ID: 1128014952

View in Genome Browser
Species Human (GRCh38)
Location 15:64335934-64335956
Sequence CTGGGGGTATAGTGACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128014952_1128014953 -10 Left 1128014952 15:64335934-64335956 CCTGTTTGTCACTATACCCCCAG 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1128014953 15:64335947-64335969 ATACCCCCAGTACCTACACTAGG 0: 1
1: 0
2: 0
3: 8
4: 84
1128014952_1128014960 29 Left 1128014952 15:64335934-64335956 CCTGTTTGTCACTATACCCCCAG 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1128014960 15:64335986-64336008 ACAGTTGCTCAATAAATTTATGG 0: 1
1: 0
2: 3
3: 25
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128014952 Original CRISPR CTGGGGGTATAGTGACAAAC AGG (reversed) Intronic
903674982 1:25057872-25057894 CTGGGGGTATCCAGACCAACTGG - Intergenic
903776203 1:25795469-25795491 CTGGGGCTATAGTGGGAGACCGG - Intergenic
903849226 1:26296304-26296326 CTGGGTGCACAGTGACATACAGG + Intronic
904551221 1:31320472-31320494 CTGGGGGCATAGAGAGAATCTGG - Intronic
909562473 1:77022004-77022026 CTGGGGGAAAAAAGACAAACGGG - Intronic
911041808 1:93597261-93597283 ATGTAGGTAAAGTGACAAACAGG + Intronic
917427982 1:174935652-174935674 CTGGGCATATATTGACAATCAGG - Intronic
1066320790 10:34301745-34301767 CTGGGTGGATAGTCACACACCGG - Intronic
1070514111 10:77187745-77187767 CTGGGGCTGTAGTGGCAAGCAGG - Intronic
1071205610 10:83272692-83272714 CTAGGGGTACAGGGACAACCTGG + Intergenic
1076499035 10:130921320-130921342 CTGTGTGGATACTGACAAACTGG - Intergenic
1077713605 11:4559422-4559444 CTGGTGGTATAGGCACAAAAGGG - Intergenic
1077800858 11:5534902-5534924 CTGGTGGAATAGTAACAGACAGG + Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1082925604 11:58543205-58543227 CTAGGGATATAGTGACAAAAAGG - Intronic
1088352179 11:108902167-108902189 CTGGGGGTTGATTGACACACAGG + Intronic
1095445781 12:42280786-42280808 CTGGGGGTAAAGTGGAAAATGGG - Intronic
1100189920 12:92179556-92179578 CTGGAGCTATAGTAACAAAGAGG - Intergenic
1100692288 12:97050934-97050956 TTGGGGGTACAGTGACATAGGGG + Intergenic
1100751079 12:97698669-97698691 CTGGGTATAAAGTGATAAACTGG - Intergenic
1103293876 12:119869683-119869705 CTGGAGAAATAGTTACAAACTGG + Intronic
1106044923 13:26129954-26129976 CTTGGGGTACAGTGAGAAACAGG - Intergenic
1108516036 13:51203731-51203753 CTAGGGGCATAGTGAGAAAGGGG - Intergenic
1109629726 13:65031435-65031457 CTGGGGGAGTAATGACAGACAGG - Intergenic
1110135590 13:72063123-72063145 CTGGTGATACAGGGACAAACAGG + Intergenic
1116375739 14:44198092-44198114 CTGGGGTTATTGAGTCAAACTGG - Intergenic
1117278645 14:54215630-54215652 CTGGGGGAATAGTGAAAACTTGG - Intergenic
1122072259 14:99212509-99212531 CTGGGCCTATGGGGACAAACAGG + Intronic
1122393717 14:101407965-101407987 CTGGGGGTACAGAGAGAAATTGG - Intergenic
1126953592 15:53910240-53910262 CTGGGGGTTAAGTGACAACATGG - Intergenic
1128014952 15:64335934-64335956 CTGGGGGTATAGTGACAAACAGG - Intronic
1128682828 15:69663968-69663990 CAGGGGGTATTGTGTCAAATGGG + Intergenic
1133329353 16:4962361-4962383 CTGTGGGTAGAGTGAAAAAAAGG + Intronic
1134262091 16:12659554-12659576 CTGGGGATAGAGTGGCAAATGGG + Intergenic
1134326044 16:13208815-13208837 CTGGGGATACATTGACAAATGGG - Intronic
1135246141 16:20858683-20858705 CTGGGGGTTAAGTGACAACATGG + Exonic
1136537222 16:30907083-30907105 TTGGGGGTAGAGTGCCAAGCAGG + Intergenic
1138532694 16:57643447-57643469 CTGTGGGAAGAGTGACAAAGGGG - Intronic
1140875111 16:79143730-79143752 ATGGGCGCATAGAGACAAACCGG - Intronic
1141111285 16:81272946-81272968 ATGGGGGTTTAGAGACAGACTGG - Intronic
1142708268 17:1709868-1709890 CTGAGGGTACAGTGACAGGCTGG + Exonic
1146449650 17:32962500-32962522 CTGGGAGTATTGGGACAATCAGG - Intergenic
1147837630 17:43346197-43346219 CTGGGGGTTAAGTGACAACATGG - Intergenic
1147870710 17:43585491-43585513 CTGGGGAAATGTTGACAAACAGG - Intergenic
1148779831 17:50115170-50115192 TGGGGGATATAGAGACAAACAGG - Intronic
1151400998 17:73856006-73856028 CTGGGGATAAAGTGAGAAGCAGG - Intergenic
1152968553 18:139539-139561 CTGGGGTTGTAGTGGGAAACTGG + Intergenic
1155556317 18:27023015-27023037 CTAGGGGTATATTGAAAAATTGG - Intronic
1157335832 18:46736815-46736837 CTGGGGGTTTAATGCCACACTGG - Intronic
1158422317 18:57306176-57306198 CTGGGGGCAGAGAGACCAACAGG - Intergenic
1159940916 18:74407613-74407635 CTGGGGGTATGGGGAGATACTGG - Intergenic
926242709 2:11100824-11100846 CTGGGGGTACAGTAACAGAAAGG + Intergenic
927611203 2:24543003-24543025 CTGAGGATACAATGACAAACAGG + Intronic
928690030 2:33789691-33789713 CTTGGGGTATAGGGAGAAAAGGG - Intergenic
931305485 2:61024372-61024394 CAGGGAGTATAGTGACATATGGG - Intronic
938267179 2:129936421-129936443 CTGTGGGTTTAGTGACAATTTGG - Intergenic
939207843 2:139130730-139130752 CTGGGGATGTTGTAACAAACTGG + Intergenic
945151071 2:206792616-206792638 CTGGGGATATAGTGATGAATAGG + Intergenic
947677061 2:231991897-231991919 CTGGGGATACAGTGATGAACGGG + Intronic
948260047 2:236597192-236597214 CTGGGTGTACAGGGACAATCTGG - Intergenic
948281253 2:236749497-236749519 CTGGTGGTTTGGTGACACACAGG + Intergenic
1168874614 20:1162666-1162688 CAGGGGCTATATTGACAAAAAGG + Intronic
1170473704 20:16693424-16693446 CAGGGTGTATAATGTCAAACAGG - Intergenic
1172037985 20:32023594-32023616 CAGGGGATACAGTGACAAAGAGG - Intronic
1173431167 20:42988162-42988184 CTGGGGACACAGTGATAAACAGG - Intronic
1178287438 21:31337314-31337336 CTGGGGGTATAGAGACTACCAGG + Intronic
1180235432 21:46456691-46456713 CTGGGGCTTCAGTAACAAACTGG - Intergenic
1181902432 22:26167954-26167976 CTGAGCGTATAGCCACAAACAGG + Intergenic
1183377802 22:37475150-37475172 CTGGGGGTACAGGGAGAATCAGG + Intronic
1185352986 22:50347691-50347713 CAGTGGGTACAGTGACAAAGAGG - Intronic
950866479 3:16193712-16193734 CTGCGGGCAGAGTGACAACCAGG - Intronic
956840463 3:73135151-73135173 CTAGGGCTATAGTAACTAACTGG - Intergenic
967435985 3:189446847-189446869 CTAGGGGGATAGGGAGAAACTGG + Intergenic
974302157 4:60082126-60082148 CTGGGGATATCCAGACAAACAGG + Intergenic
974894227 4:67919546-67919568 CTGGGGATAAAGTGATGAACAGG + Intronic
977219725 4:94325063-94325085 CTGGTGATATAATGGCAAACAGG - Intronic
977917852 4:102613697-102613719 CAGGGGGTAGAGAGACACACAGG - Intronic
983779547 4:171651048-171651070 CTAGGGGAACAGTGCCAAACTGG - Intergenic
987565729 5:19583585-19583607 CTGGAGGTATAATTAAAAACTGG + Intronic
989357042 5:40555333-40555355 ATGGGGGTATAAAGACAATCTGG - Intergenic
993335250 5:86649692-86649714 ATAGGAGTATAGTGTCAAACAGG + Intergenic
993756690 5:91739772-91739794 CTGGGTGTATTGTGAGAACCAGG + Intergenic
996532839 5:124544309-124544331 CTGGGAGTACAGTGCCAATCTGG + Intergenic
997828051 5:137125150-137125172 CTGGGGGTACAGGGCCAAGCTGG - Intronic
999745053 5:154585529-154585551 CTGGGGGTATGGTGATGAGCAGG - Intergenic
1001295415 5:170495559-170495581 CTGGGGTTTCAGTGCCAAACAGG + Intronic
1001933444 5:175688707-175688729 CTGGGGTGATAGTCAAAAACAGG - Intergenic
1002390441 5:178907473-178907495 CTGGGGGTTAAGTGACAACATGG + Intronic
1003143966 6:3494163-3494185 CTGGGAGGATTGTGACAAACAGG + Intergenic
1005011842 6:21343137-21343159 CTGGGAGTAAAGTGACAACCAGG - Intergenic
1006798747 6:36746335-36746357 CTGGGGGTGAGGTGACAAGCTGG - Intronic
1007368061 6:41408332-41408354 CTAGGGGTAGAAGGACAAACTGG + Intergenic
1011186738 6:84685210-84685232 CTGGGAATACAGTGATAAACAGG - Intergenic
1014970474 6:127808687-127808709 GTGGGGGTATGGTTACCAACAGG - Intronic
1016480131 6:144471705-144471727 CTGTGGGAATAGTGTCAGACAGG + Intronic
1017554461 6:155547923-155547945 GTGGGGGAATAGTGAGGAACAGG - Intergenic
1017564060 6:155665346-155665368 TTTGAGGAATAGTGACAAACTGG - Intergenic
1018088943 6:160329186-160329208 CTGGGGGAAAGGGGACAAACTGG + Intergenic
1019178407 6:170172721-170172743 CAGGGAGTTTACTGACAAACTGG + Intergenic
1021580510 7:22148047-22148069 CTGGGGATACAGAGACAAAGTGG - Intronic
1022600236 7:31750996-31751018 CTGGGTGTATAGGGAGAAAAAGG + Intergenic
1022642323 7:32199742-32199764 CCTGTGGTATAATGACAAACTGG - Intronic
1031130659 7:117829615-117829637 ATGGGGAGATAGTGAGAAACAGG - Intronic
1031544842 7:123038190-123038212 CTGGGGTCATATTGACAAACTGG - Intergenic
1034916210 7:155041864-155041886 CTGGGGGTATAGTGACTGGGAGG + Intergenic
1037052339 8:14391676-14391698 TTAGGGATATAGTGACGAACGGG + Intronic
1040330341 8:46382660-46382682 CTGGGGCTTTACTGACCAACCGG - Intergenic
1040936804 8:52789986-52790008 CAAGGAGTATAGTGAAAAACAGG - Intergenic
1040950552 8:52934864-52934886 CTGGGGCTAGAGTCACACACTGG + Intergenic
1044747885 8:95388859-95388881 CTGGGGACATAGTGGCAAACAGG + Intergenic
1045031260 8:98138662-98138684 CTGGGGAGAGAGTGAAAAACAGG - Intronic
1047289965 8:123521200-123521222 CTGGGGGTAGAGTGGGAAACAGG - Intronic
1048317744 8:133374797-133374819 TTGGGGGTATAGCTGCAAACGGG + Intergenic
1055232053 9:74077896-74077918 GTGGTGGTATAGTGACACAAGGG - Intergenic
1057884980 9:98823183-98823205 CTGGGGATGGAGTGACAAAGGGG - Intronic
1059636488 9:116176316-116176338 TTGGGGGAATAGTGAAAAATAGG + Intronic
1060759588 9:126236029-126236051 CTGGCGGTACAGAGACAAACGGG + Intergenic
1190334194 X:49252677-49252699 TTGGGGGTGTATTGACATACTGG + Intronic
1194928818 X:99862201-99862223 ATGGGGGTAGAGTACCAAACAGG + Intergenic
1196666669 X:118324535-118324557 CTGAGGATACAGTGGCAAACAGG - Intergenic