ID: 1128023182

View in Genome Browser
Species Human (GRCh38)
Location 15:64411367-64411389
Sequence GTGAGGGATGCTAATAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 28, 3: 122, 4: 385}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128023182 Original CRISPR GTGAGGGATGCTAATAATGG GGG Intronic
900079680 1:846502-846524 GTGGGGGATGTTGATAATGGGGG + Intergenic
901226276 1:7614597-7614619 GTGAGGAATGTTAATAACGCGGG - Intronic
901406695 1:9052612-9052634 GTGAGAGATGTTGATAAAGGGGG + Intronic
902075037 1:13777642-13777664 ATGAGGCATGCAAATATTGGGGG - Intronic
902785044 1:18727821-18727843 GTGTGGGATGCTGGTAGTGGAGG + Intronic
903001635 1:20270401-20270423 GGGAGGGATGCCCATAATAGAGG - Intergenic
904312409 1:29637529-29637551 GTGAGGGCTTCCAATCATGGTGG + Intergenic
908279232 1:62513029-62513051 ATGGGGGATGTTAATAATGGGGG + Intronic
908312439 1:62898621-62898643 GTAAGGTGTGCTAATAATGCAGG - Intergenic
908674772 1:66591538-66591560 ATGGGGGATGTTGATAATGGGGG - Intronic
908846918 1:68334128-68334150 GTGGGGGATGTTGATGATGGGGG - Intergenic
909186320 1:72491078-72491100 ATGAGGGATGTTGATAATGGAGG + Intergenic
909510362 1:76446268-76446290 GTAATGGATGTTGATAATGGGGG - Intronic
910067009 1:83166286-83166308 GTGAGGACTGTTGATAATGGGGG - Intergenic
910136122 1:83972046-83972068 GTGGTGGATGTTGATAATGGGGG - Intronic
910215263 1:84837668-84837690 GTCTGAAATGCTAATAATGGTGG + Intronic
910489862 1:87756875-87756897 GTGGGGGATGTTGATAATGGGGG + Intergenic
910767947 1:90801292-90801314 GTGTGGGATGTTGAGAATGGGGG - Intergenic
910804034 1:91172941-91172963 GTGAGGAATGTTGATAATGGGGG + Intergenic
910903339 1:92146391-92146413 GTGTGGGACGTTGATAATGGGGG - Intronic
910978413 1:92932990-92933012 GTGAGGGATGTTGATAGTGGAGG + Intronic
910997526 1:93123877-93123899 TGGAGGGATGTTGATAATGGAGG - Intronic
911354458 1:96798785-96798807 ATGTATGATGCTAATAATGGGGG + Intronic
911417348 1:97591230-97591252 GTGAGAGATGAGGATAATGGTGG - Intronic
911809606 1:102258596-102258618 GTGGAGGATGTTGATAATGGTGG + Intergenic
912479623 1:109971437-109971459 GTGAGGGATGTTCATGGTGGGGG + Intergenic
912970843 1:114281590-114281612 GTGGGGGATGTTGATAATGGGGG + Intergenic
915547365 1:156608464-156608486 GTGAAGGATGCCAAGAAGGGAGG + Intergenic
916241079 1:162640415-162640437 GTGAGGGATGTCAATAGTGAGGG + Intronic
916374738 1:164140391-164140413 GTGAGAGGTGTTAATAATGAGGG + Intergenic
916949057 1:169760276-169760298 GTGCGGGATGCTGATACTGGGGG - Intronic
917063145 1:171062898-171062920 GTGGGGGATGTCGATAATGGGGG - Intronic
917369963 1:174281816-174281838 GTGAGGGATCTTAATTTTGGTGG - Intronic
917645716 1:177026776-177026798 GGGAGGGATGGAAAGAATGGAGG - Intronic
918557617 1:185822264-185822286 GTGGGGGATGTTGATAATGGCGG + Intronic
918724522 1:187902418-187902440 GTTATGGATGATAATATTGGTGG - Intergenic
919359858 1:196578994-196579016 GAGAGGGATACTGATAATGAGGG - Intronic
919440163 1:197623679-197623701 GTTGGGTATGTTAATAATGGAGG - Intronic
919740495 1:200978470-200978492 GTGGGGGGTGTTGATAATGGGGG - Intronic
920162216 1:204007734-204007756 GTATGGGATGTTAATAATGGGGG + Intergenic
920507752 1:206528617-206528639 GTGGGGGATGCTGATAATAGGGG + Intronic
920743776 1:208606358-208606380 GTGGGGAATGTTGATAATGGAGG - Intergenic
920985170 1:210882087-210882109 GTGGGGGATATTGATAATGGTGG + Intronic
921093010 1:211860696-211860718 GTGTGGGATGTTTATAGTGGGGG - Intergenic
921598626 1:217082638-217082660 GTGAGGGATGGGGATAAGGGTGG - Intronic
921826641 1:219679365-219679387 GTAGGGGGTGCTGATAATGGAGG + Intergenic
922357636 1:224791598-224791620 ATGAGGGAAGGGAATAATGGAGG - Intergenic
923085510 1:230700532-230700554 GTGGGGGATGTCAATAATGGGGG + Intergenic
923496007 1:234525349-234525371 ATGAAGGATGCTAGAAATGGAGG - Intergenic
1062778331 10:175160-175182 GTGTGGGATGTTGATAATAGGGG + Intronic
1062900636 10:1142771-1142793 GTGGGGGATGCTGACAGTGGAGG - Intergenic
1063650988 10:7936615-7936637 GTGGGGGATGTTGATAGTGGGGG - Intronic
1063849703 10:10173230-10173252 GTAGGGGATGTTAATAATGAAGG - Intergenic
1063894987 10:10670530-10670552 GTTGGGGATGCTGATAATGTGGG - Intergenic
1064789928 10:18946004-18946026 GTGGGGGATGTTGATATTGGAGG - Intergenic
1065102248 10:22341773-22341795 GTGATTGATACTAAAAATGGGGG - Intergenic
1065768546 10:29054980-29055002 GAGAGGGATGTTATTAATGGTGG - Intergenic
1066626762 10:37415094-37415116 GTGGGGGATGTTGATAATGGAGG + Intergenic
1067218348 10:44322525-44322547 GTGGGGGATGTTGATAATGGGGG - Intergenic
1067397456 10:45935436-45935458 GTGGGGGATGTTGATAATGGGGG + Intergenic
1067865774 10:49904522-49904544 GTGGGGGATGTTGATAATGGGGG + Intronic
1068590920 10:58852225-58852247 GTGAGGGATATTGATAATGGGGG + Intergenic
1068819761 10:61360695-61360717 GTGAGTGATGTTGATAATGGCGG - Intergenic
1069181150 10:65360360-65360382 ATGAGGGAGGCAAATATTGGAGG - Intergenic
1069238926 10:66113974-66113996 GGGGGGAATGCTAAAAATGGTGG + Intronic
1070204294 10:74241309-74241331 GTGGGGGATGCTGAAAATGGGGG - Intronic
1070412870 10:76160082-76160104 GTGGGGGATGTTGATAAGGGGGG + Intronic
1070680188 10:78443630-78443652 GTCAGGGAGGCCAAGAATGGGGG - Intergenic
1070852593 10:79579256-79579278 GTGGGGGATGTTCATAATGAGGG + Intergenic
1071535125 10:86422178-86422200 GTGCTGGATGTTAATCATGGGGG - Intergenic
1071815634 10:89229842-89229864 GTGAGGGATGTTCATAACAGGGG + Intronic
1072094405 10:92162948-92162970 GTGGGGGATGTTGATAATTGGGG - Intronic
1072201137 10:93159870-93159892 GTGGGGGATGCTGATAATGAGGG + Intergenic
1072453268 10:95556002-95556024 GTTAGGGGTGCTGATAGTGGAGG - Intronic
1073179900 10:101577417-101577439 GGGAGGGATGTCAAGAATGGAGG + Intronic
1073638513 10:105224019-105224041 GTGGAGGATGTTGATAATGGAGG - Intronic
1074146621 10:110722352-110722374 CTGGGGGATGCTGATAATGGGGG - Intronic
1074350732 10:112734243-112734265 GTGAGGGATGGGAATGATGAAGG - Intronic
1074522951 10:114241154-114241176 GTGGGGGATGCTGACAATGGGGG - Intronic
1074562938 10:114550489-114550511 GTGGGGGATGTTGCTAATGGGGG - Intronic
1075447437 10:122523495-122523517 GTGAGGGATGTTGATAATGGGGG + Intergenic
1075501401 10:122978516-122978538 GTGAAGGATGTTGATAGTGGGGG + Intronic
1078947639 11:16088226-16088248 GTGGGGGCTGTTTATAATGGGGG - Intronic
1079958553 11:26894213-26894235 GTGGGGGATGTTGATAATGGAGG + Intergenic
1080484387 11:32690401-32690423 GTGGGGGATGTTAATAATTGGGG - Intronic
1080798430 11:35587517-35587539 GTGGGGGATGTTGATAGTGGGGG - Intergenic
1081415143 11:42805689-42805711 GTGATGGATGGTAGTGATGGTGG + Intergenic
1082192327 11:49261595-49261617 GTGGGGGATGTTGATAATTGGGG - Intergenic
1083285566 11:61656563-61656585 GTGAGGGATGGTGAGAATGCAGG + Intergenic
1084445393 11:69200640-69200662 GGGAGGGAGGCAAACAATGGTGG + Intergenic
1084656155 11:70520151-70520173 GTGTGAGATGCTAATAATAGGGG - Intronic
1084924195 11:72498838-72498860 GTGGGGGATGTTGATAATGGGGG - Intergenic
1085403512 11:76248262-76248284 GTGAGGGATGGCAGTCATGGGGG - Intergenic
1086066743 11:82753686-82753708 GTGGGGGATGTTGATAATGGGGG + Intergenic
1086326392 11:85705516-85705538 GTGTGGGATGTTGATAGTGGGGG - Intronic
1086478248 11:87203139-87203161 GTGCGGGATGTTAATAATGGGGG - Intronic
1086673798 11:89579364-89579386 GTGGGGGATGTTGATAATTGGGG + Intergenic
1087289593 11:96305409-96305431 GTGGAGGATGGTGATAATGGGGG + Intronic
1087610477 11:100428202-100428224 TTGGGGGATGTTGATAATGGGGG + Intergenic
1087803805 11:102533889-102533911 GTGAGGGATGTTGATAATGGGGG + Intergenic
1087955530 11:104282234-104282256 GTGGAGGATGTTGATAATGGAGG - Intergenic
1088110538 11:106256055-106256077 GTGAGGGATGTCGATAATGGAGG + Intergenic
1088523326 11:110723712-110723734 GTGACGGATGCTGATAATGAGGG - Intergenic
1088929755 11:114339811-114339833 GTGGGGGATGTTGATAATGGCGG + Intergenic
1089438973 11:118498659-118498681 GTGGGGGATGCTGATCATGGGGG - Intronic
1089576224 11:119446292-119446314 GTGGGGGATGTTGATGATGGGGG + Intergenic
1090306028 11:125692104-125692126 GTGCAGGATGTTAATATTGGGGG + Intergenic
1090449647 11:126795296-126795318 ATGCAAGATGCTAATAATGGGGG + Intronic
1090683479 11:129087794-129087816 GTGTGGGATGTCAATAGTGGGGG + Intronic
1090698264 11:129270620-129270642 ATGTGGGATGCTGATAATGGGGG + Intronic
1091454461 12:596426-596448 CTGGGGGATGTTGATAATGGGGG + Intronic
1093109564 12:15133007-15133029 GTGTGGGATATGAATAATGGGGG - Intronic
1093176906 12:15922887-15922909 GTGGGGGATGTTGATAATGGGGG + Intronic
1093460880 12:19405738-19405760 GTGAGGGATGTTCATAATGGGGG - Intronic
1093540949 12:20284302-20284324 GTGGGGGATGTTGATAATGGGGG - Intergenic
1093642867 12:21547815-21547837 TTGGGGGATGCTGATAATGGGGG + Intronic
1093698111 12:22185920-22185942 GTGGGAGATGTTGATAATGGGGG + Intronic
1093900691 12:24628111-24628133 GTGGGGTATGTTGATAATGGGGG - Intergenic
1094690270 12:32761649-32761671 GGGAAGGAGGCTAATAATGATGG + Intergenic
1096785211 12:54013345-54013367 ATGGGGGATGCTAAGAATGGAGG + Intronic
1097912394 12:64984472-64984494 GTGGGGGATGTTGATAATGGGGG + Intergenic
1098069357 12:66655413-66655435 GTGTGGGATGTTGATAGTGGGGG - Intronic
1099457744 12:82884692-82884714 ATGCAGGATGCTAATAATAGGGG - Intronic
1099610707 12:84865391-84865413 GTGGGGGTTGCTGATAATGGAGG - Intronic
1100141746 12:91627308-91627330 GTGAGGGATGTTGACAATGGGGG - Intergenic
1100258783 12:92911692-92911714 GTGGGGAATGTTGATAATGGGGG + Intronic
1100697251 12:97108465-97108487 GTGGGGGATGTTGATCATGGGGG + Intergenic
1100911763 12:99372187-99372209 GTGGGGGATGTTCATGATGGGGG + Intronic
1101278998 12:103231240-103231262 GTGGGGGATACTGATAATGGTGG - Intergenic
1101649436 12:106661477-106661499 GTGAGGGATGTTGTTAATGGGGG - Intronic
1102127537 12:110496922-110496944 GTGAGGACTTCTAATAATGAAGG - Intronic
1102203026 12:111070545-111070567 GTGGGAGATGCTGATAATGGGGG - Intronic
1102400827 12:112628218-112628240 GTGAGGCATGTTAATAATGAGGG + Intronic
1102811634 12:115829325-115829347 GTGAGGGATGTTAGTAATGAGGG - Intergenic
1103930676 12:124449266-124449288 GTGATGTATTCTAATGATGGGGG - Intronic
1104260791 12:127180282-127180304 GTGAGGGATGCTGAGAATGAGGG - Intergenic
1105004422 12:132712098-132712120 GTGTATGATGCTAATAATAGAGG - Intronic
1105445564 13:20452763-20452785 GTGGGAGTTGCTGATAATGGGGG + Intronic
1105547013 13:21358163-21358185 GTGGGGGATGTTGATAATGAGGG + Intergenic
1105670477 13:22608002-22608024 GTGCAGGATGCTGATAGTGGGGG + Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1108103377 13:46982461-46982483 GTGGGGGGTGTTGATAATGGAGG - Intergenic
1108316128 13:49239351-49239373 GTGGGGGATGTTAATAGTTGGGG + Intergenic
1109563553 13:64080656-64080678 GTGGAGGATGTTGATAATGGGGG - Intergenic
1109676532 13:65682929-65682951 TTGAGGGATGCTGATAATGAGGG - Intergenic
1109988451 13:70020963-70020985 GTGGGGGATGTTGATAATAGGGG - Intronic
1110458595 13:75718574-75718596 GTGGGGGACGTTGATAATGGGGG - Intronic
1110753433 13:79143106-79143128 GTGTGGGATGTTGATAGTGGGGG - Intergenic
1110873497 13:80480401-80480423 GGTGGGGATGCTGATAATGGGGG - Intergenic
1111599958 13:90460385-90460407 GTGGGGGATGCTGATAATGGGGG - Intergenic
1111751626 13:92338942-92338964 GTGTGTGATGTTGATAATGGGGG + Intronic
1112085788 13:96031106-96031128 GTGAGGGATGTTGATAACAGGGG + Intronic
1112240984 13:97680722-97680744 GTGGGAGATGTTGATAATGGGGG - Intergenic
1113237589 13:108297748-108297770 GTGGGGGATTTTGATAATGGGGG - Intronic
1114763766 14:25347636-25347658 GTGGGGGATGTTGATAGTGGGGG + Intergenic
1115169561 14:30489036-30489058 GTGATGGACGTTGATAATGGGGG + Intergenic
1115733018 14:36292458-36292480 ATGAGGGATGTTGATAACGGGGG - Intergenic
1116105118 14:40492826-40492848 GTGGAGGGTGTTAATAATGGGGG - Intergenic
1116218038 14:42045508-42045530 GTGGGGGATGTTGATAATGGGGG - Intergenic
1117625418 14:57632579-57632601 GTGGGGAATGTTGATAATGGGGG - Intronic
1117698616 14:58391631-58391653 GTGAGGGATGTTGATAGTAGTGG + Intergenic
1117927997 14:60805342-60805364 GTGCAGGATGTTAATAATGGGGG - Intronic
1118055350 14:62074121-62074143 GTGTGGGAGGCAAATAGTGGGGG + Intronic
1119028942 14:71176418-71176440 GTGGGGGATGTGGATAATGGGGG - Intergenic
1119537594 14:75415390-75415412 GTGGGGGATGTTGGTAATGGGGG + Intergenic
1120753778 14:88222604-88222626 GTGCGGGATGTTGATAATGAGGG + Intronic
1120837518 14:89054760-89054782 GCGGGGGATGTTGATAATGGGGG + Intergenic
1121153753 14:91663898-91663920 TTGGGGAATGCTAGTAATGGGGG - Intronic
1122360307 14:101156012-101156034 GTGGGGGATGCTGATAATGTGGG - Intergenic
1124723958 15:32138466-32138488 GTGGGGGATGTTGATGATGGGGG - Intronic
1125278216 15:38016119-38016141 GTGGGGGGTGTTGATAATGGGGG + Intergenic
1125278514 15:38019564-38019586 GTGGGGGATGCTGACAGTGGGGG - Intergenic
1125278819 15:38022715-38022737 GTGGGAGATGTTGATAATGGGGG + Intergenic
1126017426 15:44365896-44365918 GTAGGGGATGTTAATAATCGGGG + Intronic
1126203335 15:46014707-46014729 GTGAGTGATGGCAGTAATGGTGG + Intergenic
1126408337 15:48345930-48345952 GTGGGGGATGCTGATAATGGAGG - Intergenic
1126548314 15:49897901-49897923 GTTACGAATACTAATAATGGTGG + Intronic
1127681267 15:61300801-61300823 GTGGGGGATGTTACTAATCGGGG + Intergenic
1128023182 15:64411367-64411389 GTGAGGGATGCTAATAATGGGGG + Intronic
1128779814 15:70351966-70351988 GTGGGGGAGGCAAATAATGGAGG - Intergenic
1129094208 15:73185338-73185360 GTGGGGGATGTTGATAATGGGGG + Intronic
1130132896 15:81158884-81158906 GTGTGGGAGGCTCAGAATGGCGG - Intergenic
1130135310 15:81177047-81177069 GTAAGGGGTGCTGCTAATGGGGG + Intronic
1130449833 15:84040259-84040281 GTGGGGGATGCTGATAATGGGGG - Intergenic
1130807978 15:87347019-87347041 GGGAGGGATGTTGATTATGGGGG + Intergenic
1131235642 15:90694490-90694512 GTGGGGGATGTTGTTAATGGGGG - Intergenic
1131313355 15:91310700-91310722 TTGGGGGATGTTGATAATGGGGG - Intergenic
1132123166 15:99195786-99195808 GTGAGGGAGGCTATGCATGGTGG + Intronic
1132401759 15:101513481-101513503 GTGGGGGCTGTTGATAATGGAGG - Intronic
1135162536 16:20109868-20109890 CTGAGGGATGCTGAAAATGAAGG + Intergenic
1135433622 16:22409033-22409055 GTGGGGGATGTTGACAATGGGGG - Intronic
1135649735 16:24195516-24195538 GTGAAGGGTGCTATTATTGGAGG + Intronic
1135839398 16:25860926-25860948 CTGGGGGATGCTGATAATGAGGG + Intronic
1135847887 16:25935251-25935273 GTGGGGGATGTTGATCATGGGGG - Intronic
1137238646 16:46636269-46636291 GTGGGGGCTGTTGATAATGGGGG + Intergenic
1137935851 16:52634818-52634840 GTGAGAGATGCTATTCATCGGGG - Intergenic
1138223359 16:55271881-55271903 GTGGGGGATGTGGATAATGGGGG + Intergenic
1138861016 16:60757498-60757520 GTGAAGGCTGCTAATGATTGTGG + Intergenic
1138904954 16:61320129-61320151 GTGGGGAATGTTGATAATGGGGG + Intergenic
1141119086 16:81336871-81336893 GTGTGGTATACTGATAATGGGGG - Intronic
1144048163 17:11471875-11471897 GTGGGGGATGTTGGTAATGGGGG - Intronic
1144086992 17:11818930-11818952 AGGAGGAATGGTAATAATGGAGG - Intronic
1145229377 17:21161257-21161279 GTGAGGGATGTGGATAATGGGGG + Intronic
1147506506 17:41022986-41023008 GTGGGGGATGCTGATAATGGGGG - Intergenic
1148034473 17:44648481-44648503 GTGCAGGATGCTGATATTGGGGG + Intergenic
1149340838 17:55684740-55684762 GTGGAGGATGGAAATAATGGGGG - Intergenic
1150061081 17:62068675-62068697 GTGGGGGATGTTGATAATGAGGG + Intergenic
1150174299 17:63033956-63033978 GTGATGTATGCTAATTGTGGTGG - Intronic
1150878571 17:68997731-68997753 TTGGGGAATGTTAATAATGGCGG - Intronic
1151044210 17:70900279-70900301 GTGATGGATATTAATAATGGGGG + Intergenic
1151516032 17:74596516-74596538 GTGGGGGATGTTGATAATGGGGG - Intergenic
1153169475 18:2299302-2299324 GTGAGGGATGTTGATAATGGGGG + Intergenic
1153404998 18:4727849-4727871 GTGTGGGATGTTGCTAATGGGGG + Intergenic
1155564370 18:27117344-27117366 ATGAGGGATGTTGAAAATGGGGG - Intronic
1156248552 18:35328211-35328233 GTGGGGGATGTTGACAATGGAGG - Intergenic
1156413527 18:36861465-36861487 TGGATGGATGCTTATAATGGTGG - Intronic
1158444101 18:57503763-57503785 ATGTGGGATGCTAATTATAGTGG - Intergenic
1158534443 18:58295047-58295069 GTGGGGGATGCTGATGATGAGGG - Intronic
1158730957 18:60022039-60022061 GTGGGGGATGTTGGTAATGGGGG - Intergenic
1158815480 18:61090044-61090066 GTTGGGGATGTTGATAATGGGGG - Intergenic
1159232608 18:65628862-65628884 GTGAGGGCTGCAATTGATGGGGG - Intergenic
1159487288 18:69078774-69078796 GTGAGAGATGTTGATAATCGGGG + Intergenic
1159736510 18:72105608-72105630 GTGTGGAATGTTGATAATGGGGG + Intergenic
1159818289 18:73105596-73105618 GTAGGGGATGTTGATAATGGAGG - Intergenic
1162038208 19:7953649-7953671 GTGAGGGATGTTAATGCTGGGGG - Intergenic
1164969051 19:32514928-32514950 GTGGGGGATGTGAATAATAGGGG + Intergenic
1165610631 19:37149214-37149236 GAGAGGAATGCTGATAATGTGGG + Exonic
1167325506 19:48822213-48822235 GTTGGGGATGGTAATGATGGTGG + Intronic
1167325578 19:48822812-48822834 GTTGGGGATGGTAATGATGGTGG + Intronic
1167759940 19:51439718-51439740 GTGGGAGATGCTGATAATAGAGG + Intergenic
1167977390 19:53240893-53240915 ATGGGGGATGGTGATAATGGGGG + Intronic
924971838 2:135580-135602 GTGGGTGATGTTGATAATGGGGG + Intergenic
925994084 2:9277644-9277666 GTGCGGGATGTTAACAAAGGAGG - Intronic
926266182 2:11323774-11323796 GTGAGGGATGTTGATAGTGGGGG - Intronic
926780873 2:16470767-16470789 GTGGGGGATGTTGATAATGGGGG + Intergenic
927044268 2:19261647-19261669 GTGGGGGATGTTGATGATGGGGG + Intergenic
928020767 2:27703039-27703061 GTGGGGAATGTTGATAATGGGGG - Intergenic
928478884 2:31660584-31660606 GTGGGGGATGTTGATAACGGGGG + Intergenic
930042154 2:47134153-47134175 GTGTGGCATGATGATAATGGAGG - Intronic
931063364 2:58556196-58556218 GTGGGGAATGTTGATAATGGGGG - Intergenic
932488921 2:72106074-72106096 GAGGGGGATGTTAATAATGGGGG - Intergenic
933864564 2:86504308-86504330 GTGTGGGATACTGATAGTGGTGG + Exonic
934100631 2:88649935-88649957 GTGTGGGATGTTGATAGTGGAGG - Intergenic
935209246 2:100924182-100924204 GTGGGGGATGCTGATAATGGGGG - Intronic
935506274 2:103908060-103908082 GTGAAGGATGCTGATAATGGAGG - Intergenic
936085748 2:109467855-109467877 GTGAGGGATGTGAATGACGGCGG - Intronic
936727691 2:115341393-115341415 GTGCGGGATGTTGATAATTGGGG - Intronic
936766951 2:115862569-115862591 GTGATAAATGCTAATAATTGGGG + Intergenic
936919413 2:117672209-117672231 GTGGGGGATGTTGATAATGGGGG + Intergenic
937264018 2:120604867-120604889 GTCAGAGATGCTAATAGTGTGGG + Intergenic
939154630 2:138509700-138509722 GTGGGGAATGGTGATAATGGAGG - Intronic
939173818 2:138726712-138726734 GTGCAGGATGCTGACAATGGGGG - Intronic
939518851 2:143204147-143204169 GTGACAGATGATAGTAATGGTGG - Intronic
939857849 2:147382030-147382052 GTGTGGGATGTTGATAATTGGGG + Intergenic
940714298 2:157201928-157201950 GTGTGGGATGGTGATAGTGGGGG + Intergenic
941508626 2:166377490-166377512 GTGGGGAATGTTGATAATGGGGG - Intergenic
941717428 2:168778831-168778853 GTGGGTGATGTTGATAATGGGGG + Intergenic
941733399 2:168945176-168945198 GTGGGAGATGTTGATAATGGGGG + Intronic
942530889 2:176909126-176909148 ATGGGGGATGTTGATAATGGAGG + Intergenic
942656212 2:178216639-178216661 TTGGTGGATGCTAAGAATGGAGG + Intronic
942919027 2:181348297-181348319 GTGGGGGATGTTGATAATGGGGG + Intergenic
944194499 2:197038211-197038233 GTGGAGGATGATGATAATGGAGG + Intronic
945717021 2:213369837-213369859 GTAGGGGATGCTGATAATAGGGG - Intronic
946671747 2:222112134-222112156 GTGGAGGATGTTGATAATGGGGG + Intergenic
1169791702 20:9416484-9416506 GTGAGGGGAGGTAACAATGGTGG - Intronic
1170417041 20:16155672-16155694 GTGGAGGATGTTCATAATGGGGG + Intergenic
1170449736 20:16470394-16470416 GTGAGGGATGGCAACAATGGGGG + Intronic
1170471605 20:16673538-16673560 GTGTGAGATCCTAATAAAGGAGG - Intergenic
1170487532 20:16834401-16834423 GTGGGGGATGTTGACAATGGGGG + Intergenic
1170651477 20:18246496-18246518 GTGGGGGATGTTAATAATGGGGG - Intergenic
1170880295 20:20291097-20291119 GTGGGGGATGTTGATAGTGGGGG - Intronic
1171340938 20:24428242-24428264 GTGTGGGGTGTTAACAATGGGGG + Intergenic
1174487989 20:50873214-50873236 GAGATGGATTCTAAAAATGGAGG - Intronic
1175511603 20:59531526-59531548 GTGGGCGATGTTGATAATGGGGG + Intergenic
1175609109 20:60335367-60335389 GTGAAGGACACTGATAATGGAGG - Intergenic
1176889147 21:14293368-14293390 GTGGAGGATGTTGATAATGGGGG + Intergenic
1177325578 21:19584184-19584206 GTGGGGGATGTTGATAATGGGGG - Intergenic
1177669999 21:24212643-24212665 GTGGGGGATGTTGATAATAGGGG + Intergenic
1177680187 21:24357693-24357715 GTAAGGGATGTTGATAAGGGGGG - Intergenic
1178101699 21:29275859-29275881 GTAGGGGATGTCAATAATGGTGG - Intronic
1178536414 21:33413758-33413780 GAGAGGGATTCTGATATTGGTGG + Intronic
1179057540 21:37949950-37949972 GTGGGGGATGTTGATAGTGGGGG + Intergenic
1179192625 21:39136350-39136372 GTGGAGGATGTTGATAATGGCGG + Intergenic
1180900033 22:19364039-19364061 GTGGGGGATGCTGAAAGTGGGGG + Intronic
1182178561 22:28319537-28319559 GTGTGGGATGTCAATAATGGGGG + Intronic
1183766455 22:39880535-39880557 GTTGGGGATGTTTATAATGGGGG + Intronic
1184215688 22:43065770-43065792 GTAGGGGATGCTGATAAGGGGGG + Intronic
949144580 3:682346-682368 GTGTAGGATGTTAGTAATGGTGG - Intergenic
949421431 3:3870457-3870479 GTGAGGAAGGGTAACAATGGCGG - Intronic
949451282 3:4188074-4188096 GTGAGGGATGTTGATAATGCGGG - Intronic
949571429 3:5297212-5297234 GTGTGGGATGATAATAATACTGG + Intergenic
949985589 3:9538147-9538169 GTGAGAGATGCCAAGGATGGCGG - Intronic
951265800 3:20564896-20564918 GTGGGAGATGCTGATAACGGGGG - Intergenic
951676761 3:25250203-25250225 GTGAGGGATGCCAACAATGGTGG + Intronic
951759618 3:26130800-26130822 AAGAGGGATGTTAATAATGAGGG - Intergenic
951829690 3:26912247-26912269 GTGCAGGATGCTGATAATGGGGG + Intergenic
952893267 3:38058782-38058804 GTGGGGGACGTTGATAATGGTGG + Intronic
953119286 3:40024152-40024174 GTGAGGGATGAGAATAAAGGTGG - Intronic
956115861 3:65917983-65918005 GTGGGGGACGTTGATAATGGGGG + Intronic
956335184 3:68155415-68155437 GTTAGGGATGATATTAATGCTGG - Intronic
956496409 3:69831244-69831266 ATTAGTGATGATAATAATGGGGG - Intronic
958813253 3:98887769-98887791 GTCAGGAATGTTAATAATGAAGG - Intronic
959112383 3:102137229-102137251 GTGTGGGATGATGATATTGGGGG - Intronic
959771149 3:110098221-110098243 GTGGGGGATGTTGATAATGGAGG - Intergenic
963059020 3:141209843-141209865 GTGAGGGGTCCAAATAAGGGGGG - Intergenic
964234299 3:154507063-154507085 GTGCAGGATGTTGATAATGGGGG - Intergenic
964413758 3:156426410-156426432 GTGAAGGATGCTGATAACGAGGG - Intronic
964501595 3:157354128-157354150 GTGAGGGATGCTGACAGTGGGGG + Intronic
964917728 3:161856313-161856335 GTGGGGTATGTTGATAATGGGGG + Intergenic
965114584 3:164471871-164471893 GAGAGGGATGTTGATAATGTGGG - Intergenic
965654189 3:170966365-170966387 GTGGGAAATGCTGATAATGGGGG - Intergenic
966465071 3:180222402-180222424 GTGGAGAATGTTAATAATGGGGG + Intergenic
967117518 3:186355291-186355313 GTGGGGGGTGACAATAATGGTGG - Intronic
968044415 3:195616035-195616057 GTGGGGGACGCTGATGATGGGGG - Intergenic
968060204 3:195722086-195722108 GTGGGGGACGCTGATGATGGGGG - Intronic
968592929 4:1468494-1468516 GTGAATGATGATAATAATGATGG + Intergenic
969109674 4:4836074-4836096 GGTAGGGATGTTGATAATGGTGG + Intergenic
970047636 4:11874336-11874358 GTAGGGGATGTTAACAATGGGGG - Intergenic
970319117 4:14858159-14858181 GTGAGGGATGTTAATAATTGAGG + Intergenic
970750864 4:19358919-19358941 GTGAAGGATGTTGATAATGAAGG + Intergenic
971212910 4:24637172-24637194 GTGAGGGATGCTGGTAATGGGGG - Intergenic
971270048 4:25134502-25134524 GTAAGGGATGCTAAGAATAGAGG + Intronic
971306064 4:25482714-25482736 GTGGGGAATGTTGATAATGGGGG + Intergenic
971949551 4:33327394-33327416 GAGGGGAATGTTAATAATGGAGG + Intergenic
971992683 4:33920366-33920388 GTGGGGGATGTTGATAATGGGGG - Intergenic
972886537 4:43498331-43498353 GTGGGGGATGTTGATAATGTGGG - Intergenic
973289171 4:48453401-48453423 GTGGGGGATGTTGATAATGGGGG + Intergenic
973944415 4:55942652-55942674 GTCTGGGATGCCAAGAATGGGGG + Intergenic
974394025 4:61311947-61311969 ATGTGGGATGTTAATAATGGGGG + Intronic
974489216 4:62543340-62543362 GTGGGGGATGTTGATATTGGAGG + Intergenic
974623213 4:64386866-64386888 GTGAGAGATGTTGATAATAGGGG - Intronic
974632617 4:64513420-64513442 GTGGGGGATGTTAATAATGGGGG + Intergenic
974670603 4:65025350-65025372 GTGCGGGATACTGATAATAGAGG - Intergenic
975666132 4:76736857-76736879 GTGGGGGTTGCTGAAAATGGAGG - Intronic
977487514 4:97666939-97666961 GTCAGTGATGGTGATAATGGTGG - Intronic
977822193 4:101486052-101486074 GTGCAGGATGTTGATAATGGAGG - Intronic
977860378 4:101951161-101951183 ATGTAAGATGCTAATAATGGGGG + Intronic
978033015 4:103959003-103959025 GTGGGGGATGTTGATAATGGAGG + Intergenic
978243667 4:106547411-106547433 GTGTGGGATGTTGATAATGGGGG + Intergenic
979162933 4:117486785-117486807 GAGGGGGATGTTAATAATGGGGG - Intergenic
979830376 4:125293225-125293247 GTGGAGGATATTAATAATGGAGG + Intergenic
979928169 4:126594220-126594242 TTGAGAGATGTTGATAATGGAGG + Intergenic
979991238 4:127378321-127378343 GTGGGGGATGTTGATAATGGGGG - Intergenic
980319144 4:131245397-131245419 GTTGGGGATGTTAATAATGGGGG - Intergenic
981509853 4:145544163-145544185 GTGGGGGATATTAATAATGAGGG + Intronic
982033854 4:151326245-151326267 GTGGGGGATGTTGATAATGGGGG + Intergenic
982211937 4:153044825-153044847 GTGGGGTATGTTGATAATGGGGG + Intergenic
982274465 4:153625109-153625131 GTGTGGGATTTTAAAAATGGAGG + Intronic
982429249 4:155303704-155303726 GTGGGGGATGCTGATAACGGGGG + Intergenic
983110703 4:163745950-163745972 GTGGGGGGTGTTGATAATGGGGG - Intronic
983528828 4:168788680-168788702 GTGAGAGATGTTGGTAATGGGGG + Intronic
984026047 4:174544710-174544732 GTGAGGGATGTTGATAGTTGGGG + Intergenic
984907493 4:184642521-184642543 GTGCAGGATGTTGATAATGGGGG + Intronic
985225201 4:187752596-187752618 GAGAGGGTTGATAATAATGAGGG - Intergenic
986021823 5:3811816-3811838 GTGGGGGATGCTCATAATGGGGG + Intergenic
986206261 5:5628054-5628076 GTAGGGGATGCTGATAGTGGAGG + Intergenic
986385053 5:7224976-7224998 CTGGGGGATGCAAATAATTGGGG - Intergenic
986839001 5:11674454-11674476 GTGGGGGATGTTGATAATGAGGG - Intronic
986877425 5:12128352-12128374 GTGGGGGATGTTGATAATGAGGG + Intergenic
986942153 5:12966877-12966899 GTGAGGGAAGCTGACAGTGGAGG - Intergenic
987265055 5:16244826-16244848 GTGGGGGATGTCGATAATGGGGG + Intergenic
987297095 5:16562962-16562984 ATGTAGGATGCTATTAATGGGGG + Intronic
988259743 5:28870608-28870630 GTGGGGTATGCTGATAGTGGCGG - Intergenic
989100734 5:37820640-37820662 GTGGGGGATGTTGACAATGGAGG + Intronic
990202272 5:53389829-53389851 GTGGGGAATGTTGATAATGGAGG + Intergenic
990379285 5:55206352-55206374 GTGAGGAATGTTGTTAATGGGGG + Intergenic
990722809 5:58717021-58717043 GTGGGGGATGTTGATAGTGGAGG + Intronic
992609521 5:78495180-78495202 GTGAGGGATGCTAGGAATGGAGG + Intronic
992852777 5:80827996-80828018 GTGGGGGATGCTGAAAATGGGGG - Intronic
992877799 5:81075148-81075170 GTAAGAGATGATTATAATGGAGG + Intronic
993863176 5:93160539-93160561 GTGGGGGATATTGATAATGGGGG - Intergenic
994593311 5:101799803-101799825 GTGGGAGATGCTAATAATGAGGG - Intergenic
994802328 5:104394856-104394878 GTGAGGGATGTTCATAATTGTGG + Intergenic
995576999 5:113547550-113547572 GTGGGGGATGTTGATAATGGGGG + Intronic
996026708 5:118654524-118654546 GTGGGGGAGGCTTATAATGGGGG - Intergenic
996507196 5:124280735-124280757 GTGGGGAATGCTGATAATGGGGG + Intergenic
997054951 5:130431107-130431129 GTGGGGGATGTTGATAATGGAGG + Intergenic
997730421 5:136168523-136168545 GTGAGAGATGCTGATAATGGAGG - Intronic
998205087 5:140152260-140152282 GTGAGGGCTGCTAAGAAAGGTGG + Intergenic
998361888 5:141595374-141595396 GTGGGGGATGTTGACAATGGGGG + Intronic
998602466 5:143599181-143599203 GTGGGGGGTGTTGATAATGGAGG - Intergenic
999189555 5:149736862-149736884 GTGGGGAATATTAATAATGGGGG - Intronic
999305526 5:150517123-150517145 GTGGGGGATGTTGATAATGGGGG - Intronic
999373575 5:151070989-151071011 GTGGAGGATGTTGATAATGGGGG + Intronic
999427865 5:151503284-151503306 GTGGGGAATGTTAATAATGAGGG + Intergenic
999695363 5:154184146-154184168 GTGGGGGATGCTGATAATTCAGG + Intronic
1000423728 5:161066294-161066316 GTGAGGGATGCTGATAATGAAGG - Intergenic
1000550513 5:162656805-162656827 GTGAGGGAGGGTGATAATGATGG - Intergenic
1002084512 5:176764218-176764240 GTGGGGGACGTTGATAATGGGGG - Intergenic
1003300727 6:4879976-4879998 GTGGGGAATGCTGATAATGAGGG - Intronic
1003358377 6:5397502-5397524 GTGGAGGATGCTGATAGTGGAGG + Intronic
1003404675 6:5818554-5818576 GTGGGGGATGTTGATAATGAGGG - Intergenic
1003689558 6:8339340-8339362 GTGAGAGATGATAATAATGATGG - Intergenic
1003712649 6:8610004-8610026 GCTAGGGATGATGATAATGGAGG - Intergenic
1004039691 6:11963257-11963279 GTGGGGGATGCTGAAAATGGTGG - Intergenic
1004471476 6:15933358-15933380 GTGGGGGATGTTAATAATAGGGG - Intergenic
1006363702 6:33602094-33602116 GGGAAGGATGCCAAGAATGGAGG - Intergenic
1006482965 6:34313561-34313583 GTGTGAGATGTTGATAATGGGGG + Intronic
1006812789 6:36830920-36830942 GTGAGAGATGATACTGATGGTGG - Intronic
1006825404 6:36931019-36931041 GGTAGGGATGCTGATAGTGGGGG - Intergenic
1007968687 6:46028738-46028760 GTGATGAATGTTGATAATGGGGG - Intronic
1008134768 6:47761797-47761819 GTGTGGGATGTTGATAGTGGAGG - Intergenic
1008322849 6:50139156-50139178 GTGATGGATGTTGATAATGAGGG - Intergenic
1008358087 6:50579257-50579279 GTGGGGGATATTAATAATGGGGG + Intergenic
1008482852 6:52005026-52005048 TTTAGGGCTGCTAATATTGGTGG - Intronic
1010372112 6:75122386-75122408 ATGTGGGATGTTAATAGTGGAGG + Intronic
1010649097 6:78429905-78429927 GTGGAGGATACTAATAGTGGAGG - Intergenic
1011218365 6:85029456-85029478 GTGGGTGATTCAAATAATGGTGG - Intergenic
1011698407 6:89933585-89933607 GTGGGGGATGCTGACAGTGGGGG + Intronic
1012463995 6:99496861-99496883 GTGGGGGATGTTGATAATGGAGG - Intronic
1012897194 6:104963669-104963691 GTAGGGGATGTTGATAATGGAGG - Intronic
1012926051 6:105268948-105268970 GTGGGGGATGTTGATAATGGGGG + Intergenic
1013517749 6:110904070-110904092 GTGGGGGATGTTGATAATGAAGG - Intergenic
1013845630 6:114447596-114447618 GTAAGGAATGTTGATAATGGGGG - Intergenic
1014701043 6:124688413-124688435 GTGGAGGATGCTGATAATGGGGG - Intronic
1015689910 6:135910522-135910544 GTGGGGGATGTGGATAATGGAGG - Intronic
1015767451 6:136733730-136733752 GTGGGGGATGTTGACAATGGGGG - Intronic
1015872983 6:137795686-137795708 GTGAGGGATGTTGATAGTTGGGG - Intergenic
1016125579 6:140398809-140398831 GTGGGGGATATTGATAATGGAGG - Intergenic
1016630997 6:146231216-146231238 GTGCGTGATGTTAATAATGGAGG + Intronic
1016678461 6:146799685-146799707 GTAGGGGATGTTAATAATGGGGG + Intronic
1017885226 6:158593844-158593866 GTGCGAGATGCTGACAATGGGGG - Intronic
1018657419 6:166051691-166051713 GTGGGGGATGTTGATAAGGGAGG - Intergenic
1019846881 7:3511901-3511923 GTGGGGGATGGTGATCATGGAGG - Intronic
1020866328 7:13568665-13568687 GTGGGGGATGTTGATAATGAGGG - Intergenic
1020874979 7:13681815-13681837 ATGGGGGATGTTGATAATGGGGG + Intergenic
1021086376 7:16424916-16424938 GTGGGAGATGTTAATAATGTGGG - Intergenic
1021341039 7:19463064-19463086 GTGGGGGATGTTGATAATGGGGG + Intergenic
1022296197 7:29056123-29056145 GTGAGGGATATTGATAGTGGAGG - Intronic
1023407684 7:39852480-39852502 GTGAGGCATACTGATAATGAGGG - Intergenic
1024035959 7:45507630-45507652 GTGGGGGATGTTGATAATGGGGG - Intergenic
1024546364 7:50524358-50524380 CTGCAGGATGCTAATAATGGGGG + Intronic
1025024064 7:55501739-55501761 GTGAGGGAGGGGAATAAGGGGGG + Intronic
1027277102 7:76568467-76568489 GTGAGGACTGTTGATAATGGGGG + Intergenic
1028501523 7:91524151-91524173 GAGGGAGATGCTGATAATGGGGG - Intergenic
1028723002 7:94055446-94055468 TTGGGGGATGTTGATAATGGTGG + Intergenic
1028770187 7:94610415-94610437 GTGGGGGATGTTGATAATGGGGG + Intronic
1029846109 7:103413898-103413920 GTGGGGGATGTTGATAGTGGGGG - Intronic
1029846113 7:103413914-103413936 GTGGGGGATGTTGATAGTGGGGG - Intronic
1030062127 7:105630768-105630790 GTGGGGGATGTTGATAGTGGCGG + Intronic
1030353565 7:108518557-108518579 GTGGGTGATGCCGATAATGGAGG + Intronic
1031307058 7:120142035-120142057 TTGGGGGATGTTAATAATGAGGG - Intergenic
1031379004 7:121061515-121061537 GTGGGGGATGTTAATAATGGAGG + Intronic
1032015309 7:128376314-128376336 GTGAGGGATGTTTATAATGGGGG - Intergenic
1033139324 7:138810872-138810894 GTGGGGGGTGTTGATAATGGGGG + Intronic
1033150044 7:138906403-138906425 CTGGGGGATGCTGATAATGGAGG + Intronic
1033402707 7:141042068-141042090 GTGGGGGGTGTTAATAATGGGGG + Intergenic
1035525824 8:312414-312436 GTGGGGGATGTTGATAATGGGGG - Intergenic
1036450485 8:8862780-8862802 GTTGGGGATGCTACTAATGGAGG + Intronic
1036703224 8:11027891-11027913 GGGTGGGATGTTGATAATGGGGG - Intronic
1037204872 8:16304768-16304790 ATGAGGGATGATAATATTGATGG - Intronic
1037449367 8:19001411-19001433 GTGGGGGTTGATAATAATGGGGG - Intronic
1038144083 8:24877783-24877805 GTGGAGGATGTTGATAATGGGGG + Intergenic
1038415705 8:27393770-27393792 GTGAGGGATGTTGATAGTGGGGG - Intronic
1038460443 8:27711844-27711866 GTGGGGGAGGTTAATAATAGGGG - Intergenic
1038737934 8:30189227-30189249 GAGAGGGATGCTGACAATGAAGG - Intergenic
1039078466 8:33713395-33713417 GTGAAGGATGGTGATAATAGGGG - Intergenic
1039333362 8:36563227-36563249 GTGAGGGATGTTGATAATGGGGG + Intergenic
1039925960 8:41932697-41932719 GTGAGGAATGCCAATGTTGGTGG + Exonic
1039940955 8:42090697-42090719 GTGGGGGATGTTTATAATGGGGG + Intergenic
1040086864 8:43352206-43352228 GTGAGAGATACTGATAATGGGGG - Intergenic
1041407954 8:57521329-57521351 GTGGGGGATGCTGATGATGGCGG - Intergenic
1041595096 8:59640960-59640982 GTGAGGGATGTTACTGAAGGGGG + Intergenic
1042427799 8:68669229-68669251 GTGGGGGATGTTGATAATGGGGG + Intronic
1042832633 8:73048701-73048723 GTGAGGGATCCTCATGGTGGTGG - Intergenic
1043739709 8:83795360-83795382 GTGGGGCATGTTGATAATGGGGG + Intergenic
1043830881 8:84987425-84987447 GTGGAGGATGTTGATAATGGGGG - Intergenic
1043879249 8:85523116-85523138 GTGAGGGATGGAAAAAATTGGGG - Intergenic
1044074965 8:87809296-87809318 GTGAAGGACGCTGATAATGAGGG + Intergenic
1045350917 8:101338870-101338892 GTGTGGGATGTTGACAATGGTGG - Intergenic
1045562991 8:103283718-103283740 GTGGGGGATGCTCATAGTCGGGG - Intergenic
1045650261 8:104335743-104335765 GTGGGGGATGTTGATATTGGGGG + Intronic
1045989642 8:108290768-108290790 GTGTGGGATGATGATAATGTGGG - Intronic
1046000814 8:108419353-108419375 GTGAGGGATGTTGATGAGGGAGG + Intronic
1046206397 8:111003713-111003735 TTGGGGGATGTTGATAATGGGGG + Intergenic
1047545419 8:125811711-125811733 GTGAGGGATGCCAAGAAGTGTGG + Intergenic
1047560685 8:125985094-125985116 GTGATGGATTCTGAAAATGGAGG + Intergenic
1047640651 8:126817981-126818003 GTAGGGGATGTTGATAATGGGGG - Intergenic
1047695557 8:127400365-127400387 ATGTGGGATTCAAATAATGGAGG + Intergenic
1047715612 8:127592291-127592313 CTGGGGGATGCTGATAATGGGGG - Intergenic
1048318643 8:133381163-133381185 ATGGGGGATGTTGATAATGGGGG + Intergenic
1050578986 9:7030519-7030541 GTGGGGGATGTTGATAATGATGG + Intronic
1050595781 9:7203360-7203382 GTGAGGGATGTGGATAATTGAGG - Intergenic
1050796127 9:9545077-9545099 GTGGGGGATGTTGGTAATGGGGG - Intronic
1050822545 9:9898787-9898809 CTAAGAGATGCTAATAAAGGAGG - Intronic
1050886676 9:10775661-10775683 GTGATGGAGGCTAATAATTTAGG - Intergenic
1051002189 9:12297213-12297235 TTTAGGGATGTTGATAATGGGGG - Intergenic
1051442179 9:17097090-17097112 GTGTGGGATGTTGATAGTGGGGG - Intergenic
1051746711 9:20301679-20301701 GTGGGGGATGTTGATAATGGAGG - Intergenic
1052966034 9:34341365-34341387 GGGAGGGATGCTAGTAGTGATGG - Intronic
1053624761 9:39857823-39857845 GTGGGGGATGTTTATTATGGGGG - Intergenic
1053838119 9:42162782-42162804 GTGGGGGATGTTTATTATGGGGG - Intergenic
1053880109 9:42585405-42585427 GTGGGGGATGTTTATTATGGGGG + Intergenic
1053892552 9:42708904-42708926 GTGGGGGATGTTTATTATGGGGG - Intergenic
1054219134 9:62392875-62392897 GTGGGGGATGTTTATTATGGGGG + Intergenic
1054231579 9:62516298-62516320 GTGGGGGATGTTTATTATGGGGG - Intergenic
1055324033 9:75109999-75110021 GTGAGGGATGTTGATAATGGAGG - Intronic
1055781511 9:79826275-79826297 GTGGAGGATGCTCATAATGGGGG + Intergenic
1056096926 9:83264517-83264539 GTGTGGGATGTTGATGATGGGGG + Intronic
1056212444 9:84377241-84377263 GTGGGGGATGTTGATAATGAGGG - Intergenic
1057011109 9:91602118-91602140 GTGGGGGATGTTAATAATGTGGG - Intronic
1057060117 9:91996358-91996380 CCGATGGATGCTAATATTGGTGG - Intergenic
1057757888 9:97852307-97852329 GTGAGGGCTGCGGGTAATGGGGG - Intergenic
1057862801 9:98655275-98655297 GTGGGGGATGTCGATAATGGGGG + Intronic
1058071676 9:100607645-100607667 GTGCTGGATGCTGATAGTGGGGG + Intergenic
1058772722 9:108252635-108252657 GTGAGGGATATTGATAATAGAGG + Intergenic
1058863800 9:109143374-109143396 GTGCAGGATGTTGATAATGGGGG + Intronic
1059894826 9:118850973-118850995 GTGGGGGATGGTAATAATGGTGG + Intergenic
1061791270 9:133060520-133060542 GTGGGGGATGTTGATAACGGGGG + Intergenic
1061794932 9:133080997-133081019 GTGGGGGATGTTGATAATGGGGG + Intronic
1061808074 9:133147567-133147589 GAGAGGGATGCTAGTAATGGGGG + Intronic
1185957524 X:4507778-4507800 GTGGGGGATGTTGATAATTGCGG - Intergenic
1186677366 X:11832778-11832800 GTGATGGATGCTAATAATGAAGG - Intergenic
1187128142 X:16473673-16473695 GTGTGGGATGTTGGTAATGGAGG + Intergenic
1187219369 X:17308695-17308717 GTGGGAGATGGTGATAATGGGGG - Intergenic
1187311101 X:18143710-18143732 GTGAGGGATGTTGATAGTGCGGG + Intergenic
1187758300 X:22549740-22549762 GTGGGGGATGCTGATAATGGTGG + Intergenic
1187783286 X:22854255-22854277 ATGAGGGATGTTGATAGTGGGGG + Intergenic
1188088579 X:25934099-25934121 GTGGGGGATGTTAATAATGAGGG + Intergenic
1188269051 X:28116095-28116117 GTGGGGGATGTTGATAATGGGGG - Intergenic
1189058451 X:37726177-37726199 GTGGGGGATGTTGATAATGGGGG + Intronic
1189229583 X:39441881-39441903 GTGAGGGAAGCAAATAAAAGAGG + Intergenic
1189411659 X:40778231-40778253 GTGGGGGATGTTGATAATGTGGG - Intergenic
1189464968 X:41271635-41271657 GTGGGGGATATTGATAATGGGGG + Intergenic
1189804223 X:44719296-44719318 GTGATGGATGTTAATGATGGCGG - Intergenic
1189937546 X:46085584-46085606 GTGGGGGATGTTGATAGTGGGGG - Intergenic
1190264655 X:48820758-48820780 ATGAGGCAGGCTAATCATGGAGG + Intronic
1192187646 X:68962866-68962888 GTAGGGGATGTTGATAATGGGGG - Intergenic
1192903644 X:75525673-75525695 GTGGGGGATGTTGATAATGGAGG - Intergenic
1193085370 X:77444168-77444190 GACAGTGATGCTAATAATGCTGG - Intergenic
1194184443 X:90756507-90756529 GTGGGGGATATTGATAATGGGGG + Intergenic
1196155560 X:112424864-112424886 GTGCAGGATGTTGATAATGGGGG - Intergenic
1196264856 X:113630893-113630915 GTGGGGCATGTTGATAATGGGGG + Intergenic
1197416629 X:126182835-126182857 GTGAGGTTTGCTTATAAGGGAGG - Intergenic
1197618898 X:128724612-128724634 TGAAGGGATGATAATAATGGAGG - Intergenic
1197831164 X:130644975-130644997 GTGAAGGATGTTGATAGTGGGGG + Intronic