ID: 1128025395

View in Genome Browser
Species Human (GRCh38)
Location 15:64432204-64432226
Sequence GTACTTATCCTGAAGAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128025393_1128025395 8 Left 1128025393 15:64432173-64432195 CCATGCCTGGCTGAGCATTATGT 0: 1
1: 1
2: 5
3: 74
4: 1016
Right 1128025395 15:64432204-64432226 GTACTTATCCTGAAGAGAGATGG 0: 1
1: 0
2: 0
3: 8
4: 138
1128025394_1128025395 3 Left 1128025394 15:64432178-64432200 CCTGGCTGAGCATTATGTTTTCT 0: 1
1: 0
2: 4
3: 33
4: 350
Right 1128025395 15:64432204-64432226 GTACTTATCCTGAAGAGAGATGG 0: 1
1: 0
2: 0
3: 8
4: 138
1128025392_1128025395 11 Left 1128025392 15:64432170-64432192 CCACCATGCCTGGCTGAGCATTA 0: 1
1: 4
2: 55
3: 743
4: 8131
Right 1128025395 15:64432204-64432226 GTACTTATCCTGAAGAGAGATGG 0: 1
1: 0
2: 0
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128025395 Original CRISPR GTACTTATCCTGAAGAGAGA TGG Intronic
903434995 1:23343015-23343037 GTATTTGGCTTGAAGAGAGAGGG - Intronic
903758259 1:25679091-25679113 GGATTTATGCAGAAGAGAGAAGG + Intronic
906349436 1:45045076-45045098 GCCCTTTTCCTGAAGGGAGATGG - Intronic
907576997 1:55535436-55535458 GGACTTATCCTGAAGGCAAAGGG - Intergenic
909814820 1:79978559-79978581 GGGCTTATCATGAAAAGAGAAGG - Intergenic
912550780 1:110483900-110483922 GTACTGACACTGAAGACAGACGG - Intergenic
917025476 1:170637091-170637113 TTACTTCTCCTGAAAAGTGAAGG - Intergenic
919949873 1:202353054-202353076 GTATTTCTCAGGAAGAGAGATGG + Intronic
920286185 1:204881529-204881551 GGCCTTGTCCTGAAGACAGAAGG + Intronic
921099184 1:211913474-211913496 ATACTTATCTTGAAGAGGTAAGG - Intergenic
921356834 1:214292712-214292734 GAACTTGTCCTGAAGAAAGCAGG - Intronic
923951159 1:238955946-238955968 GAACTGATCCTAAAGAGAAATGG - Intergenic
924143505 1:241050191-241050213 TTTTTTATCCTGAAGATAGATGG + Intronic
1063177748 10:3567624-3567646 TGACTTATCCTGAGGTGAGAAGG - Intergenic
1066410851 10:35167679-35167701 GTACTTAATCTGAAGAAATAAGG - Intronic
1066444036 10:35465523-35465545 GTACTTTTCCTGAGGACAGAGGG - Intronic
1068423902 10:56831408-56831430 ATACTTATCATGAAGTTAGAAGG + Intergenic
1069294683 10:66829436-66829458 GTACTTTTAGTAAAGAGAGATGG - Intronic
1073131849 10:101194509-101194531 GTATTTATTCTTAAGAGATATGG + Intergenic
1080807290 11:35664851-35664873 TTACTTATGCAGAAGAGAGATGG - Intronic
1083948837 11:65942538-65942560 GAAATGATCCAGAAGAGAGAGGG + Intergenic
1086234056 11:84606526-84606548 GTACTTATTTTAAAGAAAGATGG - Intronic
1089928896 11:122288981-122289003 GTACTTATCCTGCTGAGAATGGG - Intergenic
1094324327 12:29220399-29220421 GTAGTAATCCTTAAGAGAGGTGG + Intronic
1095218583 12:39579917-39579939 ATACTTATCTTGGAGGGAGATGG + Intronic
1097388930 12:58985089-58985111 GTAGTAATCCAGAAGAGAGATGG + Intergenic
1098096271 12:66960120-66960142 GTCCTTAACCTGAAAACAGATGG + Intergenic
1102747399 12:115261277-115261299 GAACTTTTCCTGCAGATAGAGGG + Intergenic
1105986121 13:25569275-25569297 CTTCTTATCATGAAGAGAAAAGG - Intronic
1106959300 13:34978986-34979008 GTAATTATCAGGTAGAGAGATGG + Intronic
1116921115 14:50576451-50576473 GTGCAAATCCTAAAGAGAGAGGG - Intronic
1118045726 14:61968822-61968844 GTACTGCTTCTGAAGGGAGAGGG + Intergenic
1118065372 14:62184993-62185015 GCACTTTTCCTGAAGAGCCAGGG - Intergenic
1124863135 15:33462477-33462499 ATACTTATCCTGAGGGGAAAAGG - Intronic
1126003944 15:44238871-44238893 GTACTTGTGCTGAATATAGAAGG + Intergenic
1127815653 15:62606657-62606679 GTACTTATCCAGATGAAAAAAGG - Intronic
1128025395 15:64432204-64432226 GTACTTATCCTGAAGAGAGATGG + Intronic
1128043582 15:64596892-64596914 GCACAAATCCTGAAGAGAAAGGG + Intronic
1130972242 15:88742062-88742084 GCTCTTCTCCTGGAGAGAGAGGG - Intergenic
1132180075 15:99745651-99745673 GTATCTATACTGAAAAGAGAAGG + Intergenic
1133394633 16:5436465-5436487 GTACTTCTCTTGCAGAGATAAGG + Intergenic
1134215443 16:12313450-12313472 GGACTTTCCCGGAAGAGAGAAGG - Intronic
1135609883 16:23857272-23857294 GTCCCTCTCCTGCAGAGAGAAGG + Intronic
1137274456 16:46924375-46924397 CTCCTTCTCCTGATGAGAGATGG - Exonic
1139266146 16:65640292-65640314 GGATTTATCCTGAAGGGAAATGG - Intergenic
1140919535 16:79524317-79524339 GGCGTTATCCTTAAGAGAGATGG - Intergenic
1146941608 17:36847488-36847510 GCACTTTTCCTGGAGAGATAAGG + Intergenic
1149912254 17:60577324-60577346 GCACTTACCCAGGAGAGAGATGG - Exonic
1153977936 18:10285917-10285939 GTCCTTATCCAGAAGGCAGAAGG + Intergenic
1157479568 18:48044759-48044781 ATATTTAACCTGAAAAGAGAAGG - Intronic
1162594749 19:11619613-11619635 GTTCTTATCCAGAAGGGAAAAGG + Intergenic
1163680143 19:18676482-18676504 GGTCTGATCATGAAGAGAGAGGG - Intergenic
1166332846 19:42088708-42088730 GTTTATTTCCTGAAGAGAGAAGG - Intronic
926835375 2:17013437-17013459 TTTTTTATCCTGAAGAGAAAAGG + Intergenic
928571386 2:32612593-32612615 GTACATGTCCTGAAAAGATAGGG - Intronic
931135032 2:59389300-59389322 TGAGTTATCCTGCAGAGAGATGG - Intergenic
933148145 2:78881540-78881562 TTACCTATCCTAAAGATAGAAGG - Intergenic
933533588 2:83542058-83542080 GAACATATTCTGAAGAGAGAGGG + Intergenic
933545325 2:83703855-83703877 GTAATTATCCTGAAGGCAGAAGG + Intergenic
939886806 2:147690155-147690177 GTTCTTTGCCTGAACAGAGAAGG - Intergenic
940848425 2:158665168-158665190 GTAGTTCTCCAGAAGGGAGACGG + Intronic
940878407 2:158921826-158921848 GTACTCAGCCTGCAGCGAGAGGG + Intergenic
945335176 2:208583481-208583503 GATCTTATCCTGAAGTGGGAAGG + Intronic
947356097 2:229297347-229297369 GTATTTCTCCAGAAGAGTGAAGG - Intergenic
947937207 2:234017784-234017806 ACACTTTTCCTGAAGAGAGCGGG - Exonic
1170035824 20:11988587-11988609 GTGCTTATACTGTAGAGAGAAGG - Intergenic
1171246133 20:23611209-23611231 GCACTTGTCCTGAAGAGTAACGG + Intergenic
1172331804 20:34080576-34080598 GTCCTAAGCCAGAAGAGAGAAGG - Intronic
1172617736 20:36300290-36300312 GGACTTAGCCTGAAGAGCAAGGG - Intergenic
1176386122 21:6139287-6139309 GGACTTGGCCTGCAGAGAGAGGG + Intergenic
1178462987 21:32819776-32819798 GTAACTATCATGAAGTGAGAGGG - Intergenic
1179737351 21:43398965-43398987 GGACTTGGCCTGCAGAGAGAGGG - Intergenic
955225012 3:57053206-57053228 ATCCTTATCCTAAAGAGAGCAGG - Intronic
958005390 3:87803160-87803182 GAACTTAATCAGAAGAGAGAGGG - Intergenic
958625134 3:96613809-96613831 GAATTTATGCTGAACAGAGAAGG - Intergenic
960176113 3:114519371-114519393 GTACTGATCCTGAGCAGACATGG - Intronic
960646869 3:119895257-119895279 CTACTTAGCCTTAAGAAAGAAGG - Intronic
962117886 3:132531379-132531401 GTATTTATCTTGTAAAGAGAAGG + Intronic
962806056 3:138928657-138928679 TTACTTCCCCTGAAGAGACAAGG + Intergenic
964526624 3:157621736-157621758 GAACTTAGACTAAAGAGAGAAGG - Intronic
970230947 4:13910479-13910501 TTGCTTATACTGAAGTGAGAAGG - Intergenic
970632779 4:17970088-17970110 GTATTTATACAAAAGAGAGAAGG + Intronic
973304078 4:48624419-48624441 GTACATATGCAGATGAGAGATGG - Intronic
974176010 4:58325581-58325603 TTACTTATCCTGAGGTGATAGGG + Intergenic
974374447 4:61058480-61058502 GTACTTGACATGAAAAGAGAGGG - Intergenic
975667127 4:76743114-76743136 GTGCTTCTCCTGAAGGGAAATGG + Intronic
978197770 4:105990825-105990847 TTCCTTATCCAGAGGAGAGATGG + Intronic
978679974 4:111368445-111368467 TTATTTATCCTGAAGGAAGAAGG + Intergenic
979585372 4:122409119-122409141 TGACATATCTTGAAGAGAGAGGG + Intronic
982686585 4:158497497-158497519 GTTCTTTTCCTCAGGAGAGAAGG + Intronic
983303820 4:165960754-165960776 GTTTTTATCCTGAAGGGAGGCGG - Intronic
983568523 4:169179596-169179618 GTATATAACCTGAAGAGAGTGGG - Intronic
983995240 4:174174685-174174707 AAACTTAACCTGAAGATAGAAGG - Intergenic
986122728 5:4857249-4857271 TTACTTCTCATGCAGAGAGAGGG - Intergenic
986585670 5:9314729-9314751 TTACTTAGTCTGGAGAGAGAAGG - Intronic
988632392 5:32945044-32945066 GTAAATCTCCTCAAGAGAGATGG - Intergenic
992538741 5:77740384-77740406 GTAGTAATCCAGGAGAGAGATGG + Intronic
994676964 5:102835258-102835280 GTCAATATCCTGAAAAGAGAAGG - Intronic
996407306 5:123118201-123118223 ATAGTAATCATGAAGAGAGATGG + Intronic
997993156 5:138563017-138563039 ATACTTCTCCTGAAGAAAGGTGG - Intronic
998034626 5:138904428-138904450 GTACTTTACCTGAGGACAGAGGG - Exonic
998912509 5:146975337-146975359 TTACTTATTCTTAAGAAAGAAGG - Intronic
1003421750 6:5964656-5964678 CTTCTTATACTGAAGAGAGTGGG - Intergenic
1005211251 6:23466715-23466737 GTACTTAACTAAAAGAGAGAGGG - Intergenic
1007065970 6:38990827-38990849 GTAGGGATCCTAAAGAGAGAAGG - Intronic
1008921487 6:56847713-56847735 GTAATTAACCTGAGGGGAGAAGG - Intronic
1011774473 6:90713731-90713753 GTACTTACTAAGAAGAGAGAAGG - Intergenic
1014246604 6:119077245-119077267 GTTGGTATGCTGAAGAGAGATGG - Intronic
1015825178 6:137303547-137303569 GTAACTATTCAGAAGAGAGAAGG - Intergenic
1016539837 6:145151970-145151992 GTACCTGTGCAGAAGAGAGATGG + Intergenic
1017189576 6:151637895-151637917 ATACATATCCTGAAGTGGGAAGG + Intergenic
1018619960 6:165720686-165720708 GCACATATCCTTATGAGAGAAGG + Intronic
1020615495 7:10454469-10454491 GAACTTGTCCTGCAGAGAAAAGG - Intergenic
1026598664 7:71754902-71754924 GAACTTATCCTGGAGAAGGAAGG - Intergenic
1029654817 7:101917331-101917353 ATATTTATTCTGAAGACAGAAGG - Intronic
1035280136 7:157773208-157773230 AGGCTTGTCCTGAAGAGAGAGGG - Intronic
1039370196 8:36976627-36976649 GTACCCCTCCTGAAAAGAGAAGG + Intergenic
1041858812 8:62487534-62487556 GATCTTATCATGAAGAGACATGG + Intronic
1042909637 8:73813228-73813250 GTATTTTTCCTAAAGAGAAATGG + Intronic
1046250325 8:111623139-111623161 GTACTTATGTTGAAGAGAAGTGG + Intergenic
1046738937 8:117808571-117808593 TTGCTTATCCAGAAGAGATACGG - Intronic
1047117050 8:121854973-121854995 GTTTTTATCCTGAAGGGATAGGG - Intergenic
1048737690 8:137519761-137519783 CTACTTTTTCTAAAGAGAGATGG - Intergenic
1051657639 9:19398112-19398134 GACCTTCTCATGAAGAGAGAGGG + Intergenic
1053223982 9:36335587-36335609 TTATTTTTCCTGAAGAGACAGGG + Intergenic
1054782362 9:69176735-69176757 ACACTTGTCCTGAAGAGAAATGG - Intronic
1054935895 9:70687174-70687196 GTGCTCATCATGAAGGGAGAGGG - Intronic
1055994435 9:82141915-82141937 GTCCTCATTCTGAAGAGATAGGG - Intergenic
1057557170 9:96097338-96097360 GGCCTGATCCTGAAGACAGAGGG - Intergenic
1057974855 9:99594381-99594403 GTACTTGTCCTTAAGAGATATGG - Intergenic
1058383276 9:104403584-104403606 GTAATAATCCTGAAGATAGTGGG - Intergenic
1058726342 9:107808337-107808359 GGATTTATCCTGAGGATAGAAGG + Intergenic
1058871951 9:109209778-109209800 GTAGTTATCTTGAAATGAGATGG - Intronic
1059315817 9:113425055-113425077 TTACATAACCTGAAGACAGAAGG + Exonic
1185504550 X:621573-621595 GTGCTTATCATGAATAGAAATGG + Intergenic
1185872856 X:3679001-3679023 CTACTTAGCTTGGAGAGAGATGG - Intronic
1186574318 X:10749437-10749459 GTACTCACCTTGAAGAAAGAGGG + Intronic
1186714697 X:12239112-12239134 GTACTTGTCTTAAAGAAAGAAGG - Intronic
1188000918 X:24980819-24980841 GTACTTTTACTGAAGCGATATGG - Intronic
1188926186 X:36047358-36047380 GTACTTTTCATGATGACAGATGG - Intronic
1195091719 X:101466703-101466725 GTGCTGAGGCTGAAGAGAGAGGG + Intronic
1195113423 X:101670055-101670077 GCAGATATCCAGAAGAGAGATGG - Intergenic
1196007832 X:110854281-110854303 GTAATTATCCTGATGAGCAATGG + Intergenic
1198440815 X:136661288-136661310 GTACTATTCCAGAAGAGAGATGG - Intergenic
1200209298 X:154339446-154339468 GTAATTATTCTAGAGAGAGATGG + Intergenic
1200221578 X:154392681-154392703 GTAATTATTCTAGAGAGAGATGG - Intronic
1200791095 Y:7299727-7299749 CTACTTAGCTTGGAGAGAGATGG + Intergenic