ID: 1128021073

View in Genome Browser
Species Human (GRCh38)
Location 15:64390920-64390942
Sequence CGGGCACTGACCTCCTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 1, 2: 0, 3: 38, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128021073_1128021077 21 Left 1128021073 15:64390920-64390942 CCTGGGAAGGAGGTCAGTGCCCG 0: 1
1: 1
2: 0
3: 38
4: 206
Right 1128021077 15:64390964-64390986 TACTATTTGAAGCATTTGTTAGG 0: 1
1: 0
2: 1
3: 17
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128021073 Original CRISPR CGGGCACTGACCTCCTTCCC AGG (reversed) Intronic
900120572 1:1047025-1047047 CCGGCACTGACCTGCTGCCCAGG - Intronic
900240594 1:1615641-1615663 CGGGCGCGGATCTCCTCCCCTGG + Intronic
900646179 1:3709726-3709748 AGGACACTGACCTCCTGCCCTGG + Intronic
901317059 1:8316580-8316602 CCAGCCCTCACCTCCTTCCCAGG + Intergenic
901772581 1:11537833-11537855 TGGGCACTGAGCTCTTTCCCTGG + Intergenic
902230325 1:15023478-15023500 CATGCACTGGCCTCCTTCCTCGG - Intronic
903355699 1:22746100-22746122 GCTGCACTCACCTCCTTCCCTGG - Intronic
904405840 1:30287397-30287419 AGAGCCCTGGCCTCCTTCCCGGG - Intergenic
904867866 1:33596198-33596220 TGGGCTCTGACTTCCTTTCCTGG + Intronic
905446434 1:38030946-38030968 CCAGCTCTGGCCTCCTTCCCTGG + Intergenic
905732360 1:40305704-40305726 GGGGCATTTACCTCTTTCCCAGG + Exonic
906719738 1:47996700-47996722 CCGGCACTGTCCTCCGTCCGGGG + Exonic
907388663 1:54142071-54142093 AGGGCCCTGACCACATTCCCTGG - Intronic
913381505 1:118216184-118216206 CAGGCACTCACCTTATTCCCAGG + Intergenic
914854834 1:151343323-151343345 GGGCCACTGACTTCCTTACCTGG + Exonic
915011212 1:152687801-152687823 CAGTCACTGAACTCCTTCTCAGG + Intergenic
915581144 1:156814102-156814124 CGGGCTCTTAGCTCATTCCCCGG - Intronic
915660397 1:157400571-157400593 CTGACACTCACCTGCTTCCCTGG - Intergenic
916558163 1:165910734-165910756 CTGTCTCTGCCCTCCTTCCCTGG - Intronic
918080808 1:181206524-181206546 CAGGCACTGACCTCCTTTTCGGG - Intergenic
918092199 1:181307288-181307310 CCGACTCTGTCCTCCTTCCCTGG + Intergenic
919801039 1:201354850-201354872 CGGGCACTCACTTGCTTCTCTGG - Intergenic
920072201 1:203310373-203310395 CGGGTAATGAACTCCTTCCCAGG + Intergenic
920479941 1:206312093-206312115 CGGGCACTCATCACCTCCCCCGG + Intronic
920573273 1:207034323-207034345 CGGGCTATGACCTCTTTCCCTGG + Intronic
923716170 1:236426406-236426428 TGGGCAGTGTCCTCCTCCCCTGG - Intronic
1062979807 10:1712648-1712670 CGCCCAGTGCCCTCCTTCCCTGG - Intronic
1063094864 10:2900362-2900384 CGTGCCCTGTCCTCCCTCCCAGG + Intergenic
1063448344 10:6134368-6134390 TGGGCACTGTCCTGCTCCCCTGG + Intergenic
1063672643 10:8111850-8111872 CAGGCACTGACCTCCTCTTCAGG + Intergenic
1063969008 10:11368233-11368255 AGGGCCCTGGCCTCTTTCCCTGG + Intergenic
1066335160 10:34469323-34469345 CGGGCCTTGACCTCCTGGCCAGG + Intronic
1067116032 10:43436469-43436491 TGGCCACAGGCCTCCTTCCCAGG - Intergenic
1067693537 10:48519698-48519720 CGGGCACAGGCCACCTGCCCAGG + Intronic
1072736966 10:97885702-97885724 TGGGCACAGCTCTCCTTCCCAGG - Intronic
1073061869 10:100738119-100738141 GGGGCCCTGAGCTCCCTCCCTGG + Intronic
1076859290 10:133132999-133133021 AGGGCCCTGAGCTCCTTCCAGGG - Intergenic
1077164517 11:1129103-1129125 AGGGCTCGGCCCTCCTTCCCTGG - Intergenic
1077860350 11:6172523-6172545 TGGGCAGTAACCTCCTTTCCAGG - Intergenic
1081473009 11:43394231-43394253 CTGGCACTGGCCTACTTCTCTGG - Intronic
1081780984 11:45712592-45712614 TGGGGACTGGCCTACTTCCCGGG - Intergenic
1082786507 11:57320274-57320296 CTGGCAAGGACCTCCTTCCGAGG + Exonic
1082804626 11:57439893-57439915 CTTGCACTGAGCTCCCTCCCAGG + Intergenic
1083628068 11:64082146-64082168 CTGGCTCTGGCCTCCCTCCCGGG - Intronic
1083679039 11:64342901-64342923 CGGGAACAGCCCTCCTTCCAAGG - Intronic
1083795564 11:65014599-65014621 CCGGCTCTGATCTCCTCCCCCGG + Intronic
1083969820 11:66068126-66068148 CAGGCCCTGATCTCCTTTCCAGG + Exonic
1084751678 11:71208273-71208295 CTGGGGCTGCCCTCCTTCCCAGG - Intronic
1085212814 11:74796993-74797015 CAGGCACGTACCACCTTCCCTGG + Intronic
1087855934 11:103091906-103091928 CGGACAGGGACCCCCTTCCCCGG - Exonic
1088907495 11:114165664-114165686 CTGGCACTGACCCCTTTCCTGGG - Intronic
1089554714 11:119310060-119310082 CGGGGGCCGCCCTCCTTCCCTGG - Intronic
1090732033 11:129580467-129580489 CCCTCACTGGCCTCCTTCCCCGG - Intergenic
1091272836 11:134330072-134330094 CAGGCACCCACCACCTTCCCCGG - Intergenic
1093704782 12:22262458-22262480 CCGGCACTGACCTCCACCACTGG + Intronic
1097052698 12:56232805-56232827 CGGGCCTGGACCTCCTTCACAGG + Exonic
1105704666 13:22961569-22961591 CGAACACTGACCTCCAACCCAGG - Intergenic
1105857621 13:24386617-24386639 CGAACACTGACCTCCAACCCAGG - Intergenic
1110939303 13:81329435-81329457 CTGGCACTGACGTCTTTTCCGGG + Intergenic
1112034539 13:95485080-95485102 GGGGCAGTGTCGTCCTTCCCTGG - Intronic
1113364324 13:109661985-109662007 CAGGCACTGGCCTGCATCCCAGG - Intergenic
1113371591 13:109730145-109730167 CAGGCACGGACCACCTTGCCCGG - Intergenic
1113625176 13:111789650-111789672 CGGGCACTGCCACCCTCCCCTGG + Intergenic
1113994432 14:16054759-16054781 AGGGCACTGACCCCCTTCACGGG + Intergenic
1116887009 14:50231538-50231560 CGGGCGGCGACCTCCTTTCCCGG + Exonic
1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG + Intronic
1118478679 14:66142221-66142243 CGGGCACTGACTTTGTTCTCTGG - Intergenic
1119159526 14:72441539-72441561 CAGGCACTGAGCGCCATCCCAGG + Intronic
1119412397 14:74441341-74441363 CGGACACTGAGCTCCTGCCCTGG + Intergenic
1120514354 14:85452702-85452724 ATGGCACTGACCTACTGCCCGGG + Intergenic
1122345172 14:101054104-101054126 CTGGCACAGTCCCCCTTCCCTGG - Intergenic
1123768145 15:23501977-23501999 TGGTCACTTAGCTCCTTCCCAGG + Intergenic
1125591682 15:40858087-40858109 CAGGCTCTGAGCTCCTTCCCAGG + Exonic
1126065777 15:44825212-44825234 CAGACACTGAGCTCCTTCTCTGG + Intergenic
1126498650 15:49320476-49320498 GGGTCACTGAGCTCCTTCCTGGG - Intronic
1128021073 15:64390920-64390942 CGGGCACTGACCTCCTTCCCAGG - Intronic
1128537857 15:68504160-68504182 CGGCCACTGACTTACTGCCCCGG + Intergenic
1129210664 15:74066074-74066096 AGGGCACTGACTTCCACCCCAGG - Intergenic
1129403347 15:75299255-75299277 AGGGCACTGACTTCCACCCCAGG + Intergenic
1130460390 15:84155402-84155424 CGGGCCGTGACCTCCACCCCAGG - Intergenic
1132516914 16:370273-370295 CCGGCACTCACCCCCTACCCCGG + Intronic
1132691296 16:1183017-1183039 GGGGCCCAGACCTCCTTCACAGG - Intronic
1132698054 16:1210665-1210687 CGGGGACTGCCCTTGTTCCCAGG + Intronic
1133017586 16:2951417-2951439 TGGGCACTGACCGCCCTCCCAGG + Intergenic
1133326657 16:4946016-4946038 GGGGCCCTGACCTCCTGACCTGG - Intronic
1134055238 16:11165910-11165932 AGGGCACTGTCCTCCTGCCCGGG + Intronic
1140964535 16:79952166-79952188 AGTGCACTAAACTCCTTCCCTGG + Intergenic
1141447887 16:84074375-84074397 CGGGCACACACCACCATCCCTGG + Intronic
1141651252 16:85394220-85394242 CGGGCCTTGACCTCGCTCCCCGG - Intergenic
1143082911 17:4394704-4394726 AGGGCAATGACCTCCTGGCCTGG - Intergenic
1143542328 17:7576870-7576892 CTGGCAGTGTCCTACTTCCCAGG + Intronic
1144483670 17:15647551-15647573 CCTGCACTGACCTCGCTCCCAGG + Intronic
1144686037 17:17227019-17227041 CTGGCGGTGCCCTCCTTCCCAGG + Intronic
1144711816 17:17406224-17406246 GGGGCCCTGGCCTCCTTCACAGG + Intergenic
1144891454 17:18496543-18496565 CCGCCACTGAGCTCCTTCCTTGG + Intergenic
1144915016 17:18717473-18717495 CCTGCACTGACCTCGCTCCCAGG - Intronic
1145140767 17:20447774-20447796 CCGCCACTGAGCTCCTTCCTTGG - Intergenic
1146943322 17:36858711-36858733 ATGCCACTGACCTCCTCCCCAGG - Intergenic
1148326403 17:46785788-46785810 CGGGCCCTGTGCTCCATCCCAGG + Intronic
1150225748 17:63523576-63523598 CCGGCACTCACCACCTTGCCCGG - Intronic
1151688208 17:75662305-75662327 CTGGCATTGTCCTCCTTACCAGG - Intronic
1151813968 17:76461984-76462006 GGGGCACTAACCTCTGTCCCTGG - Intronic
1152271865 17:79329559-79329581 CGTGCCCTCTCCTCCTTCCCTGG + Intronic
1155597478 18:27503897-27503919 CAGGCACTGACCACCATGCCTGG - Intergenic
1157682726 18:49619563-49619585 CTGGCACTGGCCTGCTTCACAGG - Intergenic
1160557624 18:79736313-79736335 CAGCGACAGACCTCCTTCCCGGG - Intronic
1161188255 19:2937652-2937674 CCTGCACTGTCCTCCTTCGCAGG - Intronic
1161320346 19:3638082-3638104 CGTGCCCAGCCCTCCTTCCCAGG + Intronic
1161400684 19:4065419-4065441 GGGGCTCCTACCTCCTTCCCGGG + Intronic
1161951462 19:7470195-7470217 GGGGCACAGCCCTCCTGCCCGGG + Exonic
1163497660 19:17656000-17656022 GGGGCCTTGTCCTCCTTCCCTGG + Exonic
1164922885 19:32102879-32102901 GGGGCACTGACAGTCTTCCCAGG - Intergenic
1167168744 19:47817194-47817216 TGGGCACCTCCCTCCTTCCCAGG - Intronic
1167469997 19:49670335-49670357 CGGGCCCCCGCCTCCTTCCCCGG + Exonic
1167557157 19:50203660-50203682 CGGGCACTCACCGGCTTCCAGGG - Exonic
924991531 2:316734-316756 TGGGCACTGACCTGCTGCCATGG - Intergenic
925875698 2:8309452-8309474 CAGGCACAGACATCCTGCCCTGG - Intergenic
930612195 2:53555345-53555367 TGTCCACAGACCTCCTTCCCAGG + Intronic
934843321 2:97645494-97645516 CCGGCCCTGTCCTCCTCCCCAGG + Intergenic
935148045 2:100409606-100409628 CAGTCCCTGACCTCCTGCCCGGG - Intronic
936495632 2:113018307-113018329 GAGGAACTGACTTCCTTCCCAGG - Intergenic
937087169 2:119179085-119179107 CGGGTCCTGACACCCTTCCCCGG - Intergenic
938244388 2:129765766-129765788 CGGCCACTGACATCGTTTCCTGG - Intergenic
938463563 2:131512768-131512790 TGGACACTGTCCTCCCTCCCTGG - Intergenic
938537039 2:132255992-132256014 AGGGCACTGACCCCCTTCACAGG - Intronic
941159372 2:162018692-162018714 CGGCGACTGCCCTCCCTCCCAGG + Intronic
947546301 2:231012686-231012708 CGGGGACTCACCTAGTTCCCTGG - Exonic
948204985 2:236158935-236158957 CTGGCACTGACTTCTTTCCAGGG - Intergenic
948206440 2:236164934-236164956 CGGGCACCCACCTCCTCCTCTGG + Intergenic
948396461 2:237648739-237648761 CAGGCTCTGACCTCCTTCCTGGG - Intronic
948899482 2:240949153-240949175 TGGGCACTGAGCTCCATTCCAGG - Intronic
949019498 2:241733449-241733471 AGGCCACTCACCTTCTTCCCAGG - Intergenic
1170831200 20:19842364-19842386 CAGGCACTCACCACCATCCCTGG + Intergenic
1171457131 20:25278475-25278497 CTGGCACTGAGATCCCTCCCAGG - Intronic
1171767818 20:29299954-29299976 AGGGCGCTGACCCCCTTCGCGGG - Intergenic
1171865951 20:30487771-30487793 AGGGCACTGACCCCCTTCACGGG - Intergenic
1172272130 20:33660577-33660599 CCGGGACTGGCCTCCCTCCCCGG + Intronic
1174295189 20:49540570-49540592 CAGGCCCTGACCTCCTTCTCGGG - Intronic
1175415467 20:58797743-58797765 TCTGCACTGAGCTCCTTCCCTGG - Intergenic
1176083955 20:63287457-63287479 TGGACAGTGACCGCCTTCCCAGG - Intronic
1176183530 20:63765393-63765415 CCTGCACTGGCCCCCTTCCCGGG + Intronic
1176548031 21:8209812-8209834 CGGGCGCTGACCCCCTTCGCGGG + Intergenic
1176555924 21:8254022-8254044 CGGGCGCTGACCCCCTTCGCGGG + Intergenic
1176566962 21:8392847-8392869 CGGGCGCTGACCCCCTTCGCGGG + Intergenic
1176574861 21:8437057-8437079 CGGGCGCTGACCCCCTTCGCGGG + Intergenic
1176611476 21:8988353-8988375 CGGGCGCTGACCCCCTTCGCGGG + Intergenic
1179218975 21:39389767-39389789 TGGGCACTGACATTCTGCCCTGG + Intronic
1179885474 21:44312472-44312494 TGAGCACTGACCTCCATCTCTGG - Intronic
1179984292 21:44912450-44912472 TTGGCAGTGACCTCATTCCCTGG + Intronic
1180001403 21:44997067-44997089 AGGGCACCCACCTTCTTCCCAGG - Intergenic
1180181703 21:46121112-46121134 CTGACACTGACCTGCTTTCCGGG - Exonic
1180312660 22:11252645-11252667 AGGGCACTGACCCCCTTCACGGG - Intergenic
1180339334 22:11605735-11605757 CGGGCGGAGACCTCCATCCCGGG - Intergenic
1181543530 22:23587515-23587537 CGGGGCCTGACTGCCTTCCCTGG + Intergenic
1183207981 22:36432610-36432632 CAGGCTCTCAGCTCCTTCCCGGG - Intergenic
1183830236 22:40414983-40415005 CAGGCAGCGACCTCCTTGCCTGG - Intronic
1184767296 22:46578295-46578317 CTGACCCTGACCTCCCTCCCAGG - Intronic
1203252910 22_KI270733v1_random:126112-126134 CGGGCGCTGACCCCCTTCGCGGG + Intergenic
1203260965 22_KI270733v1_random:171193-171215 CGGGCGCTGACCCCCTTCGCGGG + Intergenic
950453868 3:13080824-13080846 CAGGCCCTGCCCTCCTCCCCGGG + Intergenic
952154348 3:30626757-30626779 AAGGCACTGAACTCCTTCCAGGG + Intronic
953855577 3:46497199-46497221 CAGGCACTGACCTATGTCCCTGG - Intergenic
954710887 3:52504580-52504602 CTGGCCCTCACCTCCTCCCCTGG + Intronic
955285831 3:57640448-57640470 CAGGCACCCACCTCCTTGCCCGG - Intronic
956086928 3:65621503-65621525 TGGGCTCTGTCTTCCTTCCCAGG - Intronic
956688316 3:71853190-71853212 CGGGGACTTACCTGCTTCCCAGG + Intergenic
957345989 3:78962473-78962495 CGGGGTCTGCCATCCTTCCCTGG + Intronic
959991910 3:112639662-112639684 CGGGCACACTCCTCCTTCTCTGG + Exonic
961535623 3:127568845-127568867 CGGGCACAGCCCTCTCTCCCAGG + Intergenic
961766878 3:129218346-129218368 CTGGCACTGACGCCCTCCCCAGG - Intergenic
962023811 3:131526991-131527013 CGGGCCCCCGCCTCCTTCCCAGG + Intergenic
965517305 3:169635099-169635121 TGTGCTCTGACCCCCTTCCCCGG - Intronic
970168481 4:13264724-13264746 CATGATCTGACCTCCTTCCCAGG - Intergenic
973879079 4:55250562-55250584 TGGGTACTGTCCTCCTTACCTGG + Intergenic
977990750 4:103438445-103438467 CAGGCTCTGATCTCCCTCCCTGG - Intergenic
984564159 4:181307617-181307639 CAGGCACGCACCGCCTTCCCTGG - Intergenic
984701343 4:182820628-182820650 CTGAGACTGACCTCCCTCCCAGG + Intergenic
985793646 5:1946312-1946334 CGGGTCCAGACCACCTTCCCAGG + Intergenic
986280155 5:6315950-6315972 CTGGCCCTGACTCCCTTCCCTGG - Intergenic
990582009 5:57174244-57174266 CGGGCACTCCCCTCCTCCCCCGG - Intronic
990814552 5:59768584-59768606 CAGGCTCAGACCTGCTTCCCTGG - Intronic
991188219 5:63836104-63836126 CCTGCACTGTCCTCCTTCCCAGG + Intergenic
995981645 5:118111735-118111757 CTGGCACTGACCTCCTTCCCTGG - Intergenic
997337464 5:133118355-133118377 TGGGAACAAACCTCCTTCCCAGG - Intergenic
999244217 5:150144749-150144771 CCCTCACTGACCTCCTTCTCAGG - Intronic
999271259 5:150297584-150297606 CAGACACTGGCCACCTTCCCGGG - Exonic
1001105721 5:168852450-168852472 TGGGCACTGACCTCCTATCCAGG - Intronic
1008012161 6:46479723-46479745 CAGGCACTCACCTCCATGCCTGG + Intronic
1017453711 6:154578460-154578482 CTGGGGCTGACCTCCTTCTCTGG - Intergenic
1018838275 6:167501205-167501227 CGGCCACAGCCCTCCTGCCCTGG + Intergenic
1018896122 6:168018782-168018804 CAGGCACTGACGTCCTTCCGAGG - Intronic
1019481862 7:1270591-1270613 CCTGCACTGACGGCCTTCCCAGG - Intergenic
1019552492 7:1610149-1610171 CTGGCACTGTCTGCCTTCCCCGG + Intergenic
1020447802 7:8287062-8287084 CCTGCACTGACCTCCTGCTCAGG - Intergenic
1022413785 7:30160800-30160822 CGGGGCCTCACCTCCCTCCCTGG - Exonic
1023612138 7:41981830-41981852 CAGGCACTGCCCTCCTCCGCTGG - Intronic
1024265196 7:47601011-47601033 CGGGCACTGAGTTCTTTCTCCGG + Intergenic
1025757693 7:64360359-64360381 AGGGCACTGACTTCTTTCCCAGG - Intergenic
1026057432 7:66996753-66996775 CGGGCACTGGCTTCCTTTCCCGG + Intronic
1026720676 7:72828279-72828301 CGGGCACTGGCTTCCTTTCCCGG - Intergenic
1026807704 7:73438185-73438207 AGGGCCCTGCCCTCCCTCCCAGG - Intergenic
1028446830 7:90934112-90934134 TGGGCACTGACCGCCTTTCCAGG - Intronic
1031553438 7:123143035-123143057 AGGGCACTGGCCCCCTTTCCAGG - Intronic
1034466486 7:151232803-151232825 GGGGCACAGACCTCGTTCTCAGG - Exonic
1034501297 7:151452532-151452554 CAGGCGCTGACCTCCTGCCTGGG - Intergenic
1034898859 7:154895159-154895181 GGGGCACTGGCCTCCTTCTGGGG - Intergenic
1035005231 7:155652704-155652726 AGGTCAATGACCTCCTTACCTGG - Intronic
1035205801 7:157293102-157293124 CCGGCCCTGCCTTCCTTCCCAGG + Intergenic
1035601293 8:898388-898410 CGGCCAATGACCGCCTTCCAGGG - Intergenic
1035629147 8:1095109-1095131 CTGGCATGGACCACCTTCCCAGG + Intergenic
1036651571 8:10647242-10647264 CGCCCTCTGACCTCCTTCCCAGG + Intronic
1037829804 8:22180648-22180670 CTGGCATTCACCGCCTTCCCTGG + Intronic
1037967226 8:23144577-23144599 CGGGCATTGTCCTCCGCCCCAGG + Exonic
1038423613 8:27450904-27450926 AGGGCACCGACATCCTTCCTGGG - Intronic
1038435927 8:27535956-27535978 CAGACACTGAGCTCCTTCTCTGG - Intronic
1039845379 8:41321896-41321918 GGGGCACTGGGCTACTTCCCAGG + Intergenic
1040469933 8:47728655-47728677 CAGGCCCTGACCTCCCTTCCTGG + Intronic
1040567508 8:48581251-48581273 TGGGCACTGGACTCCTCCCCCGG - Intergenic
1041774340 8:61507931-61507953 TGGGCACTGCTCTCCATCCCTGG + Intronic
1042237366 8:66626352-66626374 TGGGCACTATCCTCCATCCCTGG + Intergenic
1044895235 8:96884712-96884734 TTGGAACTGAACTCCTTCCCTGG - Intronic
1050374582 9:4957831-4957853 CAGTCACTGCCCTACTTCCCTGG - Intergenic
1050493357 9:6213422-6213444 CTGGCAGTGACCTCCTACCTTGG - Intergenic
1050663979 9:7914215-7914237 GGGGCAATGACCCACTTCCCAGG + Intergenic
1059530957 9:115035270-115035292 CGGAAACTGCCCTCCTTACCTGG - Exonic
1059883176 9:118714973-118714995 CAGGCATTGACCTTCTTCCTTGG + Intergenic
1061275913 9:129569245-129569267 CGGGCCCTGCCCTCCCTCCCTGG - Intergenic
1062343838 9:136105669-136105691 CGGGAGCCGACCTCCTCCCCAGG - Intergenic
1062350560 9:136136688-136136710 AGGACACCGGCCTCCTTCCCCGG - Intergenic
1203469312 Un_GL000220v1:109259-109281 CGGGCGCTGACCCCCTTCGCGGG + Intergenic
1203477133 Un_GL000220v1:153231-153253 CGGGCGCTGACCCCCTTCGCGGG + Intergenic
1203361166 Un_KI270442v1:220125-220147 AGGGCACTGATCCCCTTCGCGGG - Intergenic
1203364296 Un_KI270442v1:243695-243717 CGGGCGGAGACCTCCATCCCGGG + Intergenic
1185633010 X:1529531-1529553 AGGGCACTGAGCATCTTCCCAGG - Intronic
1188077332 X:25794298-25794320 CTGGCAAAGACCACCTTCCCAGG - Intergenic
1189588741 X:42489281-42489303 AGGGTACTCACCTCATTCCCTGG + Intergenic
1189862056 X:45282790-45282812 AAGGCACAGACCTCCTTCTCTGG + Intergenic
1190310589 X:49114460-49114482 CAGGCACTGACCACCATGCCTGG - Intronic
1195665107 X:107422232-107422254 CAGGCACCTACCACCTTCCCCGG + Intergenic
1197352778 X:125398855-125398877 TGTGCAGTGTCCTCCTTCCCTGG - Intergenic
1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG + Exonic
1201074337 Y:10175566-10175588 CGGGCGGAGACCTCCATCCCGGG - Intergenic
1201077285 Y:10197437-10197459 AGGGCGCTGACCCCCTTCGCGGG + Intergenic
1202019510 Y:20450127-20450149 CAGGCACTGACCACCATACCTGG + Intergenic
1202378862 Y:24259778-24259800 CGGGCCGTGACCTCCACCCCAGG + Intergenic
1202491920 Y:25410343-25410365 CGGGCCGTGACCTCCACCCCAGG - Intergenic