ID: 1128046126

View in Genome Browser
Species Human (GRCh38)
Location 15:64618963-64618985
Sequence CCGTGGACACAGGCCCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128046119_1128046126 20 Left 1128046119 15:64618920-64618942 CCAACATTTGGGCGGGAAAACAA 0: 1
1: 1
2: 0
3: 9
4: 109
Right 1128046126 15:64618963-64618985 CCGTGGACACAGGCCCCTGATGG 0: 1
1: 0
2: 1
3: 14
4: 160
1128046122_1128046126 -8 Left 1128046122 15:64618948-64618970 CCTATCTACCTAGGTCCGTGGAC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1128046126 15:64618963-64618985 CCGTGGACACAGGCCCCTGATGG 0: 1
1: 0
2: 1
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128046126 Original CRISPR CCGTGGACACAGGCCCCTGA TGG Intronic