ID: 1128019981

View in Genome Browser
Species Human (GRCh38)
Location 15:64381644-64381666
Sequence GGGCGGTACCAGGACTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128019968_1128019981 23 Left 1128019968 15:64381598-64381620 CCGTCCATCAACACGCAAAGGCC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1128019981 15:64381644-64381666 GGGCGGTACCAGGACTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1128019972_1128019981 2 Left 1128019972 15:64381619-64381641 CCTAGGATTCGTAGGCGCCCCAG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1128019981 15:64381644-64381666 GGGCGGTACCAGGACTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1128019969_1128019981 19 Left 1128019969 15:64381602-64381624 CCATCAACACGCAAAGGCCTAGG 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1128019981 15:64381644-64381666 GGGCGGTACCAGGACTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128019981 Original CRISPR GGGCGGTACCAGGACTCTCC AGG Intronic
900033690 1:389538-389560 GAGAGGTCCCAGGACTTTCCTGG + Intergenic
900054524 1:619428-619450 GAGAGGTCCCAGGACTTTCCTGG + Intergenic
900646977 1:3713404-3713426 GGGCCGTCCCAGGCTTCTCCTGG + Intronic
903440973 1:23387589-23387611 GGGCGGCAGGAGGACTCTGCGGG - Intronic
904000111 1:27334067-27334089 GGGCGGCACCGGCACTCCCCAGG + Intronic
912481564 1:109985309-109985331 GTGCGGCCCCAGGCCTCTCCCGG + Intronic
922256047 1:223893693-223893715 GAGAGGTCCCAGGACTTTCCTGG + Intergenic
923111605 1:230894965-230894987 TGGAGGTACAAGGATTCTCCAGG - Intergenic
1062829307 10:594787-594809 GGGCGGAATCTCGACTCTCCGGG + Intronic
1069570802 10:69493208-69493230 GGGCAGAACAAGGACTCTCTTGG - Intronic
1069725517 10:70575405-70575427 GGGAGCTTCCAGGACTCCCCGGG - Intergenic
1071417130 10:85451802-85451824 TGGCTGAACCAGGACTCCCCTGG - Intergenic
1074065220 10:110007738-110007760 GGGCGGGACCAGGACTCCCGAGG + Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083992829 11:66257593-66257615 GGGCGGTGCGAGGACCCGCCCGG - Intronic
1084731035 11:71073808-71073830 TGGGGGTACCAGAACTATCCTGG + Intronic
1085399476 11:76227123-76227145 GGGCGGTCAAAGGCCTCTCCCGG + Intergenic
1090897583 11:130992047-130992069 GGGAGGTGCCATGACTCTCAGGG + Intergenic
1095133572 12:38571601-38571623 GGGCGATGCCAGCACTCTCTTGG - Intergenic
1101399110 12:104372947-104372969 GGGCAGTACCAAGACTTCCCTGG + Intergenic
1103400473 12:120640360-120640382 GGGCGGTTCCGGGGCTCTGCAGG + Intergenic
1103523037 12:121549050-121549072 GGGGGGCCCAAGGACTCTCCGGG - Intronic
1110916811 13:81031000-81031022 GGGTGGTACAAGCACTCCCCTGG + Intergenic
1121653878 14:95580868-95580890 TGGAGGAACCAGGACGCTCCTGG + Intergenic
1122878252 14:104678632-104678654 TGGGGGTGCCGGGACTCTCCTGG - Intergenic
1122906263 14:104802961-104802983 GGGAGGGAACAGGACACTCCTGG + Exonic
1123117396 14:105900859-105900881 GGGTGGGCCCAGGACTCTCTGGG + Intergenic
1128019981 15:64381644-64381666 GGGCGGTACCAGGACTCTCCAGG + Intronic
1129540972 15:76346762-76346784 GGGAGGCACCGGGACGCTCCCGG + Intergenic
1131827936 15:96334755-96334777 GGGCACTACCAGGCCTGTCCTGG + Intronic
1142406734 16:89894284-89894306 GGGCTGTACGGGGACTGTCCAGG - Intronic
1145271099 17:21405382-21405404 GGGGGCTGCCAGGCCTCTCCAGG + Intronic
1145309300 17:21692769-21692791 GGGGGCTGCCAGGCCTCTCCAGG + Intronic
1145999239 17:29121503-29121525 GGGTGGGACCAGGAGTCTGCAGG + Intronic
1150940630 17:69689449-69689471 AGGCGGTAAAAGGAATCTCCGGG + Intergenic
1152240719 17:79159500-79159522 GGGGTGTTCCAGGAGTCTCCAGG - Intronic
1153981061 18:10310904-10310926 CGGCTGTACCAGGCCTCACCAGG + Intergenic
1154500178 18:14992134-14992156 GGGAGGTAGCAGGACTCTTGAGG + Intergenic
1161042071 19:2115594-2115616 CAGCGGTACCAGGACACCCCGGG - Exonic
1161091218 19:2360973-2360995 CGGCGGTCCCAGGCCCCTCCAGG - Intergenic
1161269725 19:3383146-3383168 AAGCGGTGCCAGGACTCTCTTGG - Intronic
1162171011 19:8788950-8788972 GGGCTGCAGCAGGGCTCTCCTGG - Intergenic
1163415433 19:17183591-17183613 TGGCGGCACCCGGACTCTGCTGG - Intronic
934949087 2:98564184-98564206 GGGATGAAACAGGACTCTCCAGG - Intronic
937119071 2:119429644-119429666 GAGAGGTACCAGGAGACTCCAGG + Intergenic
937330082 2:121021228-121021250 GGCTGGTACCAAGACTCTCAGGG - Intergenic
948183657 2:236002275-236002297 GGACGGGACCAGGAGCCTCCTGG - Intronic
1171143634 20:22763740-22763762 GGGCGGTTCCAGGAAATTCCAGG + Intergenic
1175967103 20:62665266-62665288 GGGCAGGACCACCACTCTCCCGG - Intronic
1179015653 21:37592707-37592729 GGTCGGGACCAGGACTCTCAGGG - Intergenic
1179015659 21:37592728-37592750 GGGCGGGAGCAGGGCTCACCAGG - Intergenic
1179600478 21:42474341-42474363 GGGCAGGACCAGGAAACTCCGGG - Intronic
1181405394 22:22680891-22680913 GGCAGGTGCCAGGCCTCTCCCGG - Intergenic
1185005989 22:48277283-48277305 GGGCCCTCCCAGGACTATCCAGG + Intergenic
966943512 3:184761609-184761631 GGGGTGTGCCAGAACTCTCCTGG + Intergenic
968601775 4:1513051-1513073 GGGCGGTGCTGGGACCCTCCTGG - Intergenic
968601783 4:1513072-1513094 GGGCGGTGCTGGGACCCTCCTGG - Intergenic
968601791 4:1513093-1513115 GGGCGGTGCTGGGACCCTCCTGG - Intergenic
977848144 4:101790816-101790838 GAGCGCTACCTGGACTCTCCCGG - Exonic
979239879 4:118438747-118438769 GAGAGGTCCCAGGACTTTCCTGG - Intergenic
985789176 5:1916148-1916170 GGGCTGGGCCAGGGCTCTCCAGG + Intergenic
991594463 5:68288554-68288576 GGGCGCCGCCAGGACCCTCCGGG - Intronic
1002556777 5:180047951-180047973 GCGTGGGCCCAGGACTCTCCAGG + Intronic
1002740130 5:181429330-181429352 GAGAGGTCCCAGGACTTTCCTGG - Intergenic
1003015197 6:2462446-2462468 GGGCTGGACCAGGACTCTTCAGG - Intergenic
1005174369 6:23027210-23027232 GGGAGGATCCAGGGCTCTCCTGG - Intergenic
1009558258 6:65203053-65203075 GGGCAGTGCCTGGACTCTCAGGG - Intronic
1017324698 6:153131409-153131431 GGGCGGGGCCGGGACTCTCGCGG - Intergenic
1019198589 6:170296452-170296474 GGGCGGCGCCAGGGCCCTCCCGG + Intronic
1019305770 7:333687-333709 GGGCGGGACAAGGACATTCCTGG - Intergenic
1029712522 7:102307417-102307439 GGGTGGGACCAGGCCTCCCCGGG - Intronic
1030899323 7:115103053-115103075 GGGCAAAACCAGGACTGTCCTGG + Intergenic
1031280851 7:119797626-119797648 GGGTGGTACCAGCACTCCCTTGG + Intergenic
1036646170 8:10612428-10612450 GGGCGGCCCCAGGGCTGTCCAGG - Exonic
1040744211 8:50620192-50620214 GGGCCATTCCAAGACTCTCCAGG + Intronic
1048324222 8:133426656-133426678 GGGAGCTACCAGGATACTCCAGG - Intergenic
1056899088 9:90582333-90582355 GGGCGGATCCAGGAGGCTCCTGG + Intergenic
1058060446 9:100489988-100490010 TGCCTGTATCAGGACTCTCCAGG - Intronic
1061522197 9:131125418-131125440 GAGCGGCACCAGGACCATCCAGG + Intergenic
1062113915 9:134797347-134797369 ATGGGGTACCAGGCCTCTCCCGG + Intronic
1062597976 9:137307589-137307611 GGGCGGTCCCGGGGCTCACCTGG + Exonic
1203605439 Un_KI270748v1:54138-54160 GAGAGGTCCCAGGACTTTCCTGG - Intergenic
1185458648 X:323334-323356 GCGCGGGACGAGGCCTCTCCCGG + Intergenic
1190862713 X:54358985-54359007 GGGCGGGACCAGGTCTCTGAAGG - Intergenic