ID: 1127997178

View in Genome Browser
Species Human (GRCh38)
Location 15:64160031-64160053
Sequence TGGGAGGGCCAGGTTCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 1, 3: 65, 4: 359}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127997178_1127997188 15 Left 1127997178 15:64160031-64160053 CCCAGCAGAACCTGGCCCTCCCA 0: 1
1: 0
2: 1
3: 65
4: 359
Right 1127997188 15:64160069-64160091 TGACATACTCCTTGGCCCAGAGG 0: 1
1: 0
2: 1
3: 10
4: 154
1127997178_1127997187 7 Left 1127997178 15:64160031-64160053 CCCAGCAGAACCTGGCCCTCCCA 0: 1
1: 0
2: 1
3: 65
4: 359
Right 1127997187 15:64160061-64160083 GGCTACACTGACATACTCCTTGG 0: 1
1: 0
2: 0
3: 4
4: 84
1127997178_1127997189 23 Left 1127997178 15:64160031-64160053 CCCAGCAGAACCTGGCCCTCCCA 0: 1
1: 0
2: 1
3: 65
4: 359
Right 1127997189 15:64160077-64160099 TCCTTGGCCCAGAGGACCTGTGG 0: 1
1: 0
2: 4
3: 60
4: 1028

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127997178 Original CRISPR TGGGAGGGCCAGGTTCTGCT GGG (reversed) Intronic
900191258 1:1353258-1353280 TGGGGCTGCCAGGTTCTGATGGG + Exonic
900405264 1:2490199-2490221 TGGGTGGGCCAGGTGCTGGTGGG - Intronic
900493835 1:2967209-2967231 TGGGAGCGCCAGGTCCTCCCAGG - Intergenic
900535173 1:3173510-3173532 CGTGAGGGCCAGATTCAGCTCGG + Intronic
900948308 1:5843678-5843700 TGGGAGGGCCAGGGGGTGCAGGG + Intergenic
900992522 1:6104486-6104508 GGGCAGGGCCAGGGTCTCCTGGG + Exonic
902080785 1:13819167-13819189 AGGGAGAGCCAGGTGCAGCTGGG + Intronic
903392033 1:22971457-22971479 TGGGAGAGCCTGGTTCTTCCTGG - Intergenic
903660008 1:24971301-24971323 TGGGAGGGCAGGAATCTGCTGGG - Intergenic
903741946 1:25563525-25563547 TGCCAGGGCCGGGCTCTGCTGGG + Intronic
904330130 1:29753457-29753479 TGGGTTGGGCAGGTTCTGCCAGG + Intergenic
904695820 1:32330709-32330731 TGGGTGGGCGGGGTCCTGCTTGG + Intronic
904695857 1:32330916-32330938 CTGCAGGGCCAGGTTCGGCTGGG + Intronic
905442831 1:38005662-38005684 TGGGAGAGCCAGGTTAGGCCGGG - Intergenic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906141748 1:43537852-43537874 TGGGAGGGGCCGACTCTGCTTGG + Intronic
906678349 1:47709018-47709040 TGGCAGGGCCAGGCTCTGAAAGG - Intergenic
908031495 1:60004797-60004819 TTGGAGGGCCAGGTTTTACAGGG + Intronic
909153189 1:72035076-72035098 TGGGAGGGCCAGTCTTTTCTCGG + Intronic
909817578 1:80015960-80015982 TGGGCTGGCTGGGTTCTGCTAGG - Intergenic
910146504 1:84086274-84086296 AGGAAGGGCCAAGTTCTACTGGG - Intronic
910777232 1:90889163-90889185 TGGGAGGGAGAAGTTCTACTTGG + Intergenic
911318750 1:96386815-96386837 TAGGAGGGCCAGTTTCTTCGGGG - Intergenic
912717512 1:111992256-111992278 TGGGAGGGACAGCATCTCCTGGG - Intergenic
912864313 1:113243744-113243766 TGGGAGGGGTAGGTTGTGATGGG - Intergenic
913715612 1:121531158-121531180 TTGGAGAGTTAGGTTCTGCTAGG + Intergenic
914922053 1:151853768-151853790 GGGGAGGGACAGATGCTGCTTGG + Intergenic
915966163 1:160310532-160310554 TGAGTGGGACTGGTTCTGCTTGG + Intronic
916575893 1:166066110-166066132 TGGCAGGGCCTTGTTCAGCTGGG + Intronic
920910646 1:210213343-210213365 TGGGATGGCCAGTTTCTTCTTGG + Intergenic
923787417 1:237081419-237081441 AGGGAGGGCCAGGTTCTAAAGGG + Intronic
923865469 1:237934600-237934622 TGGGTGGGCCAGGTGTTCCTTGG + Intergenic
924275603 1:242383465-242383487 GGGGAGTGGCAGCTTCTGCTTGG + Intronic
924576113 1:245282579-245282601 TGGGAGGGCCAGCTTTTTCCAGG + Intronic
1064789456 10:18939532-18939554 TGAGAGGTCCATGTTCTCCTTGG + Intergenic
1065184599 10:23159551-23159573 TCTGAAGGCCAGGATCTGCTGGG + Intergenic
1065780516 10:29162391-29162413 TGGGAGGGCCAGCTTTTTCAAGG - Intergenic
1066309612 10:34183653-34183675 TGGGAGGGCCAGGTTTTCACGGG + Intronic
1066378855 10:34884380-34884402 TGGCAGGGGCAGGTTGTGCCGGG - Intergenic
1066471283 10:35700725-35700747 TGGGAGGGCCAGTTTTTTCGCGG + Intergenic
1066513939 10:36134198-36134220 TGGGCAGGGCAGGTCCTGCTCGG - Intergenic
1066678822 10:37916495-37916517 TGGGAGGATCACGCTCTGCTGGG + Intergenic
1067540183 10:47145153-47145175 TGGGAGGTCCAGGTCTTGCCTGG + Intergenic
1067697902 10:48548755-48548777 TGGGAGGGGCAGGGTTTGCCAGG + Intronic
1067789197 10:49275022-49275044 TGAGAAGGCCAGGTTCTGTGAGG + Intergenic
1070392958 10:75987401-75987423 TGGTGGGGGCAGCTTCTGCTGGG - Intronic
1071566266 10:86672925-86672947 AGGCTGGGCCAGGCTCTGCTGGG + Intronic
1071902866 10:90139720-90139742 TGGGAGGACCAGGTTTTTCTGGG + Intergenic
1072728448 10:97829038-97829060 TGGGAGAAACAGGTTCTGCATGG - Intergenic
1072740670 10:97907252-97907274 AGGAAGGACCAGTTTCTGCTAGG + Intronic
1072956096 10:99889383-99889405 TGGGAGTGCCAGGGTCGGATGGG - Intronic
1073123921 10:101137976-101137998 AGGGAGAGCCAGGCTCTCCTGGG + Intergenic
1073485969 10:103819459-103819481 TGGGAGAGCCAGGGCCAGCTGGG + Intronic
1073838507 10:107471491-107471513 TGGGAGGGCCAGGTTTTTCACGG - Intergenic
1075079182 10:119371260-119371282 TGGGAGGGCCTGGCTGTGCTCGG + Intronic
1075985106 10:126778546-126778568 GGGGAGGGCCAGGCTCATCTCGG - Intergenic
1076776191 10:132699510-132699532 TGGCCGGACCAGGTGCTGCTGGG + Intronic
1077021617 11:419533-419555 TGGTAGGGCCAGTTTCTCCCAGG + Intronic
1077526307 11:3067809-3067831 TGGGTGGGCTGTGTTCTGCTGGG - Intergenic
1078759161 11:14237877-14237899 GGGGTGGGCCTGGTTCTCCTGGG + Intronic
1080641759 11:34162470-34162492 TGAGAGGGCCAGGGCCTGCAGGG - Intronic
1081874147 11:46397392-46397414 TGTGAGGTCCGGTTTCTGCTTGG + Exonic
1083897153 11:65625567-65625589 TGGGAGGGGCATGTCCAGCTTGG + Intronic
1084315232 11:68341934-68341956 TGGGTGGGCCAGCTGGTGCTGGG + Intronic
1084332438 11:68438032-68438054 CGGGAGGGGCAGGGTCGGCTGGG - Intronic
1084399168 11:68933713-68933735 TGGGAGGGGTCGGTTCTGTTGGG + Intronic
1085352635 11:75809642-75809664 TGGCAGGGCCAGGTCCTGCCAGG - Intergenic
1086058491 11:82675992-82676014 TGGGAGGGCCAGGTTTTTCATGG - Intergenic
1086811351 11:91314274-91314296 TGGAAGGGCCAGGTGGTTCTCGG - Intergenic
1087316408 11:96608510-96608532 AGTGAGTGCCAGGCTCTGCTGGG + Intergenic
1087906450 11:103703358-103703380 TGGGAGAGCCATCTTCTCCTAGG + Intergenic
1089455371 11:118622584-118622606 TGGGTGGGCCTGGGACTGCTGGG + Intronic
1090077796 11:123590478-123590500 TGGGGAGGCCAGGCTCAGCTGGG + Intronic
1090081004 11:123612702-123612724 TGGGTGGGCCTGCCTCTGCTGGG - Intronic
1090887862 11:130895124-130895146 TGGGAGGCCCAGGTTGTGGAGGG + Intronic
1091051132 11:132373729-132373751 TGGGATGGCCAGTTCCTGCCTGG - Intergenic
1091896557 12:4109829-4109851 TGGGAAGGCCAGGGCCAGCTGGG + Intergenic
1093066755 12:14666147-14666169 TGAGAGGGCCAGTTTCTTCAGGG - Intronic
1093511596 12:19935896-19935918 TGGCAAGGCCATGTTCTCCTAGG - Intergenic
1094477277 12:30850897-30850919 TGGGAGGGCCGGGTTTTTCACGG + Intergenic
1094871994 12:34603887-34603909 CGGGAGGCCCAGGTTATCCTGGG + Intergenic
1095814272 12:46404497-46404519 TGGGTTGGCTAGGCTCTGCTAGG + Intergenic
1096617155 12:52839856-52839878 CAGCCGGGCCAGGTTCTGCTTGG + Exonic
1096908721 12:54961203-54961225 TGGGGGTGCCTGGGTCTGCTGGG + Exonic
1096957326 12:55539894-55539916 TGGGAGGGCCAGGTTTTTCAGGG - Intergenic
1098499488 12:71174352-71174374 TGGGAGGGCTGGGTTGTGCAAGG - Intronic
1098972673 12:76872608-76872630 TGTGAGGGCCAGCTTTTTCTTGG + Intronic
1100409456 12:94300480-94300502 TAGGAGGGCCAGGTCATGCAGGG + Intronic
1101064284 12:101003137-101003159 TGTGTCAGCCAGGTTCTGCTGGG + Intronic
1101187404 12:102293489-102293511 TGGCAGGGCCACGTTCTTCCTGG - Intergenic
1101808851 12:108090663-108090685 TGGGAAGGCCAGGTTTTTCACGG - Intergenic
1102029407 12:109731348-109731370 TGGGAGGGCCGGATTCTGAGTGG - Intronic
1102762467 12:115400143-115400165 ATGGAGGGCCAGGTTCAGCTGGG + Intergenic
1103916048 12:124376246-124376268 GGGGAGGGGCATGCTCTGCTGGG - Intronic
1104038327 12:125113900-125113922 TGGGAGGGAGCGGTTCTGCTTGG + Intronic
1104847779 12:131855449-131855471 AGGGAGGGACAGGTGCGGCTGGG - Intergenic
1105396740 13:20043631-20043653 TGAAAGGGCCAGGTTGTGGTGGG + Intronic
1105801195 13:23904090-23904112 TGGGCGGCCCAGGCTCAGCTGGG + Intergenic
1105809722 13:23984499-23984521 TGGGAAGGACAGGTGCTGCGCGG - Intronic
1105924800 13:24998236-24998258 TGGGAGGGCCAGGTTCTTTGTGG + Intergenic
1105929926 13:25042637-25042659 TGGGAAGGGCAGGTGCTGCAGGG + Intergenic
1106127147 13:26909835-26909857 TGGGAGGGAAGGGCTCTGCTGGG + Intergenic
1106470998 13:30054102-30054124 TGGGAGGGCCAGGTTTTTCGCGG - Intergenic
1109274344 13:60286966-60286988 TGGGAGGGCCAGTTTTTTCGCGG + Intergenic
1109324849 13:60854768-60854790 TGGGAAAGCTAGGTTCTGCAGGG + Intergenic
1109682306 13:65768741-65768763 TGGGAGGGCCAGTTTTTTCACGG - Intergenic
1112124310 13:96447675-96447697 TGGGAGGGCCAGTTTTTTCTAGG + Intronic
1112564756 13:100543902-100543924 TGGTGGGCCCAGGATCTGCTGGG - Intronic
1113078567 13:106492637-106492659 TGGAAGGGCCGGCTTCTGCCTGG - Exonic
1113902555 13:113804946-113804968 TGCGTAGGCCAGGATCTGCTGGG - Exonic
1114461230 14:22887168-22887190 TGAGCGGGGCGGGTTCTGCTGGG + Exonic
1114519417 14:23323704-23323726 GGGGAGGGGCAGCTTCTACTTGG + Intronic
1114794331 14:25695485-25695507 TTGGAGGGCCTAGGTCTGCTAGG - Intergenic
1115652757 14:35414878-35414900 TGGGTGGGGCAGGGGCTGCTGGG + Intergenic
1116919724 14:50560373-50560395 AGGGAGGGCCAAGGGCTGCTAGG + Intronic
1117818890 14:59627876-59627898 TAGGAGGGACAAGTTTTGCTTGG - Intronic
1118654108 14:67928514-67928536 TGGGAGGGCCAGGTTTTTCACGG - Intronic
1118756549 14:68849090-68849112 TGGGAGGGCCACTTTATGCCAGG + Intergenic
1119471839 14:74905447-74905469 GGGGAGGACCAGGTTCTGTGGGG - Exonic
1120265974 14:82251637-82251659 TGGGAGGGCCAGTTTTTCATGGG - Intergenic
1122031610 14:98916297-98916319 TGGAAGGGCCAGGTCCCGCCAGG - Intergenic
1122745257 14:103894052-103894074 GGTGAGGGCCAGGTTCTGGGAGG + Intergenic
1122817283 14:104319962-104319984 TGGGAAAGCCAGGTTCTCCAGGG - Intergenic
1122877999 14:104677646-104677668 TGGTGTGGCCTGGTTCTGCTGGG + Intergenic
1122960801 14:105092942-105092964 TGGGATTGCCAGGGTCTGGTGGG + Intergenic
1123578400 15:21695219-21695241 TGGGAGGGCCATCCTCTGCTCGG + Intergenic
1123615025 15:22137701-22137723 TGGGAGGGCCATCCTCTGCTCGG + Intergenic
1125070536 15:35548092-35548114 TGGGAGAGCCAGGTTTTTCGTGG - Intergenic
1125087570 15:35748199-35748221 TAGGAGGGCCAGGTTTTTCACGG - Intergenic
1125758323 15:42081038-42081060 TAGGAGGCCCAGCTTCTGCAAGG + Exonic
1126870785 15:52984641-52984663 TGGGACGGCCAGTGACTGCTGGG + Intergenic
1127997178 15:64160031-64160053 TGGGAGGGCCAGGTTCTGCTGGG - Intronic
1128537098 15:68499911-68499933 TGGGAGGGAAAGGTGATGCTCGG - Intergenic
1128784380 15:70384037-70384059 TGGCAGGGCCAGCTTCTGGGAGG - Intergenic
1128986051 15:72222415-72222437 TGGGATGGGCAGTTTGTGCTGGG - Intronic
1129731569 15:77935419-77935441 TGGGAGGGGGAGCTTCAGCTGGG + Intergenic
1130263931 15:82381528-82381550 TGGGAGGGCCACGTTTTTCTCGG + Intergenic
1130277100 15:82486063-82486085 TGGGAGGGCCACGTTTTTCTCGG - Intergenic
1130469462 15:84213413-84213435 TGGGAGGGCCACGTTTTTCTCGG - Intergenic
1130476952 15:84327977-84327999 TGGGAGGGCCACGTTTTTCTCGG - Intergenic
1130494813 15:84460153-84460175 TGGGAGGGCCACGTTTTTCTCGG + Intergenic
1130535039 15:84778399-84778421 TGGGAGGGCCAGCTTTTTCTCGG - Intronic
1130591756 15:85218042-85218064 TGGGAGGGCCACGTTTTTCTCGG - Intergenic
1130662077 15:85838691-85838713 TGGGAGGGCAGGGTGCAGCTGGG - Intergenic
1130703996 15:86214775-86214797 TGGGAGGGCCCCATTCTGCCTGG - Intronic
1130819067 15:87473523-87473545 TGGGAGGGGCAGGGGGTGCTAGG + Intergenic
1131006947 15:88986147-88986169 TGGGAGGGCCAGGTTTTTTGAGG - Intergenic
1131674832 15:94661377-94661399 TGGGAGGGCCAGGTGCTCCGTGG - Intergenic
1202987270 15_KI270727v1_random:429464-429486 TGGGAGGGCCATCCTCTGCTCGG + Intergenic
1132537981 16:492675-492697 TGGGAGGGCAAGTCTCTGCGTGG - Intronic
1132556110 16:573367-573389 AGGGAGGGCCAGGCACTGCCGGG + Intronic
1133315442 16:4880687-4880709 TGTGGGGGCCAGTTTCTCCTCGG + Exonic
1134288094 16:12879723-12879745 TGGGAGGACCAGATTCTGGTGGG - Intergenic
1134313116 16:13094005-13094027 TGAAAGGGCCAGCTTCTGTTGGG - Intronic
1135941376 16:26824893-26824915 GGGAGGGGGCAGGTTCTGCTGGG + Intergenic
1136026421 16:27471789-27471811 GGGGAGGGCCCGGTTCTTCTTGG + Exonic
1136147117 16:28322199-28322221 TGGGAGGACCAGGGTGTGGTGGG - Exonic
1136155590 16:28380061-28380083 CTGCAGAGCCAGGTTCTGCTGGG + Exonic
1136207494 16:28735228-28735250 CTGCAGAGCCAGGTTCTGCTGGG - Exonic
1136687416 16:32003430-32003452 TGGGAGGGGCATGGACTGCTGGG - Intergenic
1136788030 16:32946981-32947003 TGGGAGGGGCATGGACTGCTGGG - Intergenic
1136881755 16:33906808-33906830 TGGGAGGGGCATGGACTGCTGGG + Intergenic
1138393870 16:56689803-56689825 TGGTAGGGCCAGCATCTGTTTGG - Intronic
1139484500 16:67248306-67248328 AGGGAGGGCCAGGTGCCCCTTGG + Intronic
1139547497 16:67656573-67656595 GGGGAGGGGCTGGTTCTGCAGGG - Exonic
1139957866 16:70701671-70701693 AGGGAGGGGCATGTTCTGATGGG - Intronic
1140200318 16:72889689-72889711 TGGGAGGCCCAGGTTGGGCCTGG - Intronic
1141508423 16:84496259-84496281 TGGGAGGGCCAGCTTTTTCATGG + Intronic
1141583975 16:85020705-85020727 TGGAAGGGCCAGGTCATGCTGGG + Intergenic
1141803087 16:86324132-86324154 TGGGAAGGGCAGGAGCTGCTGGG - Intergenic
1141810756 16:86373842-86373864 ATGGAGGGCCAGGTTCTGCATGG - Intergenic
1141920121 16:87130039-87130061 TGGGGGGTGCAGGTTCTGATGGG - Intronic
1142030152 16:87834574-87834596 AGGCAGGGCCAGGTTCACCTGGG + Exonic
1142412055 16:89921870-89921892 TGGCAGGGCCCGCCTCTGCTGGG + Intronic
1203090255 16_KI270728v1_random:1208638-1208660 TGGGAGGGGCATGGACTGCTGGG - Intergenic
1142966888 17:3587216-3587238 TTGGAGGCCCAGGTTCAGCATGG + Intronic
1143299024 17:5895436-5895458 TGGGAGGGCCAGTTTTTTCATGG + Intronic
1143326132 17:6099676-6099698 TGGGAGGGCCAGGTTTTTCAAGG + Intronic
1143762000 17:9111478-9111500 TGGGAGAGGCAGGTTCTTCTGGG + Intronic
1144093061 17:11875016-11875038 TGGGAGGCCCTCGTTCTGCCAGG - Exonic
1144127984 17:12220603-12220625 TTGGAGGGCCAGGTTTTTCACGG - Intergenic
1144150622 17:12439819-12439841 TGGGAGGGCCAGTTTTTTCCTGG - Intergenic
1144608253 17:16686813-16686835 AGGGAAGGGAAGGTTCTGCTGGG + Intergenic
1144643381 17:16952098-16952120 AGGGAGGGCCTAGTTCTACTGGG + Intronic
1144701462 17:17343615-17343637 TGGGAGGGCAAGGACCTGCCCGG + Intronic
1144704000 17:17355550-17355572 GGGGAGGGCCAGGTCCTGAAGGG - Intergenic
1145128024 17:20317763-20317785 GGGGAAGGGAAGGTTCTGCTGGG + Intronic
1145196584 17:20899449-20899471 AGGGAAGGGAAGGTTCTGCTGGG - Intergenic
1145206981 17:20989828-20989850 TGGGAGGCCGATGTCCTGCTGGG + Intergenic
1146404529 17:32525851-32525873 TGGGAGGTCCAGTTTCTCCTCGG - Intronic
1147148397 17:38499099-38499121 TGGGAGGGGCATGGACTGCTGGG - Intronic
1147265059 17:39229605-39229627 AGCGAGGGCCAGGTGCTGCCGGG + Intergenic
1148014544 17:44511946-44511968 TGGGAGGGCCAGCTTTTTCGTGG + Intergenic
1148445675 17:47735483-47735505 TGAGAGGGACAGGATCTTCTGGG - Intronic
1149450529 17:56746557-56746579 GGGCAGGGGCAGTTTCTGCTGGG - Intergenic
1149610135 17:57953925-57953947 TGGGATGGAGAGGTGCTGCTGGG - Intronic
1150210014 17:63436703-63436725 TGGGATCACAAGGTTCTGCTTGG - Intronic
1151887838 17:76933514-76933536 TGGGAGGTCAAGGTCCTGCTTGG + Intronic
1151931505 17:77234944-77234966 AGGGAGGGCCAGGGCCGGCTGGG + Intergenic
1153636991 18:7121193-7121215 TGGGAGGACCAGGTACCGATTGG + Intergenic
1156288344 18:35721864-35721886 TGGGTGTGCCTGCTTCTGCTGGG + Intergenic
1156308922 18:35904957-35904979 TGGGCTGCCCAGCTTCTGCTTGG + Intergenic
1156493725 18:37512114-37512136 TGGGAGGGCCAGGGACAGTTGGG + Intronic
1157281944 18:46352036-46352058 TGGGAGTGACAGGGTCTGCCAGG - Intronic
1157318055 18:46610114-46610136 TGGGAGGGAGAGGTTCTGGTGGG + Intronic
1157480472 18:48050487-48050509 TGAGTGGGCCAGGCTCAGCTGGG - Intronic
1157497583 18:48167240-48167262 TGGGAGGGGCAGGTTGGACTGGG - Intronic
1160492903 18:79352726-79352748 GAGGAGGGCCAGGCTCTGGTGGG + Intronic
1160749770 19:728256-728278 CGGGAGGCCCAGGCTGTGCTCGG + Intronic
1161260765 19:3336739-3336761 AGGGGGGGCCAGGTCCAGCTGGG - Intergenic
1161301492 19:3544994-3545016 GGGGAGGCACAGGTTCAGCTTGG - Intronic
1161493510 19:4575437-4575459 AGGGAGTGCCAAGTGCTGCTGGG + Intergenic
1162396120 19:10418965-10418987 TGGGGGGGCCGGTTTTTGCTCGG + Intronic
1162924047 19:13920750-13920772 TAGGAAGGCCAGCTGCTGCTGGG - Exonic
1163229784 19:15993340-15993362 AAGGAGGACCAGGTTGTGCTGGG + Intergenic
1163511745 19:17739558-17739580 TGGGGGTGCCAGGTCCTGGTGGG + Intergenic
1163681493 19:18684739-18684761 GGGGCAGGCCAGGTTCTGCCAGG + Intronic
1163705199 19:18808309-18808331 TTGGAGGCCCGGGTTCTGCAGGG + Intergenic
1164064117 19:21699426-21699448 TGGGAGGGCCAGCCTTTGCATGG + Intergenic
1164393823 19:27846898-27846920 TGGGAGGGGAAGGGTCTGGTCGG + Intergenic
1164460927 19:28446714-28446736 TGGGAGGGCCAGGTTTTTGCGGG + Intergenic
1164575691 19:29404193-29404215 CGGGAGAGGCAGGTGCTGCTGGG + Intergenic
1165788190 19:38474911-38474933 TGGGAGGGGCTGCTGCTGCTGGG + Intronic
1166239541 19:41480545-41480567 TGGGAGGGCCAGTTTTTCCGTGG + Intergenic
1166411545 19:42558664-42558686 GTGGAGGGCCAGTTTCTTCTTGG + Intronic
1166439025 19:42794414-42794436 TGGGAGGGCCAGTCTTTTCTCGG - Intronic
1166487988 19:43230265-43230287 TGGGAGGGCCAGTCTTTTCTCGG - Intronic
1166823527 19:45595394-45595416 GGGGAGAGCCAGGAGCTGCTGGG + Intronic
1168344278 19:55642754-55642776 TGCGAGGGCCGGGCTCTCCTGGG - Exonic
1168686541 19:58352610-58352632 TGTGGGGCCCAGGTTCTGCTGGG - Intronic
925251960 2:2446342-2446364 GGGGAGGGCCAGGTAGGGCTGGG + Intergenic
925919258 2:8627972-8627994 AGGGTGGGGCAGGTCCTGCTTGG - Intergenic
927821170 2:26266457-26266479 TTGGAAGGCCAGGTTCTTATGGG + Intronic
930241822 2:48943338-48943360 TGGGAGGGCCAAGTTCACGTTGG + Intergenic
930255010 2:49080728-49080750 TGGGAGGGGCAGTTTCTTCAGGG - Intronic
931345758 2:61444680-61444702 TGGGAGGGCCAGCTTTTTCACGG + Intronic
932292552 2:70594762-70594784 AGGGATGGCCATGTTCTGCTGGG - Intergenic
932448429 2:71794733-71794755 GGGAAGGCCCAGCTTCTGCTGGG - Intergenic
932822783 2:74915619-74915641 TGGTCAGGCCAGGCTCTGCTGGG + Intergenic
933264715 2:80169383-80169405 TGGGAAGGCCAGATTCTGATTGG - Intronic
934028976 2:88024649-88024671 TGGGAGGGCCAGTTTTTTCACGG - Intergenic
935133617 2:100279606-100279628 TGGGATGGGCAGTTTCTCCTGGG - Exonic
935139176 2:100336907-100336929 TGGGAGGGCCAGTCTTTTCTCGG + Intergenic
936268363 2:111028878-111028900 TGGGAGGGGCAGGTTTTGCCAGG + Intronic
936685370 2:114821194-114821216 TGGGAGGGCCAGCTTTTTCACGG - Intronic
937879559 2:126855312-126855334 GGGGAGCGCCAGGCTCAGCTGGG - Intergenic
942252965 2:174063452-174063474 TCAGAGGGCCTGGTTCTCCTAGG + Intergenic
943618367 2:190119415-190119437 TGGGAGGGCCAGTTTTTTCTGGG - Intronic
944748076 2:202678401-202678423 TGGGAGGGCCAGTTTTTTCACGG - Intronic
944855643 2:203764486-203764508 TGGCAGGGCCTGGTACTCCTGGG + Intergenic
945064877 2:205940130-205940152 TGGGAGGGCCAGCTTTTTCATGG - Intergenic
946691775 2:222313620-222313642 TTGGAGGGCCAAGTTCCGCAAGG - Intergenic
947598467 2:231429292-231429314 TGGGAGGGCCAGCTTTTTCACGG - Intergenic
1169197054 20:3688982-3689004 TAGGAGAGCCCTGTTCTGCTCGG - Intronic
1170110142 20:12796050-12796072 CTGCAGGGCCAGGTTCTGCAGGG - Intergenic
1172440912 20:34965911-34965933 TGGCAGGGCCAGGTCAGGCTGGG + Intergenic
1172580549 20:36044095-36044117 AGAGAGGGCCAGGCCCTGCTGGG - Intergenic
1173247658 20:41347661-41347683 TGGGCGGGGCAGGTGCTGTTAGG - Intronic
1173553344 20:43948612-43948634 TGGGAGGCCCCGGGCCTGCTGGG + Intronic
1173873608 20:46356669-46356691 TGGGAGGTCCACACTCTGCTGGG + Intronic
1174056940 20:47804474-47804496 TGGGAGGGCCAGCTTTTTCATGG + Intergenic
1174078496 20:47954603-47954625 TGGGAGGATCAGGATCTGCTGGG + Intergenic
1174310475 20:49649504-49649526 TGGGAGGTCGAGGTTCCGGTGGG + Intronic
1174660575 20:52209338-52209360 TGGGAGGGCCAGTTTTTTCGTGG - Intergenic
1174747271 20:53075806-53075828 GGTGGGAGCCAGGTTCTGCTGGG + Intronic
1175530853 20:59673564-59673586 TGGGAGCCCCAGGTGCTGCCAGG - Intronic
1175681772 20:60994628-60994650 TGGGAGGGACAGATTCTACTGGG - Intergenic
1176164477 20:63665510-63665532 AGGGAGAGCCAGGTTTTCCTGGG - Intronic
1176257499 20:64159872-64159894 TGGAAGGTCCAGGTCCTTCTGGG + Intronic
1176861305 21:14012869-14012891 AGGGAGGGCCTGGTGGTGCTTGG + Intergenic
1177332696 21:19682981-19683003 TGGGAGGGCCAGTTTTTTCGTGG + Intergenic
1179557173 21:42187131-42187153 TGGCAGGGTCAGGGTCTGGTGGG + Intergenic
1179801514 21:43813503-43813525 TGGGGGGCCCAGGGGCTGCTGGG - Intergenic
1179862810 21:44199659-44199681 TGGGAGGGCCAGGTTTCTCATGG + Intergenic
1179885778 21:44313707-44313729 TGGGTGGCCCGGGTGCTGCTGGG + Intronic
1180094048 21:45546473-45546495 TGGGAGGGGCTGGGCCTGCTAGG - Intergenic
1180230153 21:46422215-46422237 TTGGAGGGCCAGCTTTTCCTGGG + Intronic
1181029442 22:20142817-20142839 AGGGAGGTCCAGGCTCGGCTCGG - Exonic
1181837164 22:25620274-25620296 TGGGAGGGCCAGCTTTTTCGCGG - Intronic
1182825296 22:33259904-33259926 TGGGAGGGCCAGTCTCTCCAGGG - Intronic
1183037681 22:35152447-35152469 TGGGAGGGCCAGTTTTTTCGTGG - Intergenic
1183213303 22:36464089-36464111 TGGTAGGGGCAGGCACTGCTCGG + Intergenic
1183256250 22:36764265-36764287 TGTCTGGGCCAGGCTCTGCTGGG + Intronic
1183623904 22:38990187-38990209 TGGAGAGGCCAAGTTCTGCTTGG + Intronic
1184149805 22:42631382-42631404 AGGGAGGCCCAGGATGTGCTGGG + Exonic
1184444385 22:44538974-44538996 TGGAAAGGCCAGGATCTGCCTGG - Intergenic
1184710459 22:46246591-46246613 TGGGTGGGCCAGGTTCACCTGGG - Intronic
1185044056 22:48520173-48520195 TGGCAGGGCCAGTTCCTTCTGGG - Intronic
1185302190 22:50087682-50087704 TGGGAGGAGCAGGTGCTGCCTGG + Intergenic
950194490 3:10999648-10999670 TGGGAGAGCCGCCTTCTGCTGGG + Intronic
950659072 3:14455498-14455520 TGGGATGTCCAGGGTCTGGTGGG + Intronic
951552632 3:23890016-23890038 TTGGAGGTCCAGGTTTTGCCTGG + Intronic
953076619 3:39577664-39577686 TGGGAGGGCCAGTTTTTCGTTGG - Intergenic
953385596 3:42504153-42504175 TGGGAGGGCCAGATGGTGGTTGG - Intronic
954136391 3:48584009-48584031 AGTGAGGGACAGGTTGTGCTAGG - Intronic
957274136 3:78068361-78068383 TGGGAGGGCCAGTTTTTTCGAGG - Intergenic
959175532 3:102904757-102904779 TGGGAGGGCCAGCTTTTTCGCGG - Intergenic
960719981 3:120616320-120616342 TGGGAGGGCCAGCTTTTTCGTGG - Intergenic
961346422 3:126266496-126266518 TGGGGAGGCCAGGCGCTGCTTGG + Intergenic
961404603 3:126669102-126669124 TGGGACGCCCAGGTTCTCCAAGG - Intergenic
961640544 3:128362090-128362112 TGGGAGGCCCATGTGGTGCTTGG + Intronic
963035142 3:141019440-141019462 GGGGTGGGCCAGCCTCTGCTTGG + Intergenic
963226415 3:142867046-142867068 TGGGAGGGCCAGTTTTTTCAAGG + Intronic
964195777 3:154062716-154062738 TGGGAGGGCCAGTTTTTTGTGGG + Intergenic
966950729 3:184814489-184814511 TGGGATGGCCTGTTGCTGCTAGG + Intronic
968891498 4:3371794-3371816 TGGGAGGGTCAGGGAATGCTGGG + Intronic
968973078 4:3806215-3806237 TGGGTTGACCAGGCTCTGCTGGG - Intergenic
969578788 4:8051844-8051866 TGGGAGGGCCAGCTTTTCCATGG + Intronic
970599098 4:17626894-17626916 TGGGAGGCAGAGGTTCTTCTGGG - Exonic
971500558 4:27313860-27313882 CGGGAGGCCCAGGTGCTGCCTGG - Intergenic
973924870 4:55727511-55727533 TTGGAGGGCCAGATTGTGCTAGG - Intergenic
974223222 4:59003319-59003341 TGGGATGGCCAGTTTCTTCATGG + Intergenic
974648077 4:64719188-64719210 TGGGAGGGCCAGTTTTTTCATGG - Intergenic
976267214 4:83195564-83195586 TGGAAGGGCCAGTTTCTTCTGGG + Intergenic
978459902 4:108940337-108940359 TGGGAGTGCCCTGTGCTGCTTGG + Intronic
979937379 4:126715191-126715213 TGGGAGGGCCAGTCTTTTCTTGG - Intergenic
982224846 4:153155912-153155934 AAGGAGGGCCAGGACCTGCTGGG + Intronic
983553438 4:169038848-169038870 GGGGAGGGGCAGGTACTCCTGGG + Intergenic
985378881 4:189371562-189371584 TGGCAGGGCCAGTTTCTTCTGGG + Intergenic
985573114 5:661215-661237 AGAGAGGGACAGGTTCTGTTGGG - Exonic
985573139 5:661320-661342 AGAGAGGGACAGGTTCTGTTGGG - Exonic
986691725 5:10318894-10318916 TGGGTTGGCCATATTCTGCTAGG + Intergenic
986892930 5:12331256-12331278 TGGGAGGGCCAGTTTTTTCATGG + Intergenic
986948526 5:13053173-13053195 TGGGAGGGCCAGGTTTTTCGTGG + Intergenic
987508000 5:18798224-18798246 TGGGAGGGCCAGTTTTTTCTTGG - Intergenic
987668388 5:20975462-20975484 TGGGAGGGCCAGGTTTTTTGTGG - Intergenic
988584981 5:32500384-32500406 TGGGAGGGCCAGCTTTTTCTCGG + Intergenic
989962188 5:50429525-50429547 TTGGAGAGTTAGGTTCTGCTAGG - Intronic
990602240 5:57370831-57370853 TAGGAGGGCAGGGTACTGCTTGG - Intergenic
990951661 5:61304614-61304636 TGGGACGCCGAGGTTCTGCTGGG - Intergenic
991000435 5:61777475-61777497 GGGGAGTGCCAGGTCCTGCCGGG + Intergenic
994584156 5:101684213-101684235 TGGGTTGGCCAGGCTCAGCTGGG - Intergenic
997230865 5:132242029-132242051 TGGGATGGCCAATTTCTTCTCGG + Intronic
997761655 5:136454402-136454424 TGGGATTGCCATGCTCTGCTTGG + Intergenic
998345123 5:141455548-141455570 TGGGAGGGCCAGCTTTTTCTCGG - Intronic
998642482 5:144026954-144026976 TGGGAGAGGCAGGTTTTGTTAGG + Intergenic
999252002 5:150188326-150188348 TGGGAGGAGCAGGTGCTGCTAGG + Intergenic
999454317 5:151702439-151702461 TGTGAGGGCCAAGTGCAGCTTGG + Intergenic
1001661383 5:173396155-173396177 TGGGAGTGCGAGGTTTTACTGGG + Intergenic
1002063922 5:176642874-176642896 TGGGCGGGGCAGGTGCTGGTGGG + Intronic
1002575526 5:180171829-180171851 TGTGAGGGCCAGGACCTGCTCGG + Intronic
1003015371 6:2463297-2463319 TGGGAGAGCCAGGTACGACTGGG - Intergenic
1003301708 6:4889913-4889935 AGGGAGGGACAGGATCTGCCTGG + Intronic
1006130518 6:31866198-31866220 TGGGAGGGGCAGGAGCTACTGGG - Intronic
1006653036 6:35567102-35567124 TGGGAGGAACAGTTTCTGCGGGG + Intergenic
1006924455 6:37646919-37646941 TGGGCAGGCAAGGGTCTGCTGGG - Intronic
1007591013 6:43021004-43021026 AGGGCCAGCCAGGTTCTGCTGGG + Exonic
1008691566 6:53984802-53984824 TGGGAGGGCATGGTCCTGTTGGG + Intronic
1008828434 6:55728211-55728233 TGGGTTGACCAGGTTCTGCTAGG - Intergenic
1009530745 6:64811201-64811223 TGGGAGGTGCAGTTTCTACTGGG - Intronic
1013987597 6:116214440-116214462 AGTGAGGACCATGTTCTGCTAGG + Intronic
1015684996 6:135849766-135849788 TGGGAGGGCCAGATTTTGGAAGG - Intergenic
1016698409 6:147025657-147025679 AGGGAGGGCCAGGTGATACTTGG - Intergenic
1017742133 6:157416027-157416049 GGGAAGATCCAGGTTCTGCTTGG - Intronic
1019331916 7:464518-464540 TGGCTGGGGCAGGTTCAGCTCGG - Intergenic
1020125594 7:5531009-5531031 GGGGTGGGCCAGGGTCTGCACGG + Intronic
1022279334 7:28890290-28890312 CGGGAGGGCCAGGTTTTTCCTGG - Intergenic
1023831154 7:44039678-44039700 AGGAAGGACCAGGTTCTGCTAGG + Intergenic
1025170757 7:56754437-56754459 TGCCAGGGTCAGGCTCTGCTTGG + Intergenic
1025236072 7:57235704-57235726 TGGGAGGGCCAGCTTTTTCATGG - Intergenic
1025701127 7:63821262-63821284 TGCCAGGGTCAGGCTCTGCTTGG - Intergenic
1026840899 7:73669474-73669496 CCGCAGGGCCAGGTTCTCCTTGG - Exonic
1027190528 7:75993579-75993601 TGGCAGGGCCAGGGGCAGCTGGG + Intronic
1028589239 7:92478941-92478963 TGGGAGGGCCAGGTTTTTTGCGG + Intergenic
1028737908 7:94238553-94238575 TGGGAGGCACAGGTTTTTCTTGG - Intergenic
1029741482 7:102493984-102494006 AGGAAGGACCAGGTTCTGCTAGG + Intronic
1029759474 7:102593153-102593175 AGGAAGGACCAGGTTCTGCTAGG + Intronic
1029776841 7:102689063-102689085 AGGAAGGACCAGGTTCTGCTAGG + Intergenic
1030259089 7:107543864-107543886 AGAGGAGGCCAGGTTCTGCTGGG - Intronic
1030622093 7:111801193-111801215 TGGGAGGGCCAGGTTTTTTGCGG + Intronic
1031410637 7:121436903-121436925 TGGGAGGGCCAGCTTTTTCATGG - Intergenic
1034410426 7:150938522-150938544 TGGGAGGCACAGGATCTCCTGGG - Intergenic
1034438959 7:151076968-151076990 CGGGACGGCCGGGTGCTGCTGGG - Exonic
1035347814 7:158217228-158217250 TGGGAGGTCAAGGTGCAGCTAGG - Intronic
1035456547 7:159013150-159013172 TGGGGGCCCCAGGCTCTGCTGGG + Intergenic
1038692198 8:29773759-29773781 TGGGTGGGCTGGGTTCAGCTGGG - Intergenic
1038720903 8:30034564-30034586 TGGGAGGGCCAGGTTTTTCTTGG - Intergenic
1042875941 8:73440066-73440088 TGGGAAGACCAGATTTTGCTTGG + Intronic
1044226975 8:89730294-89730316 AGGGAAGTCCAGGTTCTGATAGG - Intergenic
1044535736 8:93354648-93354670 TGGCAGGGCCAGGTTCTTGCTGG + Intergenic
1045081410 8:98629761-98629783 TGGGAGGGGCAGTCTCTCCTGGG - Intronic
1045350012 8:101329909-101329931 TGAGGGGGCCAGGTACTCCTGGG - Intergenic
1046715378 8:117561237-117561259 TGTGAGAGCCAAGGTCTGCTTGG - Intergenic
1047650479 8:126914806-126914828 GTGGAAGGCCAGTTTCTGCTGGG + Intergenic
1047681453 8:127258199-127258221 AGGGAGGACCGGGTTCTTCTTGG + Intergenic
1049096699 8:140552413-140552435 TGGGAGGGACAGGCACTCCTAGG + Intronic
1050830227 9:10000892-10000914 TGGGAGGGTCAGGTTTTTCTGGG + Intronic
1052718336 9:32145545-32145567 TGGGAGGGCCAGGTTTTTTGCGG + Intergenic
1053017025 9:34667687-34667709 GGGGAGGGCCAGGCTTTCCTTGG + Intergenic
1056400494 9:86222930-86222952 TGGGAGGGCCTGGGCCTGCCTGG + Intronic
1056915196 9:90740095-90740117 TGGGTGGGCCAGGTGTTCCTTGG + Intergenic
1057211315 9:93202519-93202541 TGGGAGGGGCGGGAACTGCTGGG + Intronic
1057699138 9:97350214-97350236 TGGGAGGGGCAGGTGGTGATAGG - Intronic
1057760901 9:97873684-97873706 TGGGAAGGCCAGGTTGTTCATGG + Intergenic
1061517737 9:131099248-131099270 GGGGAAGACGAGGTTCTGCTGGG - Intronic
1061663629 9:132147526-132147548 TGGGAGGTGGAGGTTGTGCTTGG - Intergenic
1061805503 9:133135492-133135514 TGGCAGGGCTGGGTCCTGCTGGG - Intronic
1062017841 9:134300546-134300568 TGGGAGGGACAGGTTGTGCGTGG - Intergenic
1062245051 9:135561872-135561894 TGGGAGCTCCAGGTCCTGCTTGG - Exonic
1062249724 9:135588072-135588094 TGGGAGCTCCACGTCCTGCTTGG - Intergenic
1062317816 9:135977135-135977157 CGGGAGGGCGAGGTCCTCCTTGG + Intergenic
1062444209 9:136586923-136586945 CTGGAGGGCCAGCTTCTGCCAGG - Intergenic
1062467673 9:136688164-136688186 TGGCAGGGCAAGGTGCAGCTGGG + Intergenic
1062580559 9:137227545-137227567 TGGGAGGCCCAGGTTCCGGGAGG - Exonic
1062688590 9:137828926-137828948 TGGGAGGGCCAGGCCCATCTGGG - Intronic
1062710117 9:137970964-137970986 AGGGAGGGCCAGATGCTGCAGGG + Intronic
1185451520 X:283443-283465 TGGGCGGGCCAGGTTTTTCGCGG - Intronic
1185643499 X:1600993-1601015 TGGGTGGGCCGGGCTCTCCTTGG - Exonic
1188148954 X:26649051-26649073 TGGGAGGGCCAGGTTTTTCATGG - Intergenic
1188765849 X:34089610-34089632 AGGGAGGGACAGGTTCTGAATGG - Intergenic
1189590400 X:42505187-42505209 TGGGAGGGCCAGCTTTTTCGAGG - Intergenic
1190538787 X:51456462-51456484 TGGGAGGGCCAGGTTTTTCACGG + Intergenic
1190539424 X:51461869-51461891 TGGGAAGGCCAGGTTTTTCTTGG + Intergenic
1190652138 X:52577686-52577708 TGGGAGGTTCAGATGCTGCTTGG + Intergenic
1191204178 X:57816829-57816851 TGAGAGGGCCAGGTTTTTCATGG - Intergenic
1191204866 X:57822922-57822944 TGAGAGGGCCAGGTTTTTCATGG - Intergenic
1191889560 X:65926310-65926332 TGGGAGGGCCAGTTTTTTATGGG - Intergenic
1193586870 X:83333404-83333426 TGGGAAGGCAAGGTGCTACTTGG - Intergenic
1194207390 X:91028499-91028521 TGGGAGGGCCAGTTTTTTCATGG - Intergenic
1194222570 X:91213762-91213784 TGGAAGGGCCAGGTTTTTCTTGG - Intergenic
1194533657 X:95079642-95079664 TGGGAGGACCAGTTTCTTCGTGG - Intergenic
1195151313 X:102072726-102072748 TGGAAGGGCCAAGTTGTTCTTGG - Intergenic
1197662403 X:129188328-129188350 TGGGAGGGCCAGTTTTTTCCTGG - Intergenic
1198847761 X:140931164-140931186 TGGGAGGGCCAGGTTTTTCATGG + Intergenic
1199744590 X:150763994-150764016 TGGGAGGGGCATGGCCTGCTGGG - Intronic
1200124998 X:153809124-153809146 AGGGAGGGCCAGGGTCAGGTTGG + Intronic