ID: 1128036005

View in Genome Browser
Species Human (GRCh38)
Location 15:64527213-64527235
Sequence CTAGTTTGCCAGGTATTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128036003_1128036005 19 Left 1128036003 15:64527171-64527193 CCTTCATTCATGCTTTCTGTTCA 0: 1
1: 0
2: 1
3: 47
4: 468
Right 1128036005 15:64527213-64527235 CTAGTTTGCCAGGTATTTTGAGG 0: 1
1: 0
2: 1
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128036005 Original CRISPR CTAGTTTGCCAGGTATTTTG AGG Intronic
902458621 1:16554364-16554386 CAAGGTTACCAAGTATTTTGAGG + Intergenic
902493536 1:16853552-16853574 CAAGGTTACCAAGTATTTTGAGG - Intronic
903151806 1:21415124-21415146 CAAGGTTACCAAGTATTTTGAGG + Intergenic
904544491 1:31257933-31257955 ATAGTTTGTTAGATATTTTGGGG - Intergenic
904646983 1:31975152-31975174 CTAGCTTGCAAGGTATTGTGAGG - Intergenic
905913921 1:41672173-41672195 ATGGTTTGCCAGGTCCTTTGGGG + Intronic
906265539 1:44425975-44425997 CTATTTTTCTAGGTGTTTTGGGG + Intronic
907003383 1:50885725-50885747 CTTGTTTTCCAGTTGTTTTGTGG + Intronic
909135056 1:71787585-71787607 CTAATTTCACAGATATTTTGAGG - Intronic
909439029 1:75677580-75677602 TTAGTTTTCCAGTTGTTTTGTGG - Intergenic
910667815 1:89743134-89743156 CTAGTTGGGGAGGTATTTTGGGG + Intronic
911224562 1:95291026-95291048 CAAGTTTGCCAGGTACTCAGGGG - Intergenic
912605099 1:110981912-110981934 CTATTTTGCCTAGTGTTTTGGGG + Intergenic
913137509 1:115906843-115906865 CTGGTTTTCCAGGTATTGTGTGG + Intergenic
913988313 1:143585605-143585627 CAAGTTTACCAAGTGTTTTGAGG + Intergenic
915948092 1:160168864-160168886 CTAGTCTGACAGGAATTCTGTGG + Intronic
918286558 1:183061146-183061168 CTGGTTTGCCAGAGTTTTTGTGG - Intronic
918663520 1:187118646-187118668 CCAAGTAGCCAGGTATTTTGAGG + Intergenic
921966357 1:221094680-221094702 CTCGTGAGCCAGGTATTTTCAGG - Intergenic
922012339 1:221602592-221602614 TTAGATTGCCATGTATTTGGGGG - Intergenic
922018703 1:221681243-221681265 CTAATTTTCCTGATATTTTGTGG + Intergenic
922019549 1:221689590-221689612 CTGTTTTTCCAGGTATTTGGAGG + Intergenic
923440632 1:234016782-234016804 CTAGTCTGCCAAGTAGTCTGTGG + Intronic
924191513 1:241557633-241557655 CCAGTTTGCTAGGTATATTCAGG + Intronic
924306891 1:242698715-242698737 CTAGTTTGCCAGGGGCTCTGGGG - Intergenic
1063723058 10:8604130-8604152 GTAGTTTGCAAGGCACTTTGGGG - Intergenic
1071936227 10:90533671-90533693 CACATTTGCCAGGTAGTTTGTGG + Intergenic
1073714603 10:106089592-106089614 TTACTTTGCCTGCTATTTTGAGG - Intergenic
1073921020 10:108459432-108459454 CTAGTGGGCCAGGGAATTTGAGG - Intergenic
1076083325 10:127603333-127603355 CTAGTGTGCCAGGAACTGTGAGG - Intergenic
1076084051 10:127609712-127609734 CTAGTTTGCAAGTTCTTTTTGGG - Intergenic
1076808591 10:132873648-132873670 CTAGATTGCCTGGAATTCTGAGG - Intronic
1079333687 11:19553232-19553254 CTAGATTTCCAGGAATTTTGGGG - Intronic
1079634874 11:22724836-22724858 CTAGAGTTCCAGGGATTTTGTGG - Intronic
1084864545 11:72045127-72045149 CTAGTGTGCTAGGTGTTATGGGG - Intronic
1085481434 11:76825771-76825793 CTAGTTTTTCAGGTTTTTGGGGG - Intergenic
1085979414 11:81705524-81705546 CTTGTTTTCCAGGTTTTTGGGGG + Intergenic
1087445686 11:98249804-98249826 CTAGTTTTGCAGGTATTCTTTGG + Intergenic
1089572036 11:119417480-119417502 CTGCTTTGCCAGGGAATTTGGGG - Exonic
1093817123 12:23562362-23562384 CTAGTTTCCAAGGTTTTATGTGG - Intronic
1095338073 12:41052660-41052682 ATGGTTTGCCAGGTTCTTTGGGG - Intronic
1096260829 12:50089974-50089996 CTGGATTACCAGGTATTCTGTGG + Exonic
1100107053 12:91188391-91188413 CTATTTTGGCAGGTATATGGTGG - Intergenic
1107072894 13:36291051-36291073 CTAGTTTGTCAGGTTTCTTTGGG - Intronic
1109855596 13:68123085-68123107 ATAGCTTGCCTGGTATCTTGTGG + Intergenic
1110030299 13:70602969-70602991 ATTGTTTTCCAGGTTTTTTGGGG - Intergenic
1110577737 13:77079352-77079374 CTAGTTTGGCAAGTATCTTGGGG - Intronic
1111034784 13:82657932-82657954 CTAGTTTTTCAGGTATCTTTGGG + Intergenic
1112549708 13:100408317-100408339 AAAGTTTGCTAAGTATTTTGAGG - Intronic
1114466872 14:22929271-22929293 CTAGTGTGTCAGCTATTTCGGGG + Exonic
1115166809 14:30457673-30457695 TAAATTTGCCAAGTATTTTGGGG - Intergenic
1117858740 14:60065827-60065849 CTAGCTTACCAGGTTGTTTGTGG - Intergenic
1119451233 14:74712813-74712835 CTGGTTTGCCCAGTAGTTTGGGG - Intronic
1121177789 14:91904183-91904205 CTAGTATGCCAGGCACTGTGTGG - Intronic
1122190800 14:100041772-100041794 ATATTTTTCCAGGTATTTTTTGG + Intronic
1124574786 15:30897449-30897471 ATTGTTTGCCAGGGATTTGGAGG - Intergenic
1125183813 15:36908324-36908346 CTGGTTTGCTAGGTCTCTTGTGG - Intronic
1128036005 15:64527213-64527235 CTAGTTTGCCAGGTATTTTGAGG + Intronic
1130547689 15:84868705-84868727 CTAGGTTGCCAGGCACTTGGAGG - Exonic
1133693947 16:8242962-8242984 TTAGTTTGCCAGGTAATTTGAGG + Intergenic
1133866082 16:9644609-9644631 CTCGTTTTCCAGATATATTGTGG - Intergenic
1138064932 16:53930958-53930980 CTGATTTGACAGATATTTTGTGG + Intronic
1140544131 16:75790025-75790047 GGAGTGTGCCAGGCATTTTGAGG - Intergenic
1148402171 17:47374672-47374694 CTTATTTGCCAAGTATTTTTTGG - Exonic
1148824473 17:50382353-50382375 CTAGTCTCCCAGCTAGTTTGAGG - Exonic
1153621898 18:6987128-6987150 CAAGTTTACCAGGAAATTTGGGG - Intronic
1154401655 18:14043799-14043821 CTAGTTTTTCTGGTATTTTCTGG + Intergenic
1156084983 18:33387120-33387142 TTGTTTTCCCAGGTATTTTGTGG - Intronic
1156811864 18:41262580-41262602 CTAGTAGGCTAGGCATTTTGTGG + Intergenic
1157144093 18:45143518-45143540 TTAATTTGCCAGGCTTTTTGGGG + Intergenic
1159251760 18:65888403-65888425 GTAGTGTGTCAGGTCTTTTGAGG - Exonic
1159405101 18:67991479-67991501 CTAGATTGCAAGCTAATTTGAGG - Intergenic
1159567397 18:70067813-70067835 CTAATGAGCCAGGTATTTAGTGG - Intronic
1165716650 19:38050110-38050132 CTATATTGTAAGGTATTTTGAGG + Intronic
926748616 2:16180739-16180761 ATCGTTTGGCAGTTATTTTGGGG - Intergenic
927068494 2:19498504-19498526 CTAGGTTAACAGGTAGTTTGGGG + Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
928282169 2:29957337-29957359 CCAGTTTGATATGTATTTTGGGG + Intergenic
930023118 2:47013268-47013290 CTTGGTTCCCAGGTCTTTTGGGG + Intronic
930337960 2:50074097-50074119 ATAGGTTGCCAGATTTTTTGAGG + Intronic
934743169 2:96740447-96740469 ATAGTTTTCCAGCTATTTTACGG - Intergenic
938645027 2:133321369-133321391 GTAGGTTGCAAGGTATTTTTAGG - Intronic
941305720 2:163863396-163863418 CTAAATTTCCAAGTATTTTGTGG + Intergenic
941748268 2:169109965-169109987 CTGGGATCCCAGGTATTTTGTGG - Intergenic
943586238 2:189743927-189743949 GAAGTTTGCCAGGTATTCAGAGG + Intronic
947410704 2:229836044-229836066 ATAGTTTGCCAGGAAGGTTGTGG - Intronic
947621690 2:231594902-231594924 CTAGTTTGCCTGGGGTTTTCCGG - Intergenic
947849425 2:233273436-233273458 TTAGTTAGCCAGGAATTGTGAGG + Intronic
948378400 2:237537135-237537157 CTTGTTTGCCAGGGATTTCCAGG - Intronic
1168855705 20:1006144-1006166 CTGGTTTGCCAGGGATTGAGGGG + Intergenic
1169534105 20:6518453-6518475 TTAGTATGCCAGATATTTGGTGG - Intergenic
1169915435 20:10678088-10678110 TTGATTTGCCAGGTATTTTGTGG + Intergenic
1170762744 20:19265181-19265203 CAGGCTAGCCAGGTATTTTGGGG + Intronic
1175138915 20:56845132-56845154 CTGGTTTGCCAGGTGTTGAGGGG + Intergenic
1178770899 21:35503024-35503046 CTTGGTTGCCAGGGATTTGGAGG - Intronic
953167246 3:40476423-40476445 CTAGATTGCCAGGTTTTCTTTGG + Intergenic
953252744 3:41261487-41261509 CAACTTTGCCAGGTACTTAGTGG - Intronic
957028014 3:75207013-75207035 GTAGTGTGCAAGGTATGTTGAGG - Intergenic
962234892 3:133699439-133699461 CTTGTTTGCCAGGTTCTCTGGGG - Intergenic
964102025 3:152998391-152998413 GTATTTTGCCAGTTGTTTTGGGG - Intergenic
967091813 3:186141116-186141138 CCGGATTGCCAGGTATATTGTGG + Intronic
968725279 4:2244898-2244920 GTAGTTTTCCATGAATTTTGTGG + Intergenic
973275212 4:48299856-48299878 CTTAATTGCCAGCTATTTTGGGG + Intergenic
974633903 4:64533490-64533512 CTACTTTTTCAGGTTTTTTGGGG + Intergenic
977279495 4:95021955-95021977 CTATTTAGCAAGCTATTTTGAGG - Intronic
977663142 4:99614286-99614308 TTTGTTTGCCAGATAATTTGAGG + Intronic
978175642 4:105728940-105728962 CTAGTATGAGTGGTATTTTGGGG + Intronic
980508483 4:133755106-133755128 CTAGGATTCCAGGTATTTTTTGG + Intergenic
983807978 4:172018469-172018491 ATAGTTTGCCAGGGAAGTTGGGG + Intronic
986177780 5:5366536-5366558 TTAGTTTGACAGGTATCATGAGG - Intergenic
986362378 5:6992935-6992957 CTAGTTTGGCAAGCATTTTTTGG + Intergenic
986422982 5:7602669-7602691 CTAGTTTGCCAGTTTATTTAAGG + Intronic
986723633 5:10578170-10578192 CTAGTTTGCCTGGGACTTTCCGG + Intronic
987781838 5:22447781-22447803 CTTGTTTTCCAGATATGTTGTGG - Intronic
988696969 5:33631800-33631822 CTTCTTTGGCAGGGATTTTGGGG + Intronic
993841758 5:92889144-92889166 CTAGTTTGTCATATTTTTTGTGG + Intergenic
994976230 5:106810758-106810780 CTATTTTGACAGGTATATAGTGG + Intergenic
998296933 5:140979852-140979874 ATAGTTGCCCAGATATTTTGAGG - Intronic
1000032314 5:157413953-157413975 TTAGTTTGCTTAGTATTTTGAGG - Intronic
1000761445 5:165230217-165230239 CTAGTTTTCCAGATACTTTGGGG + Intergenic
1000776611 5:165427317-165427339 CTAGTAGGCCAGAAATTTTGAGG + Intergenic
1003337423 6:5187026-5187048 CTCGTTTGTCATTTATTTTGGGG - Intronic
1006215628 6:32440128-32440150 ATAGTGTGACAGGTATTATGTGG + Intronic
1007443599 6:41886562-41886584 CTAGAATGCCAGGTAATTTATGG - Intronic
1007876709 6:45111432-45111454 CTAGTTTGCCTGGGATTGAGGGG + Intronic
1008192697 6:48479590-48479612 CTTGTATACCAAGTATTTTGAGG - Intergenic
1013772464 6:113643021-113643043 CTAGCTTAGCTGGTATTTTGGGG - Intergenic
1014099745 6:117498738-117498760 CTTTTTTGCCAGGTATTTTAAGG + Intronic
1014106752 6:117573105-117573127 ATAATTTGGCAGATATTTTGGGG - Intronic
1015166595 6:130206299-130206321 GTCGTATGCCAGGTAGTTTGAGG + Intronic
1016131183 6:140473942-140473964 TAAATTTTCCAGGTATTTTGGGG - Intergenic
1016178928 6:141119713-141119735 CTAGTATGCCAGGCCTTCTGAGG + Intergenic
1017217660 6:151928780-151928802 ATAGTTTACCATTTATTTTGAGG + Intronic
1017691097 6:156965714-156965736 GTAGTTTGCTAATTATTTTGGGG + Intronic
1018254912 6:161908382-161908404 CCAGATTGCCAGTTACTTTGAGG + Intronic
1018991840 6:168679705-168679727 CTAGTTTGTCAGGTTTCTTTGGG - Intergenic
1020208617 7:6140156-6140178 CTTGTTTGTCAGATATTTGGAGG + Exonic
1022817027 7:33923613-33923635 CCACTGTGCCAGGTATTTTAGGG - Intronic
1024209298 7:47190218-47190240 CTACATTTCCAGTTATTTTGGGG - Intergenic
1026626746 7:71999976-71999998 TTAATTTTCCAGGTATTTAGAGG - Intronic
1027758429 7:82247062-82247084 CTACTTTTCTAGGTCTTTTGGGG + Intronic
1027763551 7:82309486-82309508 CTGGTTAGCCAGGTAATTTAAGG + Intronic
1031495382 7:122440972-122440994 CTTGTTTGCTGGTTATTTTGTGG + Intronic
1031951507 7:127897400-127897422 GTATTTTATCAGGTATTTTGGGG + Intronic
1035136515 7:156708898-156708920 ATAGTTTGCCAGGGAAGTTGGGG - Intronic
1037111151 8:15165431-15165453 AAGGTTTGCCAGGTGTTTTGAGG + Intronic
1037598839 8:20376578-20376600 CTAGTTTTTCAGGTTTATTGGGG - Intergenic
1040776350 8:51048108-51048130 TTAGTAGGCCAGGTATTTTCTGG + Intergenic
1041136332 8:54763042-54763064 CTAGGTGGCCATGAATTTTGGGG + Intergenic
1042165500 8:65942038-65942060 GTATTTTGCCAGGTTTTTTGTGG + Intergenic
1043313854 8:78895663-78895685 CAAGTTTGTCAGGTTTTGTGGGG - Intergenic
1047842358 8:128766937-128766959 ATAGTTTGCCAGGGAATTGGGGG - Intergenic
1051128008 9:13826712-13826734 CTAATTTCCCATGTATATTGAGG - Intergenic
1051178493 9:14385259-14385281 CAAGTTTGCCAGTTACTATGCGG - Intronic
1055823625 9:80298106-80298128 CTAGTTTTCCTGATATTTTCTGG + Intergenic
1058190257 9:101905720-101905742 CTAGTTTGGTAGGTTTTCTGTGG + Intergenic
1058608309 9:106747305-106747327 CTGGTTTGCCAGGCCTTTTTAGG + Intergenic
1061357386 9:130116759-130116781 CTAGCTTTCCTGGTATTGTGTGG + Intronic
1186328523 X:8507230-8507252 CTAGTTTTCCAGGTAAATTTTGG + Intergenic
1188694053 X:33166574-33166596 CTACTTTTTCAGGTATTGTGGGG + Intronic
1189706736 X:43766348-43766370 TTATTTTGGCAGGTATTTTTTGG + Intergenic
1189745843 X:44168141-44168163 TTAGTCTCCCAGGAATTTTGTGG - Intronic
1190414815 X:50170512-50170534 CATATTGGCCAGGTATTTTGGGG - Intergenic
1195204541 X:102583454-102583476 TTATTTTGGAAGGTATTTTGTGG - Intergenic
1195495485 X:105527676-105527698 CCAATTTGCCATGTATTTAGTGG - Intronic
1201433780 Y:13933699-13933721 CTAGTTTTCCAGGTAAATTTTGG - Intergenic