ID: 1128037639

View in Genome Browser
Species Human (GRCh38)
Location 15:64540690-64540712
Sequence TACCGTGTCCGGCCACAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128037635_1128037639 9 Left 1128037635 15:64540658-64540680 CCTGCCAAAGTGCTGGGATTACA 0: 1385
1: 300740
2: 267229
3: 151284
4: 133139
Right 1128037639 15:64540690-64540712 TACCGTGTCCGGCCACAGATAGG 0: 1
1: 0
2: 0
3: 13
4: 90
1128037631_1128037639 22 Left 1128037631 15:64540645-64540667 CCGCACGCCTCGGCCTGCCAAAG 0: 3
1: 353
2: 42909
3: 130498
4: 201786
Right 1128037639 15:64540690-64540712 TACCGTGTCCGGCCACAGATAGG 0: 1
1: 0
2: 0
3: 13
4: 90
1128037633_1128037639 15 Left 1128037633 15:64540652-64540674 CCTCGGCCTGCCAAAGTGCTGGG 0: 424
1: 119266
2: 267211
3: 214152
4: 127088
Right 1128037639 15:64540690-64540712 TACCGTGTCCGGCCACAGATAGG 0: 1
1: 0
2: 0
3: 13
4: 90
1128037637_1128037639 5 Left 1128037637 15:64540662-64540684 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 1128037639 15:64540690-64540712 TACCGTGTCCGGCCACAGATAGG 0: 1
1: 0
2: 0
3: 13
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128037639 Original CRISPR TACCGTGTCCGGCCACAGAT AGG Intronic
908632832 1:66129367-66129389 CACCGCGCCCGGCCACAGAGAGG - Intronic
909581920 1:77246440-77246462 CACCGTGCCCGGCCTCACATTGG - Intergenic
912817794 1:112843482-112843504 TACCGCGCCCGGCCCCAGATTGG - Intergenic
921562308 1:216673239-216673261 TACCGTATTTGGCCACAGAAAGG + Intronic
1066243027 10:33556276-33556298 TACAATGTCCTGACACAGATTGG - Intergenic
1067090938 10:43265654-43265676 AACCGTGTCAGTCTACAGATGGG + Intronic
1069382175 10:67852378-67852400 CACCGTGCCCAGCCCCAGATAGG - Intergenic
1070129314 10:73646110-73646132 CACCGTGCCCGGCCTCAGATTGG + Exonic
1071066981 10:81647415-81647437 CACTGTGCCCAGCCACAGATGGG - Intergenic
1073876315 10:107926178-107926200 TACCGTGCCCGGCCAAAAGTAGG + Intergenic
1101856821 12:108450665-108450687 CACCGTGCCTGGCCACAAATTGG + Intergenic
1105780158 13:23698733-23698755 CACCGTGCCCGGCCCCAGCTAGG + Intergenic
1108114034 13:47108558-47108580 CACCGTGCCCGGCCACATCTGGG + Intergenic
1110259967 13:73474039-73474061 CACCGTGTCCGGCCTTAGAGTGG + Intergenic
1112277741 13:98036673-98036695 CACTGTGCCCGGCCACAGCTAGG - Intergenic
1112747295 13:102541147-102541169 TACCGCGCCCGGCCACAGCAGGG - Intergenic
1125948465 15:43730123-43730145 TATCGTGCCCAGCCGCAGATGGG - Intergenic
1127915362 15:63450776-63450798 CACCGTGCCCGGCCCCACATGGG + Intergenic
1128037639 15:64540690-64540712 TACCGTGTCCGGCCACAGATAGG + Intronic
1128149384 15:65353536-65353558 CACCGTGCCCGGCCTCAGATGGG + Intronic
1129650644 15:77485643-77485665 CACCGTGCCCGGCCAGAGGTAGG - Intergenic
1130291462 15:82605748-82605770 CACTGTGCCCGGCCACAAATAGG - Intronic
1132418454 15:101642687-101642709 AACCGTGACTGGCCACAGCTGGG - Intronic
1133237480 16:4394155-4394177 CACCGTGTCCGGCCACCATTAGG - Intronic
1136851061 16:33612804-33612826 CACCGTGCCCGGCCTCACATGGG - Intergenic
1137584138 16:49653952-49653974 CACTGTGTCTGGCCACAGAAAGG - Intronic
1139893396 16:70269033-70269055 CACCGTGCCCGGCCAGAGGTGGG - Intronic
1140305009 16:73794720-73794742 TACCTTTTCCTGCAACAGATGGG + Intergenic
1141586913 16:85040120-85040142 CACCGTGCCCGGCCAGAGAAGGG + Intronic
1142191938 16:88722123-88722145 GACTGTGACCGGCAACAGATCGG - Intronic
1142594462 17:1022776-1022798 TACCCAGGCCAGCCACAGATAGG + Intronic
1144395780 17:14841885-14841907 CACCGCGCCCGGCCACATATGGG + Intergenic
1146282156 17:31551622-31551644 CACCGTGCCCGGCCAAACATTGG + Intergenic
1151818506 17:76483971-76483993 CACCGCGCCCGGCCACAGCTGGG - Intronic
1157338643 18:46758779-46758801 CACCGCGCCCGGCCACAGGTAGG + Intronic
1158465543 18:57686705-57686727 CACTGTGCCCGGCCAGAGATGGG + Intronic
1158607022 18:58904729-58904751 TATCATCTCCGGCCACAGACTGG + Intronic
1159606069 18:70476724-70476746 CACCGTGCCCGGCCTCAGAATGG - Intergenic
1160130950 18:76224428-76224450 GACCGTGTCTGGACACATATGGG - Intergenic
1162136173 19:8556597-8556619 CACTGTGCCCGGCCCCAGATTGG - Intronic
1162137558 19:8565059-8565081 CACTGTGTCCGGCCAGAGACAGG + Intronic
1164312507 19:24058694-24058716 CACCGTGCCCGGCCAGTGATGGG + Intronic
1166915665 19:46194531-46194553 CACCGTGTCCGGCCCTTGATTGG - Intergenic
927505736 2:23613475-23613497 CACCGTGCCCGGCCAAGGATGGG - Intronic
928166867 2:28978193-28978215 CACCGTGCCCGGCCGGAGATGGG + Intronic
929746534 2:44665357-44665379 CACCGTGCCCGGCCTCAGAGAGG + Intronic
937947956 2:127358642-127358664 TACTGTGCCCAGCCTCAGATTGG - Intronic
938280577 2:130061031-130061053 TACCATGTCCGGCCACTAGTTGG - Intergenic
938280772 2:130062204-130062226 TACCATGTCCGGCCACTAGTTGG - Intergenic
938280878 2:130062838-130062860 TACCATGTCCGGCCGCTGGTGGG - Intergenic
938357744 2:130665731-130665753 TACCATGTCCGGCCACTAGTTGG + Intergenic
941979290 2:171437060-171437082 CACCGCGTCCAGCCACAGAGAGG + Intronic
943151343 2:184116958-184116980 CACTGTATCCGGCCACACATGGG + Intergenic
1172007598 20:31828174-31828196 CACCGTGCCTGGCCACAGATAGG + Intronic
1172569233 20:35956007-35956029 CACCGTGCCGGGCCACAAATAGG + Intronic
1172722475 20:37010226-37010248 CACCATGTCCGGCCAGAAATGGG + Intronic
1175244184 20:57571672-57571694 CACCGTGCCCGGCCAGAAATGGG + Intergenic
1178767545 21:35468587-35468609 CACCATGTCCGGCCATATATCGG - Intronic
1180215946 21:46323981-46324003 TACGCTCGCCGGCCACAGATTGG - Intergenic
1181549610 22:23629903-23629925 CACCGTGCCCGGCCATGGATTGG + Intronic
1181799016 22:25332071-25332093 CACCGTGCCCGGCCATGGATTGG - Intergenic
1182734981 22:32526805-32526827 TACCGCGCCCGGCCTCTGATAGG + Intronic
1183465217 22:37976860-37976882 TACCGTGTCTGGCCATGGATGGG - Intronic
1184751637 22:46489622-46489644 CACCGTGCACGGCCAAAGATGGG - Intronic
953648699 3:44779544-44779566 CACCGTGCCCAGCCACAAATAGG - Intronic
953954724 3:47222621-47222643 CACCGTGCCCGGCCAGAGATTGG + Intergenic
955241859 3:57185555-57185577 CACCGTGCCCGGCCGGAGATTGG - Intergenic
966202797 3:177375222-177375244 CACCGCGTCCGGCCACAAAGAGG + Intergenic
973946447 4:55961474-55961496 CACCGTGCCCGGCCAAAGATGGG - Intronic
975932368 4:79540332-79540354 GACAGTTTCCAGCCACAGATTGG - Intergenic
978837030 4:113163474-113163496 CACCGTGCCCGGCCAAAGCTTGG - Intronic
980054625 4:128067665-128067687 TACCAAGTCAGGACACAGATGGG - Intronic
980630557 4:135425844-135425866 CACCGTGCCCGGCCCCAAATTGG + Intergenic
983214902 4:164993599-164993621 CACCATGCCCGGCCAGAGATGGG + Intergenic
983554394 4:169046836-169046858 CACCGTGCCCAGCCACACATGGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
988983594 5:36595872-36595894 TACAGTGTCCGGCCAAAACTGGG - Intergenic
1002931731 6:1639597-1639619 CACCGTGCCCGGCCTCAGCTTGG - Intronic
1002980421 6:2130556-2130578 TATTGTGTCTGGCCACAGAGCGG - Intronic
1011427166 6:87241706-87241728 CACCGTGTCCGGCCAGAGCTTGG + Intronic
1017015202 6:150094322-150094344 CACCGCGCCCGGCCACAGAGGGG - Intergenic
1021380734 7:19962672-19962694 CACCGTGTCCAGCCCAAGATAGG + Intergenic
1023374941 7:39546655-39546677 CACAGTGCCCGGCCACAGATAGG + Intergenic
1025837048 7:65104075-65104097 TACCGTGTCCGGCCATAGTAAGG + Intergenic
1025906830 7:65793584-65793606 TACCGTGTCTGGCCATAGTAAGG + Intergenic
1027194112 7:76017309-76017331 CACCGTGCCCGGCCCCAGATTGG + Intronic
1028882906 7:95900079-95900101 TGCCTTTTCCGGCCACAGCTTGG + Intronic
1029688818 7:102166892-102166914 CACCGTGACCGCCAACAGATGGG + Intronic
1030069703 7:105688251-105688273 CACCGTGTCCGTCCCCAGTTGGG - Intronic
1032235751 7:130120907-130120929 CACCATGACTGGCCACAGATTGG - Intronic
1035600101 8:892296-892318 TAGCGTGTCCGTCCATGGATGGG + Intergenic
1037986236 8:23292314-23292336 CACCGTGCCCAGCCACAGAAAGG - Intronic
1038869733 8:31481154-31481176 CACCGTGCCCGGCCACAGCTTGG - Intergenic
1044431204 8:92109332-92109354 CACCGTGTCCGGCCAAAAGTAGG + Intergenic
1047325705 8:123834037-123834059 TACCATGTCCAGCCACTGGTGGG + Intergenic
1047440469 8:124872987-124873009 TACCGTCTCTGGCTCCAGATAGG + Intergenic
1049771743 8:144385673-144385695 CACCATGCCCGGCCACATATAGG - Intronic
1056560590 9:87726206-87726228 GTCCCTGTCCGGCCACAGCTGGG - Exonic
1058050970 9:100406147-100406169 TACCGCGCCCGGCCACTGTTTGG + Intergenic
1061403328 9:130380378-130380400 AACTGTGTCCTGCCAGAGATGGG + Intronic
1061856494 9:133444579-133444601 TACCGTGCCTGGCCAGGGATAGG + Intronic
1062215943 9:135389919-135389941 AACCGTGTCCCGCCACTGACAGG + Intergenic
1062593373 9:137285317-137285339 CACCGTGTCCGGCCCCACATTGG + Intergenic
1185577854 X:1187828-1187850 CACTGTGACCGGCCACAGCTTGG + Intronic