ID: 1128046126

View in Genome Browser
Species Human (GRCh38)
Location 15:64618963-64618985
Sequence CCGTGGACACAGGCCCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128046122_1128046126 -8 Left 1128046122 15:64618948-64618970 CCTATCTACCTAGGTCCGTGGAC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1128046126 15:64618963-64618985 CCGTGGACACAGGCCCCTGATGG 0: 1
1: 0
2: 1
3: 14
4: 160
1128046119_1128046126 20 Left 1128046119 15:64618920-64618942 CCAACATTTGGGCGGGAAAACAA 0: 1
1: 1
2: 0
3: 9
4: 109
Right 1128046126 15:64618963-64618985 CCGTGGACACAGGCCCCTGATGG 0: 1
1: 0
2: 1
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128046126 Original CRISPR CCGTGGACACAGGCCCCTGA TGG Intronic
901024856 1:6273860-6273882 CCGTTGCCACAGGCTCCTGCTGG - Intronic
901968956 1:12892340-12892362 TCTAGGACACAGGTCCCTGAAGG + Intronic
902016218 1:13309441-13309463 TCTAGGACACAGGTCCCTGAAGG - Intronic
908263174 1:62354310-62354332 GCGTGGCCACAGGGCACTGAGGG + Intergenic
913220223 1:116654236-116654258 CCCTGCACAGAGGCTCCTGAGGG + Intronic
914456661 1:147842874-147842896 TCTAGGACACAGGTCCCTGAAGG - Intergenic
914703228 1:150151543-150151565 CCGAGGTCACAGGGGCCTGACGG - Intronic
915249205 1:154576501-154576523 CCATGGTCACAGACCCCTGGGGG + Exonic
915901119 1:159847291-159847313 CCTGGCACTCAGGCCCCTGATGG - Intronic
917470882 1:175324826-175324848 ACGTGGACACAGGCCACTCATGG + Intronic
922909543 1:229204212-229204234 TCCTGCACACAGGCCCCTGTCGG - Intergenic
923260819 1:232266263-232266285 CAGGGGAGACAGGCCTCTGATGG - Intergenic
1062801511 10:384764-384786 CCATGCACACAGGCCCCTGGAGG + Intronic
1066334833 10:34465228-34465250 CCATGGACACAGAAGCCTGATGG + Intronic
1067085300 10:43234958-43234980 CCCTGGGCAGAGGCCACTGATGG + Intronic
1073538026 10:104295486-104295508 GTGGGAACACAGGCCCCTGAAGG - Intronic
1074485392 10:113872199-113872221 CCTTGGAGATAGGCCACTGAAGG + Intronic
1075684411 10:124353702-124353724 CTGTGGTCTCAAGCCCCTGAAGG + Intergenic
1076851431 10:133095327-133095349 CCCTGGACAGAGGCCCCTGAGGG - Intronic
1076875476 10:133213584-133213606 CCTTGGACACAAGGCCCTAAGGG + Intronic
1077454909 11:2672673-2672695 CAGTGGACACAGCCAGCTGATGG + Intronic
1077477308 11:2796588-2796610 ACCTGGACACAGGCCCCTTCGGG - Intronic
1077503468 11:2919605-2919627 CAGTGGACTCCGGCCTCTGATGG + Intronic
1078508553 11:11968979-11969001 CCCTAGACCCAGGACCCTGAGGG - Intronic
1079333568 11:19552449-19552471 CCGTGGCCACAGGGCCCAGCAGG - Intronic
1080639370 11:34149842-34149864 CGCTGGACACAGACCCATGAAGG + Intergenic
1082000916 11:47393363-47393385 CCCTGGACACAGGCCACAGAAGG - Intergenic
1083255380 11:61492168-61492190 ATGTGCACACAGACCCCTGAAGG + Intergenic
1083966628 11:66047589-66047611 CCCTGGACACCAGCCCCTGAAGG + Intronic
1084114963 11:67037254-67037276 CAGAGGACACAGTCCCTTGAAGG - Intronic
1084193323 11:67508776-67508798 CCATGGCAACAGGCCCCTCATGG + Intergenic
1084830238 11:71763237-71763259 CCGTGGGCACAGGCCTCGGGTGG - Intergenic
1091406814 12:214332-214354 CCGTGGGCACAGTCCCATGATGG + Intronic
1091692216 12:2605120-2605142 GCGAGTACTCAGGCCCCTGAGGG + Exonic
1097269543 12:57765684-57765706 CCGGGAACCCCGGCCCCTGAGGG - Intronic
1098034426 12:66287737-66287759 CCGTGGACACAGAGGTCTGAGGG + Intergenic
1100913562 12:99392184-99392206 CACTGGACACAGGCAGCTGAGGG - Intronic
1101512780 12:105407718-105407740 CCACAGACATAGGCCCCTGAAGG + Intergenic
1106540924 13:30689797-30689819 CCGTGGGTACAGGCCCCAGGGGG - Intergenic
1113791241 13:113029594-113029616 CCGGGGACACAGCACCCTCAGGG - Intronic
1113868879 13:113546143-113546165 GCGTGGACATAGGGCCGTGACGG + Intronic
1114572640 14:23684287-23684309 CAGGGGACACAGGGCCTTGAAGG + Intergenic
1119183098 14:72617567-72617589 CTGAGGCCACAGGCCCCTGCAGG + Intergenic
1120999561 14:90441899-90441921 CCGAGATCACAGGCCCCAGATGG + Intergenic
1121144884 14:91574778-91574800 CTGTGCTCAGAGGCCCCTGAGGG + Intergenic
1121282192 14:92706958-92706980 CCGTGGACACAGCACCCTCACGG - Intronic
1122652631 14:103233817-103233839 CCTGGGTCACAGGCCCCTGGGGG - Intergenic
1122772715 14:104104447-104104469 CTGTGGTCACAGCCCCCTGGAGG - Exonic
1122783228 14:104152518-104152540 ACGTGGACAGAGACCCCCGAAGG - Intronic
1128046126 15:64618963-64618985 CCGTGGACACAGGCCCCTGATGG + Intronic
1128443477 15:67736293-67736315 CAGTTGGCACATGCCCCTGAGGG + Intronic
1129459449 15:75693189-75693211 CCGTGGCCACAGGCACCTCCAGG + Exonic
1129685804 15:77685494-77685516 GTGTGCACACATGCCCCTGAAGG + Intronic
1129726423 15:77903903-77903925 CTGGGGACACAGGCCTGTGAAGG - Intergenic
1130274461 15:82469251-82469273 CTGGGGACACAGGCCTGTGAAGG - Intergenic
1130466808 15:84196625-84196647 CTGGGGACACAGGCCTGTGAAGG - Intergenic
1130497456 15:84476911-84476933 CTGGGGACACAGGCCTGTGAAGG + Intergenic
1130589103 15:85201218-85201240 CTGGGGACACAGGCCTGTGAAGG - Intergenic
1130664860 15:85861050-85861072 CCGTAGACACAGGGCCCTCAGGG - Intergenic
1130742774 15:86619053-86619075 CTCTGGCCACAGACCCCTGAGGG - Intronic
1130954793 15:88620037-88620059 CCTTTTACCCAGGCCCCTGAAGG - Intergenic
1132677799 16:1127792-1127814 CCTGGGACAGATGCCCCTGAGGG + Intergenic
1133322844 16:4924978-4925000 GTGTGGACACAGGTCCCTGCAGG + Intronic
1135429628 16:22372333-22372355 GCGTGGACTAAGGCACCTGATGG + Intronic
1135956189 16:26958369-26958391 CCGTGGCCACAGGGTCATGAGGG - Intergenic
1135992327 16:27225633-27225655 CCTTGGAGACAGGGCCCTGAAGG - Intronic
1138599177 16:58045121-58045143 ACGTGGAGCCAGGCCCCCGATGG + Exonic
1138659021 16:58507065-58507087 CCTTGCACACTGCCCCCTGAGGG + Intronic
1139170823 16:64627731-64627753 CCATGGCCACAGGCCCAGGATGG - Intergenic
1141808819 16:86360217-86360239 CTGGGGACACAGGCCCCTCCAGG + Intergenic
1142119767 16:88381506-88381528 CTGTGGACAAAGACCCCAGAGGG - Intergenic
1142469992 17:157952-157974 CCGTGGCCCCAGTTCCCTGAAGG + Intronic
1142470724 17:161862-161884 CCCTGGCCCCAGTCCCCTGAAGG - Intronic
1143106825 17:4534331-4534353 CCAGGGACACAAGCCCCTGCTGG - Intronic
1148131435 17:45264691-45264713 CAGTGCACACTGGCCCCTGATGG - Exonic
1148862627 17:50612575-50612597 CCAAGGACACAGGCCCCCCACGG - Intronic
1152105447 17:78326048-78326070 CTGGGGACACAGGGCCCTGTGGG - Intergenic
1152519553 17:80847197-80847219 CCGTGGGCACTGGCATCTGAAGG - Intronic
1152766060 17:82139762-82139784 CCATGGGCACAGGCTTCTGATGG + Intronic
1152849119 17:82621472-82621494 CCAGGTCCACAGGCCCCTGAGGG + Intronic
1160134543 18:76261362-76261384 CCGGAGACACAGGCCCCAGTGGG - Intergenic
1160285641 18:77540295-77540317 GCGTTGACACAGGGCTCTGAGGG + Intergenic
1160778861 19:869000-869022 CTGTGGACAGATGCCCCTGCCGG - Intronic
1160853893 19:1207323-1207345 CGGAGGACACAGGCGCCAGACGG - Intronic
1161681014 19:5679813-5679835 CCGTGGGCCTTGGCCCCTGAGGG - Intronic
1162926148 19:13931431-13931453 CCGTGGACAGAGCCCCCAAAGGG + Intronic
1165055607 19:33174435-33174457 CCATGGGCAGAGGCCCCTCAGGG - Intronic
1167265365 19:48480443-48480465 CCTTGGCCACAGGCACCTGCCGG + Intronic
1167556697 19:50200940-50200962 CCTAGGAAACAGGCCCCTGCAGG - Intronic
925572401 2:5325876-5325898 CCGTGGACACAGGCCTGGGGTGG + Intergenic
928462159 2:31485192-31485214 CCCTGGACACAGCCCCCAGGGGG - Intergenic
935664075 2:105494888-105494910 CCGTGGGCACAGGCCCCGGGTGG + Intergenic
936847516 2:116854472-116854494 CCGTGTACACAGTCTCCAGAAGG + Intergenic
937267291 2:120624594-120624616 GCGTGGCCACATGCCCCAGATGG + Intergenic
938380324 2:130832767-130832789 CAGGGGCCACAGGCCCGTGAAGG - Intergenic
938981487 2:136531610-136531632 ACGTGGACAAAGGACCCTGTAGG - Intergenic
946017726 2:216617464-216617486 CCGTGGACAAAGGTGCCTGCTGG - Intergenic
946213048 2:218162911-218162933 CCTTGGAGACAGGGCCCTGTCGG - Exonic
947112053 2:226729165-226729187 CTGTGGTCACAGGCTGCTGAGGG - Intergenic
947544408 2:231000920-231000942 CCTATGACACAGGCCACTGAGGG - Intronic
947718282 2:232352553-232352575 CCGCGGAGACAGGCTCCCGAGGG + Intergenic
948793607 2:240391438-240391460 CCCTGGACACAGACCCCCCAGGG + Intergenic
948909206 2:240994561-240994583 CCCCGGACCCAGGCACCTGAGGG - Intergenic
1169194971 20:3678066-3678088 CCCTGGCCACAGGCCCCACAAGG + Intronic
1171474951 20:25401337-25401359 CAGTGAACACAGGCCGCTAAAGG - Intergenic
1172229288 20:33326240-33326262 CAGTGGACCCAGGCCCCCTAGGG - Intergenic
1172305649 20:33878370-33878392 TCGTGGGCACAGGCCCCGGAGGG + Intergenic
1173163477 20:40669878-40669900 CTGTGGACACAGGCCCAGGAGGG + Intergenic
1174742174 20:53025768-53025790 CAGTGCACACAGGCCCCCAAAGG + Intronic
1175326320 20:58130980-58131002 CGATGTCCACAGGCCCCTGATGG + Intergenic
1175482664 20:59322428-59322450 CCTTTGACACAGGCCTCTGTTGG - Intronic
1175806849 20:61834288-61834310 CCTAGGCCACAGGCCCCAGAAGG - Intronic
1176217573 20:63955645-63955667 GCGTGGCCACCGCCCCCTGACGG + Intronic
1176228128 20:64015295-64015317 CCTTTGCCGCAGGCCCCTGAGGG + Intronic
1176868575 21:14070445-14070467 CCGTGGGCCCAGGGCCCTGAGGG + Intergenic
1179435323 21:41358618-41358640 CCCTGGGCAGAGGCCCCTCAGGG + Intergenic
1180821523 22:18832255-18832277 CCCTGCACAGAGGCTCCTGAGGG + Intergenic
1181191455 22:21143790-21143812 CCCTGCACAGAGGCTCCTGAGGG - Intergenic
1181207743 22:21266720-21266742 CCCTGCACAGAGGCTCCTGAGGG + Intergenic
1182458184 22:30465893-30465915 CCATGGACCCAGGCCTGTGAGGG + Intronic
1184431918 22:44445999-44446021 GCGGGGACTCAAGCCCCTGATGG + Intergenic
1203219177 22_KI270731v1_random:28696-28718 CCCTGCACAGAGGCTCCTGAGGG - Intergenic
1203271648 22_KI270734v1_random:58131-58153 CCCTGCACAGAGGCTCCTGAGGG + Intergenic
950176399 3:10877891-10877913 CCCTGCTCACATGCCCCTGAGGG - Intronic
953385876 3:42505393-42505415 CAGTGGCCACAAGCTCCTGAAGG + Intronic
954635439 3:52068499-52068521 CCAGGCACACAGGCCCCTGCAGG + Intergenic
956390824 3:68771065-68771087 CCCTGGACACAGGCCACCCAGGG - Intronic
961295342 3:125880081-125880103 CCGTGGGCACAGGCCCTGGGTGG - Intergenic
961426030 3:126848994-126849016 CTGTGGAGACAGGCCTCAGAAGG - Intronic
961525167 3:127492192-127492214 CCGTGCACACAGACCCCAGTGGG + Intergenic
961662655 3:128477923-128477945 CCCTGAACACTGGCTCCTGATGG - Intergenic
963101201 3:141606121-141606143 CAGTGGACACAGACAGCTGAAGG - Intronic
965697182 3:171421434-171421456 CCTTATACACAGGCCCATGAAGG - Intronic
968495310 4:912082-912104 CCCTGCGCACAGCCCCCTGAGGG - Intronic
968953017 4:3704260-3704282 CCTTACACACAGGCTCCTGAGGG + Intergenic
969597149 4:8156047-8156069 AGGTGGACAGAGGCTCCTGAGGG - Intronic
969614191 4:8242711-8242733 CCCAGGATCCAGGCCCCTGATGG - Intergenic
971351613 4:25861150-25861172 CCCTGTACACAGGGCCCTGCTGG - Intronic
974594166 4:63995551-63995573 TGGTGGACAGAGGTCCCTGATGG - Intergenic
982793405 4:159618086-159618108 CCATGGCCACAGGCCCCAGGAGG + Intergenic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985702863 5:1384033-1384055 CCCAGGACACCTGCCCCTGATGG - Intergenic
987989424 5:25190939-25190961 CCGGGGCCAGAGGGCCCTGAAGG + Intergenic
990299754 5:54438218-54438240 CCGTTGCCACAGGTTCCTGATGG + Intergenic
999256857 5:150214428-150214450 GCGAGGACTCAGGCCCCAGAGGG - Intronic
1001511011 5:172321843-172321865 CCCAGGGCCCAGGCCCCTGAGGG - Intergenic
1001991001 5:176115309-176115331 CCGGGGAACCAGCCCCCTGAAGG + Intronic
1002225871 5:177722831-177722853 CCGGGGAACCAGCCCCCTGAAGG - Intronic
1002267976 5:178048381-178048403 CCGGGGAACCAGCCCCCTGAAGG + Intronic
1002801805 6:530564-530586 CAGAGGACACAGGGCCCGGAAGG + Intronic
1003149772 6:3538646-3538668 CCATGGACACAGAGCCCAGATGG + Intergenic
1003245413 6:4378359-4378381 CCTTCCACACAGGGCCCTGAAGG + Intergenic
1004875069 6:19943054-19943076 CAGGGGCCACAGGCACCTGAAGG - Intergenic
1006007641 6:31015419-31015441 CCCTAGTCAGAGGCCCCTGAAGG - Intronic
1007390863 6:41548735-41548757 CAGTGGACCCAGCCGCCTGAAGG + Intronic
1016602354 6:145876853-145876875 CTGTGCGGACAGGCCCCTGATGG - Intronic
1016767393 6:147810390-147810412 CCTGGGTCACAGGCTCCTGAGGG - Intergenic
1016892606 6:149021510-149021532 CCCTGGACACAGACCTCTCATGG - Intronic
1018924537 6:168197232-168197254 CCGTGGGCACAGGCCCAGGCTGG + Intergenic
1019336526 7:485448-485470 CCGTGGACCCCAGCCCCTGGGGG - Intergenic
1019340020 7:504515-504537 CCCTGGACACAGGTCCCAGCAGG + Intronic
1024461681 7:49666098-49666120 CCGTGGGCATAGGACCCTCAAGG - Intergenic
1029878289 7:103777774-103777796 CCGTGGACCCAAGTCTCTGAAGG + Intronic
1034447563 7:151121393-151121415 CCGTGGACAGAGGCACCTAAGGG - Intronic
1035689680 8:1551848-1551870 CAGTGGTCACATTCCCCTGAGGG + Intronic
1036736516 8:11322816-11322838 CGGCGGACACAGGCCCAAGAAGG - Exonic
1045151836 8:99416539-99416561 CTGTTGGCATAGGCCCCTGAGGG + Intronic
1047926642 8:129688894-129688916 ACCTGGGCACAGGCCCCTGGTGG + Intergenic
1049494138 8:142921870-142921892 CAGTCGTCACAGGCCCCTTATGG - Intergenic
1055590067 9:77803012-77803034 CCGTGGACAAAGGCACTTGTGGG - Intronic
1059991226 9:119868272-119868294 CCGTGGTCATAGCCTCCTGATGG - Intergenic
1060992798 9:127858296-127858318 CCCTGGCCACTGGCCACTGAAGG + Intergenic
1061224953 9:129276004-129276026 CCCTGGACAAAGCCACCTGATGG + Intergenic
1061809686 9:133155078-133155100 ACGTGCACACAGGACCCTGCTGG - Intronic
1062452980 9:136623278-136623300 CCGTGGGCTCATGCCCCTCAGGG + Intergenic
1062479304 9:136744091-136744113 CCGAGGTCACAGGACCCTGTGGG + Exonic