGCAGGCAGATTGCTTGGGG - Intronic
1069683321 10:70300478-70300500 CAAGGCAGCCAGGCTGCTGCTGG + Exonic
1069724292 10:70567365-70567387 TGGGGCTGGCAGGATGGTGGAGG + Exonic
1069736780 10:70661797-70661819 CGGGGCAGGCACGGTGCTGGAGG - Intergenic
1070729913 10:78819549-78819571 TAGGGCTGTCAGGATGCTGTAGG + Intergenic
1071343384 10:84668331-84668353 GAGGGAAGGCAGGCTGGGGGTGG - Intergenic
1072640975 10:97211204-97211226 TAGAGTAGGCAGCCTCCTGGGGG + Intronic
1073600074 10:104838224-104838246 TATGGCAGGCAGGATGGTGGAGG - Intronic
1074532837 10:114308744-114308766 CAGGGCAAGCAGGCTGCTCAGGG + Intronic
1075345694 10:121680579-121680601 TGGAGGAAGCAGGCTGCTGGGGG - Intergenic
1075617969 10:123905281-123905303 CAGGGCAGTCAAGCTGCTCGCGG - Intronic
1075681920 10:124339406-124339428 CAAGCCAGGCAGGCTGCTGCAGG + Intergenic
1076135003 10:128039728-128039750 TCAGGCAGGAGGGCTGCTGGTGG + Intronic
1076176877 10:128374980-128375002 TTGGGCAGGCCGGCCTCTGGAGG + Intergenic
1076433389 10:130423103-130423125 CAGAGCAGGCTGGCTTCTGGGGG + Intergenic
1076688580 10:132209245-132209267 CCGGGCAGTCTGGCTGCTGGAGG - Intronic
1076700318 10:132269582-132269604 AAGGGCAGGAAGGCTGCTCGGGG + Intronic
1076738612 10:132469550-132469572 TGGGGCAGGCAGGGGGCTGGAGG + Intergenic
1077037374 11:502004-502026 TGGGGCAGGCTGGCGGGTGGCGG - Intronic
1077394861 11:2315816-2315838 GAGGGCAGGAAGCCAGCTGGTGG - Intronic
1077488998 11:2851852-2851874 TGGGGCAGCCAGACAGCTGGGGG + Intergenic
1078055194 11:8003557-8003579 TAGGGTGGGCAGGCAGCTGGGGG - Intergenic
1078083174 11:8218367-8218389 TGGGGCAGGCAGACTGGTGGTGG + Intergenic
1078161761 11:8846341-8846363 TAGGGCCAGCAGCCTGTTGGGGG - Intronic
1078169574 11:8919255-8919277 AAGGACAGGTAGCCTGCTGGGGG + Intronic
1079377200 11:19904012-19904034 TTGGGCAGGCAGCCAGCTGGTGG + Intronic
1079466116 11:20732567-20732589 TGGGGCTGGCAGGATCCTGGAGG + Intronic
1081568429 11:44275066-44275088 AGGGGCAGGAAGGCTGCTGCTGG - Intronic
1081814579 11:45931332-45931354 CAGGGCAGACAGCCTGCTGCTGG + Intronic
1081935343 11:46899986-46900008 CAGAGCAGTCAGGCTGCTGCAGG + Intronic
1082665510 11:55971169-55971191 CAGTGCAGGGAGGGTGCTGGTGG - Intergenic
1083671698 11:64303660-64303682 AGGGGCAGGCAGGCTGGTTGGGG + Intronic
1083737077 11:64687502-64687524 CAGGGCAGCAAGGCTGGTGGGGG + Intronic
1083837081 11:65277408-65277430 TAAGGCAGGCAGATTGCTTGAGG - Intronic
1083842623 11:65313574-65313596 TGGGGGAGGCAGGATGCTGGGGG - Intergenic
1083931816 11:65850372-65850394 GGGGGCAGGCAGGATGATGGGGG + Intronic
1084683240 11:70679364-70679386 GGGGGCTGGCTGGCTGCTGGTGG - Intronic
1084717434 11:70882905-70882927 CAGGGCAGGCAGGAGGCAGGTGG + Intronic
1084860224 11:72013322-72013344 CAGAGCAAGCAGGCCGCTGGGGG - Exonic
1085027641 11:73245949-73245971 TAGCTCAGGCAGGCTGAGGGAGG - Intergenic
1086028742 11:82327099-82327121 TAGGGGATGCCGGGTGCTGGGGG - Intergenic
1086053283 11:82618999-82619021 AAGAGCAGGCAGTCTGCTGGAGG - Intergenic
1086887560 11:92223397-92223419 CAAGGCAGCGAGGCTGCTGGAGG + Intergenic
1086931729 11:92700670-92700692 TAGGGCAACGAGGTTGCTGGAGG - Intronic
1087534298 11:99424517-99424539 TAAGGCAGGCAGGCAGCTCCTGG + Intronic
1089151442 11:116367382-116367404 TAGGGCAGGCAGGAAGCAGAAGG - Intergenic
1089605668 11:119639962-119639984 AAGTGCAGCCAGGCTCCTGGCGG - Intronic
1089746509 11:120621175-120621197 AAGGTCAGGAAGGCTGCTTGGGG + Intronic
1090442690 11:126737294-126737316 CAGGGCAGAGAGGGTGCTGGTGG + Intronic
1090636228 11:128692229-128692251 GAGGGCAGGCAGCCTGCCGCGGG + Intronic
1090813714 11:130271510-130271532 TAGGGCTGGCAGGAAGTTGGAGG - Intronic
1093607426 12:21109777-21109799 TGGAGCTGGTAGGCTGCTGGAGG - Intronic
1094584687 12:31767335-31767357 TAAGGCAGGCAGAATACTGGAGG + Intergenic
1095094253 12:38137182-38137204 TAAGGCAGGCAGACGGCTTGAGG + Intergenic
1096113398 12:49041556-49041578 TAGGGCAGTCAGGCTGCTGCAGG + Intronic
1096994002 12:55827897-55827919 TTGGACAGGCAGGCTTTTGGTGG - Exonic
1098071449 12:66679964-66679986 TATGGCGAGCAGGCTGCTGCTGG - Intronic
1098304640 12:69090330-69090352 CAAGGCAGGAAGGCTGCTGAGGG - Intergenic
1099989584 12:89708630-89708652 AAGGAAAGGCAGGCTGCGGGAGG + Exonic
1100237288 12:92673480-92673502 CAAGGAAGGCAGCCTGCTGGGGG - Intergenic
1102643288 12:114385371-114385393 ACGGGCAGGAAGGCTGGTGGAGG + Intronic
1102929596 12:116852122-116852144 TAGGGCAGGCAAGATTCTGGTGG - Intronic
1103138134 12:118525661-118525683 CAGGGCAGGCAGACTACTTGAGG - Intergenic
1103573039 12:121857509-121857531 TAGGGCAGGCAGGCTGAGGGGGG - Intronic
1103843759 12:123887087-123887109 CAGGGAAGGGAGGCTGGTGGTGG + Intronic
1104017913 12:124972679-124972701 TGGAGCAGGCAGGCGGCTTGAGG + Intronic
1106335318 13:28778168-28778190 TAGGGCAGGCGGCAGGCTGGGGG + Intergenic
1106391506 13:29339227-29339249 TAGGGCAGGCAGCAGGCTGAGGG + Intronic
1106473154 13:30075976-30075998 TGGTGGAGGGAGGCTGCTGGAGG + Intergenic
1107524822 13:41220031-41220053 TAGGACAGGAAAACTGCTGGGGG + Intronic
1108418882 13:50228617-50228639 TAGGGCAGTAGGGCTGCTGCAGG - Intronic
1108454109 13:50596278-50596300 TGGGGCAGGCAGTGTGCAGGAGG + Intronic
1108702470 13:52955523-52955545 GAGGTCAGGCGTGCTGCTGGGGG - Intergenic
1108854439 13:54775586-54775608 TGGGGATGGCAGGCTGATGGTGG - Intergenic
1109400162 13:61816881-61816903 CAGGTCAGGCAGGCTGCTGTTGG - Intergenic
1110602327 13:77388938-77388960 AAGAGCATGCAAGCTGCTGGTGG + Intergenic
1112873635 13:104007029-104007051 TAGGGCCGGCTGGCTTCTGTAGG + Intergenic
1113676263 13:112209789-112209811 GAAGGCAGGCAGGGTGCAGGTGG + Intergenic
1114264721 14:21066735-21066757 TAGCACAGGCAAGATGCTGGTGG + Intronic
1114474992 14:22988000-22988022 TAGGCCACACAGGCTCCTGGCGG + Exonic
1115115704 14:29879080-29879102 GAGGCCAGGCAGGCTGAAGGTGG - Intronic
1117202720 14:53408989-53409011 TATGGCAGACCAGCTGCTGGAGG + Intergenic
1117771594 14:59139333-59139355 TTGGGCAGAAGGGCTGCTGGGGG - Intergenic
1119265601 14:73261865-73261887 AATGGCAGGCTGGGTGCTGGAGG + Intronic
1119304027 14:73592414-73592436 CAGGTGAGCCAGGCTGCTGGCGG + Exonic
1119407014 14:74405342-74405364 TGGCCCAGGCAGGCTCCTGGGGG + Intergenic
1120242077 14:81960936-81960958 TAAGGCAGGGAAGCTGTTGGCGG + Intergenic
1120767142 14:88338738-88338760 CAAGGCAGGCAGGTTGCTTGAGG + Intergenic
1120915372 14:89705683-89705705 CAAGGCAGGCAGACTGCTTGAGG - Intergenic
1121434616 14:93910902-93910924 TTGGGCAAGCAGGCAGGTGGTGG - Intergenic
1121697566 14:95926252-95926274 TGGGGCAGGCAAGGTGCTGACGG - Intergenic
1122251674 14:100444364-100444386 TGGGTCAGGGAGGCTGCTGCAGG + Intronic
1122477847 14:102024030-102024052 TATGGCTGGCTGGCTGCTGTTGG + Intronic
1122693603 14:103542640-103542662 AGAGGCAGGCAGGCTTCTGGGGG - Intergenic
1122717491 14:103704264-103704286 AAGGGGAGGCAGGCTGCTGGGGG + Intronic
1123041949 14:105493936-105493958 GAGGGCGGGCAAGCTGCTGCGGG + Intronic
1123043286 14:105499314-105499336 TAGGGCTGGCCAGGTGCTGGAGG + Intronic
1123114331 14:105887096-105887118 CAGGGCAGGCAGGCACCTGCTGG - Intergenic
1123448622 15:20346518-20346540 CAGGGCAGGCTGGCAGCTGTAGG + Intergenic
1124028718 15:25989940-25989962 TGGGGCAGGCAGGGTGGCGGGGG + Intergenic
1124242100 15:28037263-28037285 GAGGGCAGGAAGGCAGCTGGTGG + Intronic
1124439833 15:29677863-29677885 GTGGGGAGGCAGGCTGGTGGTGG + Intergenic
1124783807 15:32660325-32660347 GTGGGTAGGCAGGCTGCAGGAGG - Intronic
1125325260 15:38530151-38530173 TAGTGCAGGCTGGGTGCTGCTGG + Intronic
1125702278 15:41697646-41697668 TGAAGCAGGCAGACTGCTGGAGG - Intronic
1126099000 15:45108450-45108472 GAGGTCAGGCAGGCTGGTGATGG - Intronic
1127810190 15:62559145-62559167 GAGGGAAGTCAGGCTGCTGGAGG - Intronic
1127996913 15:64158515-64158537 TAGGGCAGGCAGGCTGCTGGGGG - Intronic
1128159639 15:65415230-65415252 GGGGGCAGGGAGGCTGCCGGAGG - Intronic
1129525092 15:76208648-76208670 TATGGCTGGCGGGCAGCTGGGGG + Intronic
1129827153 15:78641351-78641373 TAGGGAAGCCAGGCGGCAGGTGG - Intronic
1130027145 15:80279873-80279895 AAGGGCAGGCAAGCTCGTGGAGG - Intergenic
1130055683 15:80523396-80523418 CAGGGCAGGCAGCCTTGTGGGGG + Intronic
1130679608 15:85984952-85984974 TAGGGGAGGCTGGAGGCTGGCGG + Intergenic
1130960568 15:88656211-88656233 TAGGACAGGCATGGTGCTGGGGG - Exonic
1131220947 15:90583623-90583645 TAGTGCTGGCAGGCTGCTGGGGG + Intronic
1132393105 15:101453252-101453274 TGGGGTAGGGAGGCTGCTTGAGG + Intronic
1132558930 16:584716-584738 TAGGCCAGGTAGGCAACTGGAGG - Intergenic
1133076729 16:3285780-3285802 CAGGGGAGGAAGGGTGCTGGGGG - Intronic
1133636635 16:7672629-7672651 TAAGGCAGGCAGATTGCTTGAGG + Intronic
1133812786 16:9174110-9174132 TTGGGAAGGGAGGCAGCTGGTGG - Intergenic
1133840290 16:9402005-9402027 TGGGGCAGGCAGTTTGCTTGGGG - Intergenic
1134472621 16:14540693-14540715 TGAGGCAGGCAGATTGCTGGAGG + Intronic
1134514121 16:14873198-14873220 CAGGACAGGTAGGCTGCGGGGGG + Intronic
1134674836 16:16082878-16082900 CAAGGCAGGCAGACTGCTTGAGG - Intronic
1134701763 16:16271698-16271720 CAGGACAGGTAGGCTGCGGGGGG + Intronic
1134970067 16:18522952-18522974 CAGGACAGGTAGGCTGCGGGGGG - Intronic
1136238789 16:28931934-28931956 TGGGGCAGGCAGGGGCCTGGAGG - Exonic
1136609895 16:31359840-31359862 TGGGGGAGGGAGGCTGCTGGGGG + Intronic
1136615050 16:31393452-31393474 GAGGGCAGGCTGGGGGCTGGTGG + Intronic
1136778162 16:32882398-32882420 AAGGGCAGGCAGGGTCCAGGAGG + Intergenic
1136850026 16:33605098-33605120 TAAGGCAGGCAGATTGCTTGAGG + Intergenic
1136892459 16:33979116-33979138 AAGGGCAGGCAGGGTCCAGGAGG - Intergenic
1138429604 16:56960520-56960542 TAGTGCAGACTGGGTGCTGGGGG - Intergenic
1138947083 16:61864538-61864560 TAGGGCATGCTTCCTGCTGGGGG - Intronic
1139477296 16:67209028-67209050 TGGGGCAGGAAGGATGCAGGTGG + Intronic
1139594863 16:67951604-67951626 TGGGGAAGACAGGCTGCTGCAGG + Intronic
1139916434 16:70431096-70431118 TGGGGGAGGCAGGCAGCAGGGGG + Intronic
1141028702 16:80570388-80570410 AAGGGCTGGCGGGCTGCAGGTGG - Intergenic
1141203538 16:81915151-81915173 TTGGTCAGGCAGGGTGGTGGAGG + Intronic
1141428822 16:83960533-83960555 TAGGTCAGAGGGGCTGCTGGAGG - Intronic
1141612866 16:85192971-85192993 TAGGGCAGGAGGGCTGTTGGAGG + Intergenic
1141828395 16:86496464-86496486 CAGGGCAGCCAGGCTGATGCGGG - Intergenic
1142158137 16:88542306-88542328 CAGGCCAGGCAGGCTGGTGGGGG - Intergenic
1142178867 16:88657615-88657637 CAGGGCGGGCAGGGTGCTGACGG - Intronic
1142244442 16:88963085-88963107 TGGGCCTGGCAGGATGCTGGGGG + Intronic
1142353052 16:89588532-89588554 TAGGGCTGGGGGGCTGCTGTTGG - Intronic
1142363472 16:89638008-89638030 TGGGGCAGCCTGCCTGCTGGTGG - Intronic
1203080581 16_KI270728v1_random:1144507-1144529 AAGGGCAGGCAGGGTCCAGGAGG + Intergenic
1203111638 16_KI270728v1_random:1453551-1453573 TAAGGCAGGCAGATTGCTTGAGG + Intergenic
1142594496 17:1022942-1022964 TGGGGAAGGCAGGTTGCTGCGGG - Intronic
1142986057 17:3695982-3696004 TGGGGCAGGCGGGCTGCAAGGGG - Exonic
1143052510 17:4137714-4137736 TAGTGCAGGCAGGTGGCTGGCGG + Intronic
1143108484 17:4541060-4541082 CAGGGCTGGGAGGCAGCTGGAGG - Intronic
1143773554 17:9183241-9183263 TTGGGCTGGCGGGCAGCTGGTGG - Intronic
1144006671 17:11106440-11106462 TGAGGCAGGAAGACTGCTGGAGG + Intergenic
1144186021 17:12795745-12795767 TAGGTCAGGCAGGAGGTTGGGGG + Intronic
1144728339 17:17512781-17512803 CAGGCCAGGCAGGCAGCAGGTGG + Intronic
1144873192 17:18382882-18382904 TCGGGCAGGGTGGCTGCAGGTGG + Intronic
1145865744 17:28240520-28240542 CAGGGCAGGAAGGTTCCTGGAGG - Intergenic
1145931691 17:28690540-28690562 CAGGGCAGGCAGACTGCTTGAGG + Intronic
1145990735 17:29077926-29077948 TAGGGCAGGAAGTCAGCTGATGG - Exonic
1146202518 17:30872145-30872167 CAAGGCAGGAAGACTGCTGGAGG - Intronic
1146579734 17:34026243-34026265 CAGGGCAGGCATACTGCTGTTGG - Intronic
1147131909 17:38414830-38414852 AAGGGCCCGGAGGCTGCTGGTGG + Intergenic
1147168311 17:38604830-38604852 TAGGGAAGGCAGGCGGCTGAGGG - Intronic
1147359396 17:39921665-39921687 TAGGGGAGGGAGGCTGCTGTGGG - Intronic
1147477030 17:40721862-40721884 TTGGCCAGGCTGTCTGCTGGTGG - Intergenic
1147556230 17:41480888-41480910 GAGAGCAGGGAGGCAGCTGGTGG + Exonic
1148152113 17:45403077-45403099 GAGGGCAGGGAGGCTGGGGGTGG - Intronic
1148691182 17:49527973-49527995 TGGTGCAGGCAGGGGGCTGGGGG + Intergenic
1148795637 17:50195377-50195399 AGGGGCAGGCAGGCTGCAGGCGG + Intronic
1148896172 17:50840439-50840461 CAGGGCGGGCAGGCTGCACGCGG - Exonic
1149334738 17:55624054-55624076 CAGGGCTGGCAGGGTGGTGGTGG + Intergenic
1150582503 17:66487631-66487653 GAAGGCAGGGATGCTGCTGGTGG - Intronic
1151748049 17:76022149-76022171 TCGGGCAGGGAGGCTGCGGGTGG - Intronic
1151787334 17:76281474-76281496 AAGGGCAGGCTTGCTGGTGGGGG - Intronic
1151830114 17:76544517-76544539 TAGGGCAGGCAGGAGGCAGGGGG + Intronic
1151944442 17:77311835-77311857 TCGGGCAGCCAAGATGCTGGTGG - Intronic
1151978820 17:77497473-77497495 CAGGGCAGGCAGGTGGCAGGGGG - Intronic
1152034780 17:77865445-77865467 TGGGGCAGGCAGCCGGCTGCAGG + Intergenic
1152482981 17:80568139-80568161 TGAGGCAGGCAGACTGCTTGAGG - Intronic
1152604950 17:81284857-81284879 GAAGGCAGGCAAGATGCTGGTGG - Exonic
1152797471 17:82315265-82315287 TGGGGCAGGGAAGGTGCTGGGGG + Exonic
1155928833 18:31685185-31685207 GCGGCCAGGCAGGCAGCTGGCGG - Intronic
1156368075 18:36447914-36447936 GAGGGCAGTCAGGCAGCTGGAGG + Intronic
1156462944 18:37331847-37331869 GAGGACAGGCAGGCAGGTGGAGG + Intronic
1157161267 18:45316320-45316342 CAGTGCAGGCAGCCTCCTGGTGG - Intronic
1157326798 18:46674907-46674929 TAGGGCAGGGAGGTGGCAGGAGG + Intronic
1157478778 18:48039817-48039839 TTGGGCAGGGAGGCTGGCGGTGG - Intronic
1157595061 18:48859349-48859371 GAGTACAGGCCGGCTGCTGGAGG + Exonic
1157931025 18:51823670-51823692 TAGGGCATCCAAGCTGCTGGTGG - Intergenic
1157934627 18:51859335-51859357 GAGGGTAGGCTGGCTGCTGTTGG - Intergenic
1158060952 18:53340818-53340840 TTGGGCAGGCAGGGTGTAGGGGG + Intronic
1158702070 18:59757148-59757170 TAGGACAGGCTGTCAGCTGGTGG - Intergenic
1160314807 18:77832723-77832745 TCGGGCCGGCAGCCTGCTGTCGG + Intergenic
1160350459 18:78174116-78174138 ACTGGCAGGAAGGCTGCTGGGGG - Intergenic
1160553059 18:79707409-79707431 CAGAGCAGGGAGCCTGCTGGTGG + Intronic
1160624039 18:80190717-80190739 GAGGGCAGGCGGGCAGCTGTTGG + Intronic
1160817046 19:1040948-1040970 TGGGCCAGGCAGGAGGCTGGGGG + Intronic
1161206574 19:3044365-3044387 TAGGGCAGGCAGGATTCTACAGG + Intronic
1161328573 19:3675415-3675437 AAGGGCAGCCAGTCTGCTGCAGG + Intronic
1161428554 19:4217614-4217636 TCGGGCCAGCCGGCTGCTGGCGG + Exonic
1162087060 19:8255377-8255399 TAGGGCAGGCAGGTCGCTGACGG - Intronic
1162869401 19:13574189-13574211 TGGTGCAGGGAGGCTGTTGGAGG + Intronic
1162926449 19:13932736-13932758 CAGGGCAGGCAGGGGGATGGAGG + Exonic
1163009150 19:14413783-14413805 TGGGGCTGCCAGGATGCTGGTGG + Intronic
1163161148 19:15464629-15464651 CAGTGCGGGCAGGTTGCTGGAGG + Intergenic
1163163010 19:15476596-15476618 AGGGGCAGGGAGGCTGCAGGAGG + Exonic
1163309443 19:16504469-16504491 CAGGGCAGCCAGCCAGCTGGGGG - Intronic
1163362614 19:16856802-16856824 TGAGGCAGGCAGACTGCTTGAGG - Intronic
1163501547 19:17679456-17679478 TAGGGAGGGCAGGCAGGTGGAGG + Intronic
1163524588 19:17812915-17812937 TGGGTGAGGGAGGCTGCTGGAGG - Exonic
1163524768 19:17814040-17814062 AAGGAGAGGGAGGCTGCTGGTGG - Intergenic
1163577510 19:18119300-18119322 TCGGGGAGGGAGGGTGCTGGTGG + Intronic
1163747284 19:19055947-19055969 GGGGGCAGGCAGGCTGGTGTGGG + Intronic
1163764452 19:19154960-19154982 TAGGGCCTGCTGGCTTCTGGAGG - Intronic
1164478678 19:28594720-28594742 CAGGTCATGCAGGCTCCTGGAGG - Intergenic
1164841582 19:31397125-31397147 GAGCACAGGCAGGCGGCTGGGGG + Intergenic
1165030825 19:32997129-32997151 TAAGGCAGGCAGATTGCTTGAGG - Intronic
1165824740 19:38699241-38699263 CAGGGCACGCAGCCTCCTGGTGG - Intronic
1166783012 19:45352106-45352128 GAGGACAGGCAGGCTGAGGGTGG + Intronic
1166819888 19:45571560-45571582 TATGGCAGCCAGGCTGCTGCTGG - Intronic
1166941837 19:46371795-46371817 TGAGGCATGCAGGCAGCTGGGGG - Intronic
1167125516 19:47545758-47545780 CAGGGACCGCAGGCTGCTGGGGG + Exonic
1167264408 19:48476469-48476491 CAAGGGAGGCAGACTGCTGGGGG + Intronic
1167699797 19:51035881-51035903 CAAGGCAGGCAGGTTGCTTGAGG - Intergenic
1168207884 19:54865681-54865703 TAGGACAAGCAGCCTGATGGCGG - Intronic
925139916 2:1543065-1543087 TGCGGCAGGGCGGCTGCTGGAGG - Intronic
925429446 2:3778455-3778477 GAGGGCAGGCAGGCTGTGGAGGG + Intronic
925909801 2:8566212-8566234 GAGGACAGGCAGGGGGCTGGAGG - Intergenic
926053329 2:9758386-9758408 GAGGTCACGGAGGCTGCTGGAGG - Intergenic
926251863 2:11159392-11159414 GAGGGCCTGCAGGCAGCTGGGGG + Intronic
927489429 2:23510837-23510859 CAGGACTGGCAGGCTTCTGGGGG + Intronic
928200727 2:29246199-29246221 GAAGGCAGGCAGGCTGGAGGGGG + Intronic
928314962 2:30237884-30237906 TTGGGCAGGCAGGCTGTGGGTGG + Intronic
928437837 2:31267183-31267205 GAGGGCAGGCGGGCAGCTGCAGG + Exonic
929642851 2:43598943-43598965 CTAGGCAGGCAGGATGCTGGTGG + Intergenic
929811369 2:45191718-45191740 AAGGGTAGGGAGGCTGCTGCAGG + Intergenic
929983570 2:46703237-46703259 TCAGGCAGGCATGCTGTTGGTGG + Intronic
931244490 2:60481023-60481045 TGAGGCAGGGAGGCAGCTGGGGG - Intronic
931962035 2:67492956-67492978 GAGGACAGGCAGGGTGCTGGCGG + Intergenic
932432394 2:71683752-71683774 CATGGCAGACAGGCTGCTTGGGG + Intronic
932715935 2:74100853-74100875 CTGGGTACGCAGGCTGCTGGTGG - Exonic
933989583 2:87624670-87624692 TAGGTCAGGCACTGTGCTGGGGG + Intergenic
934041517 2:88131072-88131094 GATGTCAGGCAGGCAGCTGGGGG - Intergenic
934525352 2:95048411-95048433 AGGGGCAGGCAGGCACCTGGCGG - Intronic
934898771 2:98140712-98140734 AAGGGAAGACAAGCTGCTGGGGG - Intronic
935232763 2:101113554-101113576 CAGGGCTGTCAGGCTGCAGGCGG - Intronic
936109996 2:109657211-109657233 TAAGGCAGGCAGACTGCTTGAGG + Intergenic
936271732 2:111054339-111054361 TGAGGTGGGCAGGCTGCTGGTGG + Intronic
936581267 2:113702874-113702896 TAAGGCAGGCAGATTGCTTGAGG + Intergenic
937287324 2:120761703-120761725 TGGGGCAGGCAGGAAGCTGGAGG - Intronic
937366936 2:121269526-121269548 TGGGGCAGGAAGACTGCTTGAGG + Intronic
937445016 2:121950144-121950166 TAGGGCAGGAAGGTGGGTGGGGG + Intergenic
938101028 2:128498348-128498370 GAGGGCATGCAGGCTGCGGAGGG + Intergenic
939967199 2:148622065-148622087 AAGGTCAGGTAGCCTGCTGGTGG - Intergenic
941201100 2:162511876-162511898 TAGGCCATGCATGCTGCTGTGGG - Intronic
941362489 2:164569264-164569286 TAGGGGAGGGAGGCTGGAGGAGG + Intronic
944752562 2:202725549-202725571 CAAGGCAGGCAGACTGCTTGAGG - Intronic
945083297 2:206107457-206107479 TGAGGCAGGCAGACTGCTTGAGG - Intergenic
946228535 2:218277711-218277733 GAAGGAAGGCAGGGTGCTGGGGG + Intronic
946334555 2:219028444-219028466 TAGGGCAAGGGGGGTGCTGGGGG + Intronic
946362636 2:219228585-219228607 TGGGGCAGGAAGGCTGCAGTGGG + Intronic
947055978 2:226104280-226104302 CAAGGCAGGCAGATTGCTGGAGG - Intergenic
947586586 2:231360544-231360566 GATGGCAGGCACACTGCTGGTGG - Intronic
947874059 2:233457037-233457059 TAGGCCTGGCAGTCTGCTGATGG - Intronic
948057290 2:235018135-235018157 TGGGGCAGGGAGGTTGCAGGAGG + Intronic
948160551 2:235819820-235819842 TTTGGTAGGCAGGTTGCTGGTGG + Intronic
948279480 2:236735846-236735868 TAGGGCAGCCCGGTTGCAGGTGG + Intergenic
948698810 2:239747932-239747954 AGGGGCAGGCAGGCTGATTGCGG - Intergenic
948851627 2:240711162-240711184 CAGAGCAGGCAGGAAGCTGGGGG + Intergenic
948975522 2:241461323-241461345 GAGGGCAGAGAGGCTGCCGGTGG - Intronic
949028193 2:241775964-241775986 TAGGGCAGGGAGGCTGCCTTGGG + Intergenic
1169189097 20:3645882-3645904 TAGGGAAGGCACGGTTCTGGGGG - Intronic
1169283919 20:4291172-4291194 TAGGGCAGGCAGGGTAGGGGAGG - Intergenic
1171209361 20:23304860-23304882 TTGGGGAGGCAGGATGCTGGTGG - Intergenic
1171341201 20:24431087-24431109 TTGGGCTGGAAGGCTGTTGGGGG - Intergenic
1171395846 20:24832639-24832661 GAGAGCAGACAGGCTGCTGTGGG + Intergenic
1172027327 20:31957402-31957424 TAGGACAGGAAGGCAGGTGGAGG + Intergenic
1172493449 20:35360273-35360295 TAGGGCATTCAGGCTTCTGCTGG - Intronic
1172612110 20:36260061-36260083 TAGGCCTGGCAGGCTGGGGGTGG - Intronic
1172620137 20:36313283-36313305 AAAGGCAGGCAGGCAGCTGGGGG - Intronic
1172935130 20:38614881-38614903 TGGTGCAGGCAGCTTGCTGGGGG - Intronic
1173572474 20:44086296-44086318 TCGGTGTGGCAGGCTGCTGGCGG + Intergenic
1173663469 20:44750048-44750070 CCGGGCAGGCAGGCTGCGGGCGG + Intronic
1173676103 20:44836995-44837017 GCGGGCCGGCATGCTGCTGGGGG + Intergenic
1174231019 20:49045785-49045807 GAGGGCAGGCAGGCTGGCAGGGG + Intergenic
1174338709 20:49882910-49882932 TAGGGCAGCCAGGCTGCTGCAGG - Intronic
1174368274 20:50069387-50069409 GAGGGCAGGCAGGCAGCAGTGGG - Intergenic
1175309481 20:58001717-58001739 CAGGGGAGGTAGGCTGCTTGGGG + Intergenic
1175701463 20:61140755-61140777 TAGGGGAGGAAGGCTCCAGGTGG + Intergenic
1175722831 20:61297684-61297706 TAGAGCAGGCTGGATTCTGGAGG + Intronic
1175898731 20:62351640-62351662 AAGGACAGGCAGGGAGCTGGGGG + Intronic
1176131773 20:63499322-63499344 CAGGGCAGGGAGGCGGCGGGAGG + Intergenic
1176144392 20:63559149-63559171 TGGCCCAGGCAGGCTGATGGCGG + Intronic
1176420106 21:6507347-6507369 TAGGGCAGGTAGGCGCCTGTGGG - Intergenic
1179178389 21:39025178-39025200 AAGTGCAGGCCGGCTGCAGGTGG - Intergenic
1179635449 21:42705795-42705817 TAGGGCAGGCAGGAATGTGGGGG - Intronic
1179695598 21:43115667-43115689 TAGGGCAGGTAGGCGCCTGTGGG - Intergenic
1179883124 21:44301672-44301694 GAGGGCAGACAGGTTGCTGTGGG + Intronic
1179887813 21:44321941-44321963 TGTGGAAGGCCGGCTGCTGGAGG + Intronic
1180220262 21:46354174-46354196 CAGGGGAGGAAGGCTGCTTGCGG + Intronic
1180374961 22:12083134-12083156 CAGGCCAGGCATGCTGCTGGAGG + Intergenic
1180754028 22:18147897-18147919 CAGGGAGGGCAGGGTGCTGGTGG - Intergenic
1180858717 22:19064540-19064562 GAGCGCAGGCAGGGGGCTGGGGG - Intronic
1180959500 22:19756218-19756240 TAGCGCAGGTAGGCTGCCGCTGG - Intergenic
1181142115 22:20813491-20813513 TCGGGCAAGCAGGAGGCTGGTGG + Exonic
1181177562 22:21046241-21046263 AAGGGAAGGCAGGGGGCTGGAGG - Intronic
1181850807 22:25748717-25748739 AAGGGCAGGAAGGTTGATGGAGG - Intronic
1181916547 22:26285596-26285618 TAGGGCATGCAGGTTGGGGGAGG + Intronic
1183638912 22:39081700-39081722 GAGGGCAGGCAGGGGGCAGGAGG - Intronic
1183664829 22:39241310-39241332 CAGGGCAGGCCTGCTGGTGGAGG - Intronic
1183832219 22:40424289-40424311 CATGGCTGGCAGGCTGCTCGGGG + Exonic
1184050710 22:42001972-42001994 AAGAGGAGGCAGGCTGCTGTGGG + Intronic
1184098591 22:42329811-42329833 TGGGGCAGGCAGGCAGGGGGAGG - Intronic
1184113583 22:42409366-42409388 GAGGGCAGGCGGGCAGCCGGTGG + Intronic
1184244175 22:43227523-43227545 GAGGGGAGGCTGGCGGCTGGCGG + Intronic
1184254064 22:43277048-43277070 CAGGGCAGGGAGGCTGAGGGTGG + Intronic
1184668753 22:46002022-46002044 TGGGGCCGCCAGGCTGCAGGGGG - Intergenic
1184918097 22:47587056-47587078 TGAGGCAGGCAGGTGGCTGGCGG + Intergenic
1184968572 22:47998878-47998900 CAGGACAGGCAGGCTGATGGGGG - Intergenic
1185264749 22:49895030-49895052 GGGGGCAGACAGGCTGATGGAGG + Intergenic
1185337043 22:50275348-50275370 TAGGGCATGGAGGCGGCTGCTGG + Exonic
1185414587 22:50702978-50703000 TGGGGCTCGCAGGCAGCTGGAGG + Intergenic
949533741 3:4979743-4979765 TTGGGCAGGCAGGCGGGGGGTGG - Exonic
950107344 3:10396671-10396693 TGGGGGAGGCAGGCTGCTGCAGG + Intronic
950401823 3:12774964-12774986 TGAGGCAGGCAAGTTGCTGGGGG - Intergenic
950677051 3:14560615-14560637 TGTGTCAGTCAGGCTGCTGGCGG + Intergenic
951407459 3:22317826-22317848 TAAGGCAGGCAGATTGCTTGAGG + Intronic
951710332 3:25580422-25580444 TTGAGCAGGCAGGTTGTTGGTGG - Intronic
953303181 3:41799627-41799649 CAGGGCAGGCAGATTGCTTGAGG + Intronic
953342782 3:42149680-42149702 TAGGGGAGACAGGCGGCTGGCGG + Intronic
953851920 3:46471183-46471205 TAGAAAAGGCAGGCAGCTGGGGG - Intronic
953982738 3:47420726-47420748 GAGGGCAGGCAGGCCTCAGGGGG + Exonic
954114719 3:48460030-48460052 TTTGGCAGGCAGGCTGTTTGGGG + Intronic
954378573 3:50207548-50207570 CAAGGCAGGCAGACTGCTTGAGG - Intronic
954954731 3:54508978-54509000 CAGAGTATGCAGGCTGCTGGAGG + Intronic
955900473 3:63748364-63748386 TATGGCAGGCAGACTGATGTGGG - Intergenic
956435275 3:69229256-69229278 TAAGGCAGGAAGGTTGCTGGAGG - Intronic
958785671 3:98593885-98593907 TAGGGCTGGGAGGCTGAGGGCGG + Intergenic
961010895 3:123435050-123435072 CAGGGCAGGCAGACTGATGGAGG + Intronic
961029244 3:123587524-123587546 TTTGGCAGGCAGGAGGCTGGAGG + Intergenic
961059153 3:123813741-123813763 TAAGGCAGGCAGATTGCTTGAGG - Intronic
961521037 3:127467477-127467499 TGGGCCAGGCAAGCTGCAGGAGG - Intergenic
961604427 3:128083159-128083181 GAGGGGAGGCAGGCTGGCGGCGG + Intronic
962181356 3:133209270-133209292 CAAGGCAGGAAGGCTGCTTGAGG - Intronic
962491639 3:135898924-135898946 TGCAGCAGGCAGCCTGCTGGGGG - Intergenic
962560074 3:136596838-136596860 CAAGGCAGGCAGACTGCTTGAGG + Intronic
963848053 3:150179979-150180001 TAGGGCGGGAAGGATACTGGAGG + Intergenic
964092061 3:152889022-152889044 TGGGGCAGGGAGGGGGCTGGAGG + Intergenic
964415380 3:156442741-156442763 TAGGGCAGGCTGTCTGCAGCTGG - Intronic
965548096 3:169935748-169935770 AAAGCCAGGAAGGCTGCTGGTGG - Intronic
966785211 3:183617342-183617364 TAGGACGCGCAGGGTGCTGGAGG - Intergenic
966882820 3:184359686-184359708 CTGGGCTGGCAGGCTGGTGGGGG - Intronic
967845149 3:194037062-194037084 AAGGGCAGGAAGGATCCTGGAGG + Intergenic
968497177 4:925268-925290 TGGGGCCTGCAGGCTGCTCGGGG - Intronic
968728327 4:2258485-2258507 CAGGGAAGGCAGGTGGCTGGTGG - Intronic
969125550 4:4945287-4945309 CAGGGCAGGCAGGAGGCTGGAGG + Intergenic
969325622 4:6442249-6442271 GAGGCCAGGCCTGCTGCTGGGGG - Intronic
969619537 4:8272148-8272170 CAGGGCTGGCAGGGAGCTGGAGG + Intronic
970492242 4:16586117-16586139 TTTGGAGGGCAGGCTGCTGGAGG + Intronic
972322960 4:37989751-37989773 AAGGTCACACAGGCTGCTGGTGG - Intronic
972808668 4:42558941-42558963 TGAGGCAGGAAGGCTGCTTGAGG + Intronic
973634793 4:52852000-52852022 TAGGAATGGCAGGCTGGTGGTGG - Intergenic
975703946 4:77093244-77093266 TAGGGAAGGAAGCCTGATGGTGG + Intergenic
976095141 4:81500574-81500596 TGAGGCAGGCAGACTGCTTGAGG - Intronic
976815262 4:89140288-89140310 TGGGGCCCGCAGGATGCTGGGGG + Intergenic
980730841 4:136823211-136823233 TAAGGCAGGCTGGCTGCGGCAGG + Intergenic
982131604 4:152233807-152233829 TAGAGCTGCCAGCCTGCTGGGGG - Intergenic
982917094 4:161226659-161226681 TGGGGCAGGGAGGTGGCTGGAGG - Intergenic
983090864 4:163500441-163500463 TGAGGCAGGCAGACTGCTTGAGG - Intronic
983651448 4:170040490-170040512 GAGGGCCGGAAGGCTGCAGGAGG + Intergenic
1202756548 4_GL000008v2_random:68583-68605 CAGGCCAGGCATGCTGCTGGAGG + Intergenic
985545033 5:505159-505181 TAAGGGAGGGAGGCTGCTGTGGG + Intronic
985827645 5:2204883-2204905 TAGGAGAGGGAGGCTGGTGGGGG + Intergenic
986102479 5:4626757-4626779 TAGGGAGGGCCGTCTGCTGGCGG + Intergenic
986449405 5:7850562-7850584 TAGGGGAGGCAGCCTGGGGGCGG - Intronic
987928839 5:24376780-24376802 TTTGGCAGGCAGGCCGATGGCGG + Intergenic
988499975 5:31776361-31776383 CAGGGCAGGGAGGCAGTTGGAGG - Intronic
993107069 5:83611523-83611545 GATGGCAGGCAGGATGTTGGTGG + Intergenic
993205488 5:84873087-84873109 TAGGGCAGGCAGATTACTTGAGG + Intergenic
993247406 5:85468153-85468175 TAGGACAGGCAGGGGGCTAGAGG - Intergenic
993351508 5:86855731-86855753 CAGGGCAGGCAGGCTGCAGATGG - Intergenic
996912455 5:128670693-128670715 TGGGGGAGGCAGGCTCCTGGGGG + Intronic
997372412 5:133370450-133370472 CTGGGCAGGAAGCCTGCTGGAGG + Intronic
997926488 5:138035108-138035130 TAGGGTAGGAATGCTGCTGGAGG - Intronic
998943626 5:147313006-147313028 TAAGGTAGGAAGGCTGCTTGAGG + Intronic
999133126 5:149299643-149299665 TCCTCCAGGCAGGCTGCTGGCGG - Intronic
999423309 5:151464053-151464075 TTGGGCAGGCAGTCAACTGGAGG - Intronic
999753536 5:154647695-154647717 GAGGGCAAGCAAGCTGCTGACGG - Intergenic
999775207 5:154806983-154807005 TAGGGCTGGGAGGATTCTGGGGG - Intronic
999834318 5:155352798-155352820 TGGTGGAGGGAGGCTGCTGGTGG - Intergenic
1000250804 5:159493072-159493094 AAGGGCAAGCAGGATGCTTGGGG + Intergenic
1000611969 5:163384174-163384196 CAGGGCAGGAAGACTGCTTGAGG + Intergenic
1000853480 5:166369501-166369523 GAGTGAAGGCAGGCTGCCGGTGG - Intergenic
1000888175 5:166772263-166772285 CAGGGAAAGCAGGCTGCTGTGGG + Intergenic
1002206779 5:177568476-177568498 GGGTGCAGTCAGGCTGCTGGTGG + Intergenic
1003916590 6:10792356-10792378 CAGAGGAGGCAGGCTGCTGCTGG - Intronic
1006518622 6:34558625-34558647 TAAGGCAGGCAGTCTGCAGCTGG - Intergenic
1007099998 6:39239635-39239657 CAGGGGAGGCAGGCTGGGGGAGG - Intergenic
1007348127 6:41248469-41248491 TAGGGCAGGCAGAGGGGTGGAGG + Intergenic
1007399931 6:41597842-41597864 GAGGGGCAGCAGGCTGCTGGCGG - Exonic
1007462493 6:42028582-42028604 AGTGGCAGGGAGGCTGCTGGCGG - Intronic
1007551385 6:42732619-42732641 AAGGGGAGGCAGGCTGCTTCAGG + Intergenic
1007679486 6:43624580-43624602 TGTGGCAGCCAGGCTGCTTGAGG + Exonic
1007765693 6:44158610-44158632 GAGGACAGCCAGGCTGGTGGAGG + Intergenic
1007781303 6:44256552-44256574 CAGGGCAGGCTGGCTGCTCTGGG - Intronic
1009032077 6:58071597-58071619 CAAGGCAGGCAGACTGCTTGAGG + Intergenic
1011107284 6:83796431-83796453 AAGGGCAGGCATTTTGCTGGTGG - Intergenic
1016577292 6:145583920-145583942 CAGAGCAGGCAGGGTGGTGGGGG + Intronic
1016948037 6:149552061-149552083 TAGCGCAGGCAGGCAGCTGTAGG + Intergenic
1017113020 6:150950273-150950295 TAGGGCTGGCAGGAGGATGGAGG - Intronic
1018198410 6:161374986-161375008 CAGGCCAGGCAGGCATCTGGTGG + Intronic
1018377432 6:163226628-163226650 CAGCCCATGCAGGCTGCTGGAGG + Intronic
1018740628 6:166725812-166725834 CCGGGCAGGGAGGCTCCTGGCGG + Intronic
1018804595 6:167248964-167248986 CAGGGCAGGCAGGGTGGTGCAGG + Intergenic
1019174340 6:170152654-170152676 AAGGCCAGGCAGGCATCTGGAGG + Intergenic
1019256766 7:57350-57372 CATGGCAGGCTGGGTGCTGGGGG + Intergenic
1019580419 7:1759178-1759200 CAGGGCCGGCAGCCTGCAGGCGG + Intergenic
1019744510 7:2692171-2692193 TGGGCCAGCCAGGCTCCTGGAGG + Intronic
1020071048 7:5227236-5227258 TTGGGAAGGCAGGTAGCTGGTGG - Exonic
1020155902 7:5724232-5724254 AAGGGCAGTCAGGCTGATGAAGG + Intronic
1021908506 7:25360675-25360697 TTAGGAAGGCAAGCTGCTGGTGG + Intergenic
1022101946 7:27174089-27174111 TAGGGCAGGTCGGCGGCGGGCGG + Exonic
1022265209 7:28746908-28746930 TAGGGCAGGAAGGCTGATGAAGG + Intronic
1025959641 7:66208699-66208721 TGAGGCAGGCAGACTGCTTGAGG - Intronic
1026051786 7:66952923-66952945 CAGGGGAGGAAGCCTGCTGGAGG + Intronic
1026911068 7:74092383-74092405 GGGGGCCTGCAGGCTGCTGGAGG + Intronic
1027170774 7:75870703-75870725 TAGCGTAGGCAGGTTGCGGGGGG + Intronic
1028112081 7:86952860-86952882 TGAGGCAGGCAGACTGCTTGAGG + Intronic
1030762542 7:113369444-113369466 TGAGGCAGGCAGATTGCTGGAGG - Intergenic
1031047762 7:116912491-116912513 TAGGGCTGGGAGGGTTCTGGGGG - Intronic
1031493915 7:122423213-122423235 TAGGGCAAGTAGGCTCCAGGAGG + Intronic
1031962601 7:128003537-128003559 TGGCACATGCAGGCTGCTGGTGG - Intronic
1032831897 7:135636025-135636047 TAGGGCAAACAGTCTGCTCGTGG - Intronic
1032887848 7:136161723-136161745 TAGTGTGGGTAGGCTGCTGGGGG + Intergenic
1033144701 7:138861268-138861290 GCTGGCAGGCTGGCTGCTGGGGG + Exonic
1033157714 7:138971101-138971123 TGGGCCACCCAGGCTGCTGGAGG + Intronic
1033300058 7:140177225-140177247 AAGGGCACGCAGGCGGCTGCGGG + Intergenic
1033598116 7:142870789-142870811 CAGGGCAGGCAGGTCTCTGGTGG - Exonic
1034536310 7:151727987-151728009 TCTGGAAAGCAGGCTGCTGGGGG - Intronic
1035674056 8:1442456-1442478 TAGACCCGCCAGGCTGCTGGGGG + Intergenic
1035885563 8:3287796-3287818 CAGGGCAATCAGGCAGCTGGAGG - Intronic
1036009606 8:4707424-4707446 TAGTGCAGGAATGCTGATGGTGG + Intronic
1037898879 8:22676020-22676042 AAGGGCAGGAAGGCTCCCGGGGG + Intergenic
1038017243 8:23525635-23525657 TAGGGAAGGCATGCTGCGAGAGG - Intergenic
1038642091 8:29337059-29337081 CAGGTAGGGCAGGCTGCTGGGGG + Exonic
1039574640 8:38613380-38613402 TAGGGCTGGGAGGGTGCTGAAGG - Intergenic
1039862760 8:41473116-41473138 TTGTGAAGGCAGGATGCTGGAGG + Intergenic
1040935991 8:52782706-52782728 TAAGGAAGCCAGGCTGCTGCTGG - Intergenic
1041688436 8:60665929-60665951 TAGGGCAGGCAGGCAGTTCATGG - Intergenic
1041707690 8:60863962-60863984 CAGGGCAGGCAGATTGCTTGAGG - Intronic
1045346374 8:101297508-101297530 TGTGGTAGGCAGGCTGGTGGTGG + Intergenic
1045436397 8:102168993-102169015 TAAGGCAGGCAGATTGCTTGAGG + Intergenic
1045870521 8:106921978-106922000 TAGGTCAGGGAGGAAGCTGGGGG - Intergenic
1047311554 8:123696668-123696690 AAGGGCAGGCTAGGTGCTGGGGG + Intronic
1047326935 8:123848539-123848561 GTGGGCAGGGAGGCTGCCGGAGG + Intergenic
1048120728 8:131578638-131578660 AATGGCAGCCAGGCTTCTGGAGG + Intergenic
1048463049 8:134638859-134638881 GATGTCAGCCAGGCTGCTGGCGG - Intronic
1049193319 8:141301109-141301131 CGGGGCAGGCAGGCTGGAGGTGG - Intronic
1049263608 8:141653189-141653211 TAGGGCATGCATGCCCCTGGGGG + Intergenic
1049578359 8:143399943-143399965 TTGGGCCTGCAGTCTGCTGGGGG + Intergenic
1049614523 8:143570293-143570315 TGGAGCAGGCAGGAGGCTGGAGG - Exonic
1049690721 8:143957752-143957774 GAGGGCAGGCAGGGTGGTGGTGG - Intronic
1050589240 9:7145414-7145436 TAGGTGAGACAGGCTGATGGGGG + Intergenic
1051378176 9:16426395-16426417 TGAGGCAGGCAGATTGCTGGAGG - Intronic
1051711503 9:19935179-19935201 TAGGTCAGGCTGGAAGCTGGGGG - Intergenic
1052815988 9:33102928-33102950 TGGGGCAGGGAGGGTGCAGGTGG - Intergenic
1052825990 9:33175077-33175099 CAAGGCAGGAAGGCTGCTTGAGG + Intergenic
1054190620 9:61983612-61983634 TTGTGCAAGCAGGCTGCTTGTGG - Intergenic
1054462604 9:65473594-65473616 TTGTGCAAGCAGGCTGCTTGTGG + Intergenic
1055095677 9:72411282-72411304 TGGGGCAGGCAGGGTTCTGGAGG - Intergenic
1055788668 9:79898421-79898443 TAGGTCAGCCAGGTTGCTGTAGG - Intergenic
1055860999 9:80748667-80748689 TAGAGAGGGCAGGCTTCTGGTGG + Intergenic
1057498410 9:95578087-95578109 TAGGTCAGGCAGTGTGCTTGGGG - Intergenic
1057949498 9:99358724-99358746 GAGAGCAGGCAGGTGGCTGGTGG + Intergenic
1057976374 9:99609922-99609944 GAGGGCATGTAGGCTGCTGGAGG - Intergenic
1059324159 9:113493520-113493542 GTGGGGAGGCAGGATGCTGGGGG - Intronic
1059657524 9:116369766-116369788 TGGGGCAGGCAGGCAGCGGGTGG - Intronic
1060140910 9:121209178-121209200 TAGGGCAGGCCTCCTGCTGAAGG + Intronic
1060230571 9:121822483-121822505 AATGGCAGGCAGGCTGCCGAGGG - Exonic
1060470814 9:123946693-123946715 CAGGGCAGGCGGACTGCTTGAGG + Intergenic
1061627277 9:131848494-131848516 GAGGGAAGGCAGGCTGCCGCTGG + Intergenic
1062155391 9:135045489-135045511 TGGCACAGGCAGGCTGCAGGAGG + Intergenic
1062363540 9:136198478-136198500 CAGGGCGGGGAGGGTGCTGGGGG + Intronic
1062523529 9:136969339-136969361 CAGGGCAGGGAGGCTCCAGGCGG + Exonic
1062710724 9:137973821-137973843 GAGGGCAGACAGGATGTTGGAGG + Intronic
1203537344 Un_KI270743v1:53440-53462 CAGGCCAGGCATGCTGCTGGAGG + Intergenic
1186117784 X:6323230-6323252 TGAGGCAGGCGGGTTGCTGGAGG + Intergenic
1186195805 X:7109405-7109427 GAGGGCAGGCAGGACGATGGAGG + Intronic
1187392380 X:18894591-18894613 GAGGACAGGCTGGCTCCTGGAGG - Intronic
1189094195 X:38120748-38120770 GGGGGAAGGCAGGCTGCTGGAGG + Intronic
1189389987 X:40568439-40568461 TAGGGCAGGAAGATTGCTTGAGG - Intergenic
1190108382 X:47574335-47574357 GCGGGCGGGCGGGCTGCTGGAGG + Exonic
1190283337 X:48945956-48945978 TAGGTCAGGCTGGCTGCTTCTGG - Intronic
1192369151 X:70499118-70499140 TAGGACAGGCTGTCTGGTGGGGG + Intronic
1192587192 X:72328484-72328506 TAAGACAGGCAGGCTTATGGTGG + Intergenic
1195883311 X:109615106-109615128 AAGGGCAGGGATGCGGCTGGGGG + Intergenic
1196720648 X:118850557-118850579 TGAGGCAGGCAGGTTGCTTGAGG - Intergenic
1199895002 X:152119527-152119549 CAGGGTTGGCAGGGTGCTGGGGG + Intergenic
1200043842 X:153389081-153389103 CACAGCAGGCTGGCTGCTGGGGG - Intergenic
1201168104 Y:11229728-11229750 TAGGCCGGGCGTGCTGCTGGAGG - Intergenic