ID: 1128032879

View in Genome Browser
Species Human (GRCh38)
Location 15:64497404-64497426
Sequence ATGTCACAGTAGAAGAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128032879_1128032886 22 Left 1128032879 15:64497404-64497426 CCTTTGCTCTTCTACTGTGACAT 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1128032886 15:64497449-64497471 GTTCTTTGACATTGCTCTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 198
1128032879_1128032887 28 Left 1128032879 15:64497404-64497426 CCTTTGCTCTTCTACTGTGACAT 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1128032887 15:64497455-64497477 TGACATTGCTCTGAGGGAATAGG 0: 1
1: 0
2: 1
3: 18
4: 173
1128032879_1128032885 21 Left 1128032879 15:64497404-64497426 CCTTTGCTCTTCTACTGTGACAT 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1128032885 15:64497448-64497470 AGTTCTTTGACATTGCTCTGAGG 0: 1
1: 0
2: 2
3: 18
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128032879 Original CRISPR ATGTCACAGTAGAAGAGCAA AGG (reversed) Intronic
901457323 1:9370654-9370676 ATCTCACAGGAGGATAGCAAGGG + Intergenic
902173150 1:14629379-14629401 GTGACTTAGTAGAAGAGCAAAGG - Intronic
902647096 1:17807220-17807242 ATGTCAGATTACAAGACCAAGGG - Intronic
902705417 1:18200914-18200936 ATAGCGCAGCAGAAGAGCAAAGG - Intronic
902761477 1:18583649-18583671 ATGTCACTCTGAAAGAGCAATGG - Intergenic
904203230 1:28835401-28835423 ATGTCATAGGAGAAGATTAAAGG - Intronic
905993923 1:42364537-42364559 ATGTCCCAGTAAAAGAGCCTGGG - Intergenic
907622193 1:55992706-55992728 ATTTCATAGTAGAAGAGGACTGG - Intergenic
909252298 1:73374040-73374062 AGGTGACATTAGAATAGCAATGG - Intergenic
909535473 1:76731061-76731083 ATTTCACAGGGCAAGAGCAAGGG - Intergenic
910012462 1:82482053-82482075 ATGTCACAATGGAGGTGCAAAGG - Intergenic
910475527 1:87602212-87602234 ATGTCCCAGTAGAACAACTATGG - Intergenic
911143097 1:94526799-94526821 AGATCACAGTCGAAAAGCAAGGG + Intergenic
911143783 1:94533192-94533214 ATGTGACCGTAGAAGATGAACGG - Exonic
912687610 1:111779485-111779507 AGGTCAGAGTAGAAAAGCCAAGG - Intronic
913071232 1:115300618-115300640 ATGTCACTGCAGAAGAGCAAGGG - Intronic
915629774 1:157143632-157143654 AAGCCACATTAGAAGAGGAAAGG - Intergenic
916808852 1:168287402-168287424 ATGTCACAGAAGGAGACTAAAGG - Intronic
917428674 1:174942578-174942600 ATTTTACAGAAGAAGAACAAAGG - Intronic
919596890 1:199575427-199575449 ATGTCACAGTACATTAGCAGAGG - Intergenic
923043939 1:230340957-230340979 ATGTCACAGGAGAAGGGGACAGG + Intronic
923178430 1:231492182-231492204 ATGTCACATTAGAAAATCCAAGG + Intergenic
923546290 1:234925898-234925920 ATGTCTCAGTGGAAGAACTATGG + Intergenic
923916396 1:238510819-238510841 AAGCCCCAGTAGAAGAGCCATGG + Intergenic
1063767197 10:9155830-9155852 TTGTCACAGTAGGAGATCAAGGG - Intergenic
1065028382 10:21560902-21560924 AAGTCACACAAAAAGAGCAAAGG - Intronic
1066615709 10:37292158-37292180 ATGCCACAGGAAAAGAGCTAAGG - Intronic
1069737147 10:70664260-70664282 ATGACAGAGTGGAAGAGGAAGGG + Intergenic
1073142886 10:101260866-101260888 TTGTCTCAGTCCAAGAGCAAAGG - Intergenic
1073740853 10:106405048-106405070 ATGGCACACTGGAAGAGCAGTGG + Intergenic
1074339667 10:112615236-112615258 CTGTCACAGTAGTTTAGCAAGGG + Intronic
1078898022 11:15615380-15615402 GTGACAGAGTAGAATAGCAAAGG - Intergenic
1080430665 11:32195854-32195876 AGGACACAGTAGCAGGGCAAGGG + Intergenic
1080970415 11:37268152-37268174 TTGTCACAGTAGGAGAATAAGGG - Intergenic
1081182039 11:39995709-39995731 TTTTCATAGTAGAAGATCAAGGG - Intergenic
1083341960 11:61964019-61964041 ATGTTGCAGTAGGAGGGCAAAGG - Exonic
1084994615 11:72963927-72963949 ATTTCACAGTTGAATAACAATGG + Intronic
1087194809 11:95294639-95294661 CTGTTACAGAAGAAGAGCAGAGG + Intergenic
1088209745 11:107442217-107442239 TTCTCACAGTAGAAGGGGAAGGG + Intronic
1089789810 11:120934484-120934506 ATGTCCCAGGAGAAGAGCAGTGG + Intronic
1089860487 11:121586215-121586237 ATTTCAGAGAAGAAGTGCAATGG + Exonic
1089956457 11:122575536-122575558 ATGCCACAGTGGCAGAGCTAAGG + Intergenic
1090317503 11:125806826-125806848 ATGTAACACTAGGATAGCAAAGG - Intergenic
1091058776 11:132442798-132442820 CAGTCATAGTGGAAGAGCAAGGG - Intronic
1092888632 12:12948027-12948049 GTATCTCAGTTGAAGAGCAAAGG - Intronic
1093108289 12:15116435-15116457 ATGCCACAGTAGGAGGGAAATGG + Intronic
1094435698 12:30418691-30418713 GTGTCAGAGGAGAAGAGTAAGGG + Intergenic
1094562464 12:31568409-31568431 AGTTCACAGTAGAAGAGGGAGGG - Intronic
1096000102 12:48122309-48122331 AAGTAGAAGTAGAAGAGCAAGGG - Intronic
1096860333 12:54522161-54522183 ATGTCCCAGTTTAAGAGAAAAGG + Intronic
1097171517 12:57116874-57116896 ACGACACAGTTGAAGAGCAGAGG + Intronic
1099193344 12:79583739-79583761 CACTCACAGTAGAAGAGGAAGGG - Intronic
1099306148 12:80958854-80958876 ATGTCACAGTAAATAAACAAAGG - Intronic
1099696429 12:86027162-86027184 GTGTCATAATAGAAGAGGAAAGG + Intronic
1100200863 12:92296575-92296597 CTGTCACAGTAAAGGCGCAAAGG - Intergenic
1103144745 12:118585310-118585332 ATGACACAGAAGAAGAGCATTGG - Intergenic
1104297108 12:127526422-127526444 ATGTCACATGAGAAGACCTAAGG - Intergenic
1106701038 13:32228876-32228898 ATGTGACAGTTGATGGGCAAGGG + Intronic
1107242824 13:38257788-38257810 ATTTCATAGTGGAAGAGTAATGG + Intergenic
1108426776 13:50310295-50310317 AGGTCACAGTAGGTGGGCAAAGG + Intronic
1110344950 13:74435213-74435235 ATATCACTGTAAAAGAGAAAAGG - Intergenic
1113257328 13:108521019-108521041 AAGTGACAGAAGAAGAGCAAAGG - Intergenic
1113555851 13:111233517-111233539 ATGTTACGGGACAAGAGCAAGGG - Intronic
1113863803 13:113508420-113508442 ATATCACGGCCGAAGAGCAATGG - Intronic
1115150782 14:30283184-30283206 ATGTAACACTAGGAAAGCAATGG - Intergenic
1115479422 14:33846564-33846586 ATGTCGCAGTAGAAACACAATGG - Intergenic
1116954598 14:50911163-50911185 AGGTCCCAGTGGAAGAGAAAGGG + Intronic
1119384354 14:74248075-74248097 AAGTCAAGGTAGAAAAGCAAGGG - Intronic
1120093763 14:80364621-80364643 AAGTCACTGTAGGAGTGCAAGGG + Intronic
1120096372 14:80393151-80393173 ATGTCATAGTGAAAGAGCATAGG - Intergenic
1120276566 14:82382412-82382434 ATGACACAGAAGTAGAACAATGG + Intergenic
1125707838 15:41756234-41756256 ATGACCCAGTAGAAAAGTAATGG + Intronic
1125922287 15:43532139-43532161 ATGTCAAAGGAGCAGAGAAAGGG + Intergenic
1126332497 15:47548498-47548520 AAGCTACATTAGAAGAGCAATGG - Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1126732341 15:51696698-51696720 ATGTCACAGCATAAAAGCAAAGG + Intronic
1127242310 15:57129939-57129961 ATTTCACAGTAGAGGAGCATAGG - Intronic
1128032879 15:64497404-64497426 ATGTCACAGTAGAAGAGCAAAGG - Intronic
1128258351 15:66214522-66214544 ATGACACAGCAGAAGAAGAAGGG + Intronic
1129682662 15:77666577-77666599 ATGGCTCAGTAGAAGAGCTTGGG + Intronic
1138182063 16:54948051-54948073 ATGTCACAGTCCAGGAGCCAGGG - Intergenic
1138219469 16:55238648-55238670 ATGTCACATGAGAAGGGCATGGG - Intergenic
1138788869 16:59878831-59878853 ATTTCACAGAAGAAGAGGAGGGG + Intergenic
1140146565 16:72316720-72316742 CTGTCACAGCAGCAGAACAAGGG - Intergenic
1140329426 16:74039604-74039626 ATTTCACAGAAAAACAGCAAAGG + Intergenic
1141364837 16:83433044-83433066 ATGACACAGTAAGAGAGCCAAGG - Intronic
1143224529 17:5289182-5289204 AACTCATAGTAGAAGAGAAAAGG - Intronic
1143933950 17:10462461-10462483 ATGTGACTGTAGAAGAACAGTGG + Intronic
1144025638 17:11273954-11273976 ATGTCCCAGGAGAAGAACACAGG - Intronic
1144168820 17:12638579-12638601 ATGGCAAAGTAGTAGAGAAATGG + Intergenic
1145014208 17:19386335-19386357 ATGTCACAGAAGACGGGCACAGG + Exonic
1149665207 17:58360367-58360389 ACCTCACAGTAGAATAGGAATGG + Intronic
1149956910 17:61061460-61061482 ATGGCACAGTTGAATAGCAAAGG - Intronic
1151434467 17:74086363-74086385 GTGTCACAGGAGAGGAGCAAGGG - Intergenic
1153451336 18:5232876-5232898 ATGTCACAGTTCCAGGGCAAAGG + Intergenic
1153703461 18:7720264-7720286 ACCTGACAGTAGAAGAGTAATGG + Intronic
1155721358 18:29016483-29016505 AAGTAAAAGTAGAAGAGAAAAGG + Intergenic
1156274092 18:35565360-35565382 ATGTCATATTAGTAGAGTAAGGG + Intergenic
1156540081 18:37901002-37901024 ATGACCCAGCAGAAGAGAAAGGG - Intergenic
1156844845 18:41653220-41653242 ACTTCCCAGTAGCAGAGCAAAGG - Intergenic
1157166750 18:45364421-45364443 CTGTGAGAGTAGAAGAGAAAAGG + Intronic
1158642350 18:59214305-59214327 ATGTGACAGGGGAAGAGCTAGGG + Intergenic
1158953155 18:62515820-62515842 ATGTCAAAATACAAGAACAAGGG + Intergenic
1159314838 18:66758918-66758940 ATGAAACAGGAGAAGAGCAAGGG + Intergenic
1162448497 19:10739207-10739229 ATGTCCCCATAGAAGAACAAGGG - Intronic
1164545290 19:29156034-29156056 GTGTCACAGAGGAAGACCAAAGG - Intergenic
1164816446 19:31207522-31207544 ATGTCAAAGCAGAAGAGCCTCGG + Intergenic
1165984495 19:39756141-39756163 ATGTAACAGTGAAACAGCAAAGG + Intergenic
1168614965 19:57830197-57830219 ATGACAGAGTGGAAGAGCCATGG + Intronic
1168625011 19:57911236-57911258 ATATCACAGTAGAAGTGAAAAGG + Intronic
925497167 2:4464883-4464905 ATGTCACCATACAATAGCAAGGG + Intergenic
926794382 2:16606869-16606891 ATGTCAAAGCAAAGGAGCAAAGG + Intronic
927598783 2:24421992-24422014 CTCTCTCTGTAGAAGAGCAAAGG - Intergenic
930547668 2:52789890-52789912 ATGACACAGAAGCAGAGAAATGG - Intergenic
930704159 2:54487655-54487677 TTGTAACACTAGAAAAGCAATGG - Intronic
934911438 2:98259038-98259060 ACATCACATTAGTAGAGCAAAGG - Intronic
935484662 2:103638902-103638924 CTGTTAGAGTAGAAGAGGAAAGG - Intergenic
935849632 2:107204615-107204637 ATTTCACAGGAGTAGTGCAAAGG - Intergenic
936481666 2:112890577-112890599 ATGTCACAGTAACAAAGCCATGG + Intergenic
937318667 2:120947911-120947933 CTGGCACAGGGGAAGAGCAAGGG + Intronic
940649278 2:156425477-156425499 CTGTCACAGAAGAAAAGAAAAGG - Intergenic
941673063 2:168315842-168315864 ATGTCAGAGTAGAGGAGTAAAGG + Intergenic
942520932 2:176802871-176802893 ATGCCTCAAAAGAAGAGCAATGG - Intergenic
942839831 2:180347049-180347071 ATTTTAAAGTATAAGAGCAAAGG - Intergenic
943275389 2:185860797-185860819 ATAGCACAGTAGGAGCGCAAAGG + Intergenic
943795303 2:191985605-191985627 TTTTCCCAGTAAAAGAGCAATGG + Intronic
946575019 2:221065703-221065725 ACAACATAGTAGAAGAGCAATGG + Intergenic
947803984 2:232951951-232951973 CTGCCACAGTTGAAGGGCAAAGG + Intronic
948042436 2:234913553-234913575 CTGTCACAGTGGTACAGCAAGGG + Intergenic
1170200792 20:13741530-13741552 ATGTCACATTACTAGAGGAAAGG + Intronic
1174297287 20:49557842-49557864 ATGTCACAAGAGAAAAGGAACGG - Intronic
1174822365 20:53737743-53737765 ATGTTACAATAGAACAGGAATGG - Intergenic
1175740720 20:61418036-61418058 ATTTAACAGCAAAAGAGCAAAGG - Intronic
1177528413 21:22328809-22328831 ATGGCACAGAAGAAGAGGATGGG - Intergenic
1182010385 22:26995844-26995866 ATGTAGCAGTAGAAGATCCAGGG + Intergenic
1182523096 22:30895982-30896004 ATGTCACAATAGATGAATAAAGG + Intronic
1185046287 22:48530228-48530250 ATGTCACAGGAGGGGAGCAGAGG - Intronic
952148151 3:30556298-30556320 ATGGCACGGGAGAAAAGCAAGGG + Intergenic
955184279 3:56700253-56700275 ATGTCAGAGATGAAGAGGAAGGG + Intergenic
956326314 3:68056662-68056684 ATTTCCCAGTAGAGAAGCAAGGG + Intronic
956466258 3:69523458-69523480 ATGTCAGAATAGAAGAGGGAGGG - Intronic
957480473 3:80786741-80786763 TTGTCACAATAGATAAGCAATGG - Intergenic
958679006 3:97301635-97301657 ATGGCACAGTATAAGAGCACTGG - Intronic
959098506 3:101983866-101983888 ATATCACAGTGGATGAGAAAAGG + Intergenic
959137201 3:102438225-102438247 TTTTCATAGTAGAAGAGCTAAGG - Intronic
959533234 3:107457287-107457309 AAGTCACAGAAGAAGAGAAAGGG + Intergenic
964689747 3:159437153-159437175 ATGTCTCAAAAGAAGAACAAGGG - Intronic
965974028 3:174598997-174599019 TTGTCACAGTAGACTAGAAAAGG - Intronic
967153283 3:186669131-186669153 CTAACACAGTAGAAGAGAAAGGG + Intronic
967583011 3:191181819-191181841 AAGCCACACTAGAAGATCAATGG - Intergenic
967702707 3:192612146-192612168 CAGTCACAGTAGTAGAGAAATGG + Intronic
969568787 4:7995895-7995917 ATGTCACAGAAGGAGAGTCAAGG + Intronic
970006339 4:11414539-11414561 TTGTTAAAGTAGAAAAGCAATGG - Intronic
971176914 4:24290997-24291019 ATAAGACAGTAGAAGAGCAATGG - Intergenic
972318805 4:37953071-37953093 ATGCCACAGTGGGAGAGGAATGG - Intronic
974233756 4:59153014-59153036 ATGTTACAGAGGTAGAGCAATGG + Intergenic
979099279 4:116595225-116595247 ATGTCAAAGGAGGAGAGAAATGG + Intergenic
979310069 4:119192820-119192842 ATCACACAGTAAAAAAGCAATGG + Exonic
979535521 4:121815822-121815844 ATGTCATAATAGAAAAGCTAGGG - Intronic
979881672 4:125967309-125967331 ATGTCACATTAGAAGGAAAAAGG - Intergenic
979890070 4:126081358-126081380 AGGTTACAGTAGAAGAGCAGAGG + Intergenic
980134479 4:128846569-128846591 CTGTCAGGGAAGAAGAGCAAGGG - Intronic
980569114 4:134587352-134587374 ATATCAAGGTAGAAAAGCAATGG + Intergenic
983426252 4:167587569-167587591 ATGGCACATTAGAGGAGCGAAGG - Intergenic
984106029 4:175547074-175547096 GTGTCACAGGAGAAGAGGGAAGG + Intergenic
984238450 4:177189706-177189728 ATATGAAAGTAGAAGAGTAATGG + Intergenic
985343868 4:188981267-188981289 AGGTCAAAGAAGAAAAGCAAGGG + Intergenic
985536954 5:470727-470749 CTTTCACAATAGAAGATCAATGG + Exonic
985776585 5:1847394-1847416 ATGTCACAGTGGTAAAGCTAGGG - Intergenic
986014088 5:3742189-3742211 ATGTCAGAGGAGATGAGCAGAGG + Intergenic
986899547 5:12414440-12414462 ATGCAACAGAAGAAGAGAAAAGG + Intergenic
987006553 5:13716124-13716146 CTGCCACAGCAGTAGAGCAAAGG - Intronic
987466414 5:18277099-18277121 ATGTCACAGGGCAAGAGTAACGG - Intergenic
988556775 5:32243664-32243686 ATGACACAGTTGAGGAGCACAGG - Intronic
988638764 5:33017683-33017705 ATCTCACAGAAGAGGAGCAAAGG + Intergenic
990612268 5:57469507-57469529 ATGTCAGAGAAGAGGAGCTATGG - Intergenic
990859198 5:60307681-60307703 AAGTCACACTAGATTAGCAAAGG + Intronic
991470625 5:66965259-66965281 TGGACACATTAGAAGAGCAAAGG - Intronic
996390501 5:122955697-122955719 ATGCCACCATAGAAGAGAAAGGG + Intronic
996400297 5:123054935-123054957 ATGTAACAGTGGAAAAGCAGAGG + Intergenic
997822355 5:137077465-137077487 AAGTCACAGTTGACAAGCAAGGG - Intronic
999305421 5:150516214-150516236 ATTTCACAGAGGGAGAGCAAGGG - Intronic
999733564 5:154494672-154494694 TTGCCACTGTAGAAGAGCCAAGG + Intergenic
1000135062 5:158340013-158340035 ATGTTACAGAAGAAGGGCATAGG - Intergenic
1000547341 5:162619617-162619639 CTATCACAGTAGCAGAGCCATGG - Intergenic
1002968393 6:1990370-1990392 AGGTCACAGTGGAAGGCCAAAGG - Intronic
1002992115 6:2247386-2247408 GTGTGACAGTAGAAGAAAAATGG + Intergenic
1003141092 6:3471906-3471928 TAGTCACAGTAGAAGAGGGAAGG + Intergenic
1003540584 6:7014912-7014934 ATCTCACTGTACAAAAGCAAGGG - Intergenic
1004664685 6:17739159-17739181 AGGTCAGAGTGGAAGATCAAGGG - Intergenic
1005819423 6:29585361-29585383 ATCTCACAGCCAAAGAGCAAAGG - Intronic
1006107590 6:31725727-31725749 GTGTCCCAGAAGAAGAGAAAGGG - Intronic
1009446725 6:63751335-63751357 ATGGTACAGTAGAAGAGCTGTGG - Intronic
1009568913 6:65354954-65354976 ATGTCTCAGTATAAAAGTAATGG - Intronic
1010090863 6:71980073-71980095 ATGACTCTGTAGAAGAGCAGAGG - Intronic
1012150439 6:95743747-95743769 CTGTGACAGCAGAATAGCAATGG + Intergenic
1014598411 6:123375172-123375194 TTGTCACATTCCAAGAGCAATGG + Intronic
1015098899 6:129451142-129451164 ATGGCAAAGCAGATGAGCAATGG - Intronic
1018642825 6:165920473-165920495 ATGCCACAGTATAAGACCAATGG - Intronic
1019424142 7:965529-965551 ATGTCACAGCAGAACGGCAGAGG - Intronic
1021606917 7:22417662-22417684 AAGTTACAGGAGAAAAGCAATGG - Intergenic
1022314716 7:29234691-29234713 TTGCCACAGTAGATGAGAAATGG - Intronic
1023883771 7:44336208-44336230 GTGTCACAGGAGGAGAGAAAAGG + Intergenic
1024448742 7:49513660-49513682 ATTTCACAGCAGAGGAGCCAAGG - Intergenic
1027624490 7:80529474-80529496 ATGTGAGAGAATAAGAGCAAGGG - Intronic
1028157767 7:87450813-87450835 ATGTTTCAGGAGAAAAGCAAAGG + Intronic
1028210826 7:88072508-88072530 ATGTGACAGTGAGAGAGCAAGGG + Intronic
1029680340 7:102104210-102104232 GTGTCAGAGTTGAAGAGCTAAGG + Intronic
1030070509 7:105693892-105693914 ACATCACAGGAGAAGAGCAAAGG + Intronic
1030937826 7:115607485-115607507 ATGTCAGATTAGAAGTGCTATGG - Intergenic
1031175802 7:118347785-118347807 ATGGGACAGGAGAAAAGCAAAGG + Intergenic
1031443485 7:121822390-121822412 ATGACACAGGAAAGGAGCAATGG - Intergenic
1033253742 7:139781328-139781350 ATGTCACTGAAGGAGAGCATGGG + Intronic
1034869887 7:154674712-154674734 ATGTGACAGATGAAGAGCAGTGG + Intronic
1035840232 8:2803958-2803980 ATATCACAGTAAAGTAGCAAAGG - Intergenic
1036158122 8:6361375-6361397 CTGTAACTGCAGAAGAGCAAAGG + Intergenic
1036773835 8:11596648-11596670 ATGCCACAGAAAAAGAGCATGGG - Intergenic
1037284674 8:17286349-17286371 TTGCCACTGTAGAAGAGCCAAGG + Exonic
1040666331 8:49638685-49638707 ATGTCAAGGGAGAAAAGCAAGGG - Intergenic
1048445435 8:134489482-134489504 ATGGCCCAGGAGAGGAGCAAGGG - Intronic
1049539013 8:143198128-143198150 ATGCCACAGTGGAAGAGCTTTGG - Intergenic
1050234943 9:3567853-3567875 ATTTGACAGTAGAAGAGTTATGG - Intergenic
1051134912 9:13909133-13909155 ATGCTTCAGTGGAAGAGCAAGGG + Intergenic
1051406699 9:16745239-16745261 ATTTCAAAGTAGAAGACCACAGG + Intronic
1051425181 9:16925106-16925128 CTGTCACAGAAGAAGACCAAAGG + Intergenic
1051714342 9:19965749-19965771 ATGTGACAGTAGCAGAACACTGG - Intergenic
1051925405 9:22318781-22318803 AAGTCACATGAGAAAAGCAAGGG + Intergenic
1053440209 9:38109794-38109816 ATGCCACAGAAGAAGCGCAAGGG + Intergenic
1054761580 9:69009546-69009568 ATGGCAGAGAAAAAGAGCAATGG + Intergenic
1054890987 9:70251421-70251443 ATGTCAAATTAGTAGAGTAATGG + Intergenic
1056022654 9:82456651-82456673 ATGTAACATAAAAAGAGCAAAGG + Intergenic
1056498600 9:87185833-87185855 GTAGCACAGTAGAACAGCAAGGG + Intergenic
1056729674 9:89154862-89154884 AAGTCAAAGGAAAAGAGCAAAGG + Intronic
1058871011 9:109201756-109201778 AGGTCTCAGTGGAAGAGCAGAGG + Intronic
1059582243 9:115564695-115564717 GTGAGAAAGTAGAAGAGCAATGG + Intergenic
1059992865 9:119881692-119881714 ATGACACAGTGGCAGAGCTAGGG + Intergenic
1060754314 9:126201351-126201373 ATGACCCACTAGAAGAGCTAAGG + Intergenic
1186140098 X:6562676-6562698 TTGTCACAGTTGAGGAGAAAAGG + Intergenic
1187255201 X:17635868-17635890 ATGCCTCAGAAGGAGAGCAAAGG - Intronic
1187434495 X:19254840-19254862 ATGGCAGAGTTGAATAGCAATGG - Intergenic
1188768049 X:34121412-34121434 ATGTGACAGTAGAAGAGGTAGGG - Intergenic
1188985271 X:36763363-36763385 ATGTCTTAGTAGAAGAAAAATGG - Intergenic
1189139519 X:38587071-38587093 ATGTCACAACTGAAGAGGAAAGG + Intronic
1192396474 X:70786782-70786804 ATGTCACATTAACAGAGTAAAGG + Intronic
1193363457 X:80602557-80602579 ATGACGCAGGAGAATAGCAAGGG - Intergenic
1197140584 X:123113516-123113538 ATTTAACAGTAGAAAAGTAAGGG + Intergenic
1198868753 X:141153971-141153993 ATGTCTCAGTAGAAGTTCGAAGG + Intergenic
1200296839 X:154928528-154928550 ATGTCACAAGAGCAGAGCAAAGG + Intronic
1200328014 X:155263276-155263298 ATGCTACAATAGAAAAGCAAAGG + Intronic
1202104091 Y:21343730-21343752 ATCTCAGAGCAGAGGAGCAAAGG + Intergenic