ID: 1128046558

View in Genome Browser
Species Human (GRCh38)
Location 15:64623079-64623101
Sequence CTGCAGAAGCAGGTTGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 343}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128046558_1128046568 19 Left 1128046558 15:64623079-64623101 CCCTTCTCAACCTGCTTCTGCAG 0: 1
1: 0
2: 2
3: 46
4: 343
Right 1128046568 15:64623121-64623143 TTGTTGTAAATATTACCAAGTGG 0: 1
1: 0
2: 2
3: 15
4: 230
1128046558_1128046565 -9 Left 1128046558 15:64623079-64623101 CCCTTCTCAACCTGCTTCTGCAG 0: 1
1: 0
2: 2
3: 46
4: 343
Right 1128046565 15:64623093-64623115 CTTCTGCAGGGGAGCCACCAGGG 0: 1
1: 0
2: 0
3: 20
4: 215
1128046558_1128046564 -10 Left 1128046558 15:64623079-64623101 CCCTTCTCAACCTGCTTCTGCAG 0: 1
1: 0
2: 2
3: 46
4: 343
Right 1128046564 15:64623092-64623114 GCTTCTGCAGGGGAGCCACCAGG 0: 1
1: 0
2: 2
3: 27
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128046558 Original CRISPR CTGCAGAAGCAGGTTGAGAA GGG (reversed) Intronic
901110437 1:6789076-6789098 TTGCAGAAGCAGGATAAGTAAGG - Intronic
902690077 1:18105660-18105682 CAGCAGAAGGAGCTAGAGAATGG - Intergenic
903024395 1:20417150-20417172 ATGAAGAAGCAGGCTGAGAGAGG - Intergenic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903364700 1:22798833-22798855 AGGCAGGAGCAGGATGAGAAGGG + Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903733480 1:25515146-25515168 TTGGAGAGGCAGGTGGAGAATGG - Intergenic
903796275 1:25931179-25931201 CTTTATAAGCAGCTTGAGAATGG + Intergenic
903800158 1:25961237-25961259 CAACAAAAGCAGGTTGAGATGGG - Exonic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
905649094 1:39644674-39644696 TTGCGGAAGCAGGTTTAAAAAGG + Intergenic
906058795 1:42935225-42935247 CTGGAGAAGCAGGTTGACTCTGG + Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
908061919 1:60359719-60359741 CTGCAAAAGAAGGTTGAAGAAGG - Intergenic
910709538 1:90165492-90165514 TTTCAGAAGCAGGTTGGGGATGG + Intergenic
912387221 1:109277522-109277544 CTGCTGAAGCAGGTTTAGAGTGG + Intergenic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
913969284 1:143402258-143402280 CTGGACAAGCAGATTGTGAAGGG + Intergenic
914063661 1:144227857-144227879 CTGGACAAGCAGATTGTGAAGGG + Intergenic
914115489 1:144738497-144738519 CTGGACAAGCAGATTGTGAAGGG - Intergenic
915479500 1:156175287-156175309 TAGCAGAAGCTGGCTGAGAAGGG - Intronic
915493602 1:156265857-156265879 CTGGAGGAGCAGGTTGCTAAAGG + Exonic
916757270 1:167784673-167784695 CTGCAGATGTAGGTTGAGATTGG - Intronic
916780510 1:168022636-168022658 CTGGAGAGGGAGTTTGAGAAGGG + Intronic
916790061 1:168117034-168117056 TTGCAGAAGGATGTTGTGAAGGG - Intronic
917013349 1:170500696-170500718 ATACAGAAACAGGTTCAGAAAGG - Intergenic
917284143 1:173407015-173407037 CAGCAGCAGCAGGATGAGAAGGG + Intergenic
919759986 1:201091793-201091815 CTGCAGAGGCAGGCAGGGAAGGG + Intronic
920195403 1:204223193-204223215 CTCCAGAAGCAGGCAGGGAATGG - Intronic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
923248265 1:232154858-232154880 CTGCAGAATCAGGTTCAGCAAGG + Intergenic
923776806 1:236986158-236986180 CTGAAGAAGCCAGTGGAGAAGGG - Intergenic
924581710 1:245329558-245329580 CTGCAGAAGCAGGACGGGAGGGG - Intronic
924594578 1:245434410-245434432 CTGCAGAGACAGGGAGAGAAAGG - Intronic
924690342 1:246343467-246343489 CTGCAGAAGCAGGGTCAAAGAGG + Intronic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063653198 10:7960955-7960977 CTTCAGAAGCAGTTTGTAAAAGG - Intronic
1063863777 10:10341896-10341918 CTGCAGAAGTAGGTTTAGAGGGG + Intergenic
1066212087 10:33250510-33250532 CTGCTGAATCACGTTGAGATGGG - Intronic
1066640566 10:37550846-37550868 CTGCAGAAGGAGCTTGGTAAAGG - Intergenic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1067523661 10:47026112-47026134 CTGCAGAACCATGTGGAGATGGG - Intergenic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1068075213 10:52245212-52245234 CTACAGAAACAGTTTGAAAAAGG - Intronic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1069914829 10:71781008-71781030 CTGCAGCAGGAGGTTGTGGAGGG + Intronic
1070444666 10:76485002-76485024 ATACAGAAACAGGTTGAAAATGG - Intronic
1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG + Intronic
1071876744 10:89850959-89850981 CCACAGAAGCAGGTGGAGCAGGG + Intergenic
1072050717 10:91700539-91700561 CTGCAGGGGCAGGCAGAGAAGGG - Intergenic
1072417615 10:95262226-95262248 CTTCAAATGCAGGTTGAGAGAGG - Intronic
1072737118 10:97886587-97886609 CTGCAGAAGCGGGGTGAAAATGG + Intronic
1072757873 10:98032321-98032343 CTGAAGAAACAGGTTGACATTGG - Intergenic
1073483112 10:103799399-103799421 CTGTAGATGCAGTTTGGGAAGGG - Intronic
1074199530 10:111222633-111222655 CTTGAGAAGGAGGTTGGGAAGGG - Intergenic
1075400153 10:122155213-122155235 CTGGAGAGGCAGGTTGAGAAGGG - Intronic
1075653695 10:124147269-124147291 CTGCAAAAGCAGGTAGAGAGAGG - Intergenic
1076005012 10:126941852-126941874 CTGCAAAGGCGGGCTGAGAAAGG - Intronic
1076016159 10:127028927-127028949 CGGAGGAAGCAGGTTAAGAACGG + Intronic
1076286243 10:129299885-129299907 CTGCACTGGCAGGTAGAGAAAGG + Intergenic
1077032343 11:474230-474252 AGGCAGAAGCAGGAAGAGAAGGG - Intronic
1078355643 11:10629712-10629734 CTGCAGAAGGAGGATGAGCTGGG + Intronic
1081346927 11:41999365-41999387 CTGAAGAAGCAGCTTCAGTATGG + Intergenic
1081419504 11:42856927-42856949 ATACAGAAGAAGCTTGAGAAAGG + Intergenic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084335954 11:68457971-68457993 CTCGAGAAGCAGGTGCAGAAGGG - Intergenic
1084789421 11:71463937-71463959 ATGCAGAGTCAGCTTGAGAATGG - Intronic
1084885707 11:72205343-72205365 CTGAAGAAGCACTTTTAGAAGGG + Intergenic
1085810962 11:79680690-79680712 CTGAAGGAGCAGTTTGGGAAGGG - Intergenic
1085844161 11:80046660-80046682 CTGCTGAGGCAGGATTAGAAAGG - Intergenic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1087092585 11:94288941-94288963 CTGCAGAAGCAGGAGGATAAGGG + Intergenic
1088598895 11:111458620-111458642 CTGCAGAATGAAGGTGAGAAGGG - Intergenic
1090326017 11:125887244-125887266 CCGCAGCAGCCAGTTGAGAAGGG + Exonic
1090364172 11:126192438-126192460 CTGGAGAAGTAGGGTGACAAGGG + Intergenic
1091064123 11:132492555-132492577 AGGAAGAAACAGGTTGAGAAGGG + Intronic
1091366610 11:135026797-135026819 ATGGAGAAGAAGGTAGAGAAAGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1092372789 12:7931090-7931112 CTGAAGAAGCAGGCTGAGGCCGG - Intronic
1096793441 12:54059546-54059568 CAGAAAAAGCAGGCTGAGAAGGG - Intergenic
1098175417 12:67785286-67785308 TTACAGAAGTAGGATGAGAATGG + Intergenic
1098571250 12:71989843-71989865 CTGCAGAAACAGGTCCACAAAGG - Intronic
1098876502 12:75871616-75871638 CAGGAGGAGCAGGTTGGGAAGGG - Intergenic
1100120217 12:91360875-91360897 CTGGAGAAGTAGGTAGATAATGG - Intergenic
1100367832 12:93937665-93937687 CTGCAGCCCCTGGTTGAGAAAGG - Intergenic
1101065101 12:101012801-101012823 TTGCAGTAGGAGGGTGAGAAAGG + Intronic
1102107207 12:110335700-110335722 CTACAGAAGCAGCTCAAGAATGG + Intronic
1102177100 12:110884104-110884126 CTGCTGAAGCTGGCTGAGAGTGG + Exonic
1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG + Intergenic
1102941948 12:116950737-116950759 CTGCAGAACTAGTTTTAGAAAGG + Intronic
1105257287 13:18752416-18752438 ATGTAGATGCAGGTTCAGAAGGG - Intergenic
1105259958 13:18771778-18771800 ATATAGAAGCAGGTTCAGAAGGG - Intergenic
1105260432 13:18775247-18775269 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105262637 13:18791101-18791123 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1107310707 13:39074040-39074062 CTGCAACAGCACATTGAGAAGGG - Intergenic
1107548983 13:41457795-41457817 CTGCAGATGGCGGGTGAGAAAGG + Intronic
1107648725 13:42522689-42522711 CTGCACAAGAAGGTTAAAAATGG - Intergenic
1109975711 13:69828954-69828976 CTACCAAAGCAGGTAGAGAAAGG - Intronic
1110624597 13:77638758-77638780 CTGCTGGAGCAGGTTCTGAAGGG - Intronic
1112201892 13:97284376-97284398 CTGAAGAGGCAGGTAGAGATTGG - Intronic
1114267387 14:21080954-21080976 CGGCTGGAGCAGGTTGAGAGTGG + Exonic
1115432422 14:33335293-33335315 CTGCAGGATCAGGTTTAAAATGG + Intronic
1116192286 14:41676197-41676219 CTGCTGTAGAAGGTTGAGAGAGG - Intronic
1118348785 14:64958957-64958979 GTGGAGAAGCAGGTTCAGACTGG + Intronic
1118796928 14:69152638-69152660 CCGCAGAAGGGGGTAGAGAAAGG + Intronic
1119318120 14:73712804-73712826 CTACAGAAGGTGGTAGAGAAGGG - Exonic
1119444606 14:74652764-74652786 CTGGAGAGGGAGGTGGAGAATGG + Intergenic
1119643020 14:76328998-76329020 CTGAAAAACCAGGTTGTGAAGGG + Intronic
1121664631 14:95662833-95662855 CTGCAGCTGCAGGTTCTGAAAGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123798098 15:23794015-23794037 CTGAAGAAGCAGTTTCAGAGGGG + Intergenic
1123807263 15:23887878-23887900 CTGCATAAGCAGGTATAGCATGG - Intergenic
1126023942 15:44427855-44427877 CTGGAGGACCAGGTTTAGAAGGG - Intronic
1126686426 15:51252354-51252376 CTGAGGCAGAAGGTTGAGAAAGG - Intronic
1127311868 15:57759535-57759557 ATGCAGCTGCAGGTGGAGAAGGG - Intronic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1128081024 15:64856990-64857012 CTGGAGAAGCAGGGGGAGAGGGG - Intronic
1129064372 15:72888944-72888966 CCTCAGAAGCAGGCCGAGAAAGG + Intergenic
1130573003 15:85065737-85065759 CTTCAGAAGCAGACTGAAAATGG - Intronic
1130899493 15:88196423-88196445 CTGCAGAAGAATGTGGAGCAGGG + Intronic
1131355451 15:91742038-91742060 GTGGAGATGCAGGTGGAGAATGG + Intergenic
1133721445 16:8498233-8498255 CTGCAGAAGCAGAGCGGGAATGG - Intergenic
1133723788 16:8519021-8519043 CTGCAGAAATAGCTTGAGGAAGG - Intergenic
1134009112 16:10838231-10838253 CTGGAGAGGGATGTTGAGAATGG + Intergenic
1134034639 16:11020444-11020466 CTGGAGAAGCAGGGAAAGAAAGG - Intronic
1135497042 16:22961973-22961995 CTGCAAAAGCTGGTTGTTAAAGG - Intergenic
1136287194 16:29251504-29251526 CTGCAGAAGGGCGCTGAGAAGGG + Intergenic
1137714943 16:50592825-50592847 GTGCAGAAGCGGGTGGAGACAGG + Intronic
1137927478 16:52554317-52554339 CTGCAGAAGAAGTTTTAGACTGG - Intergenic
1137943678 16:52713733-52713755 CTGCAGAATCAGGTTCAGACTGG - Intergenic
1138560758 16:57799750-57799772 CTGCAGAAGGAAGCTGAGAGAGG + Intronic
1138885705 16:61075519-61075541 CTGCAGAAGTAGGATGTGATTGG + Intergenic
1139417146 16:66822112-66822134 CAGCAGAACCAGGCTGAGACAGG - Intronic
1139548691 16:67661665-67661687 GTGCAGAAGCGGGGTGAGGAGGG + Exonic
1140189862 16:72806164-72806186 ATACAGAAGCAGTTTTAGAAAGG - Intronic
1140783930 16:78321964-78321986 CTGCAGAGACAGGTTGTGGATGG + Intronic
1140931464 16:79632149-79632171 CTGCAGAGGCAAGTTGGGAGAGG - Intergenic
1141594123 16:85087130-85087152 CTGAAGAAGCAGGCTGTGATTGG + Exonic
1141619589 16:85229864-85229886 ATCCAAAAGCAGGGTGAGAAGGG + Intergenic
1142092804 16:88224137-88224159 CTGCAGAAGGGCGCTGAGAAGGG + Intergenic
1142407678 16:89900067-89900089 CTGCAGAAGAATGTTGATGATGG + Intronic
1143163596 17:4886605-4886627 CGGAAGAAGCGGGGTGAGAAAGG + Exonic
1143679357 17:8464918-8464940 CTCCTCAAGCAGGTTGAGGATGG - Intronic
1143679875 17:8468369-8468391 TTCCAGGAGCAGTTTGAGAATGG + Intronic
1146761049 17:35479106-35479128 ATTCAGAACCAGGTTGAGGAAGG - Exonic
1147403278 17:40193527-40193549 CTGCAGAGGCAAGGAGAGAATGG - Intronic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1149549664 17:57530992-57531014 GTGGAGAAGCAGGGAGAGAAAGG + Intronic
1151426460 17:74033901-74033923 CTGCAGATTCAGGGTGAGAAGGG + Intergenic
1151692818 17:75697338-75697360 TTGCAGAAGCTGGTGGAGAGTGG - Intronic
1152984042 18:306078-306100 CTGCAGATGAAGGATGAGAAGGG + Intergenic
1153067705 18:1065231-1065253 CTGCTGTAGCAGGTTTATAAGGG - Intergenic
1154292819 18:13125393-13125415 CTGCAGAAGCTGGTACAGATGGG + Intergenic
1154425587 18:14269548-14269570 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154426072 18:14273023-14273045 ATGTAGAAGCAGGTTCAAAAGGG + Intergenic
1154428321 18:14289133-14289155 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428803 18:14292607-14292629 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154431083 18:14308952-14308974 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433279 18:14324789-14324811 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433753 18:14328261-14328283 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155819688 18:30359728-30359750 CTGCTGAACCAGGTTGAGGTGGG - Intergenic
1155880767 18:31145496-31145518 CTACAGAAGCATGCTGAGAAAGG + Intronic
1156582025 18:38388451-38388473 CTGAAGAATATGGTTGAGAAAGG - Intergenic
1156708195 18:39909542-39909564 ATGGAGGAGCAGCTTGAGAAAGG - Intergenic
1157188021 18:45557275-45557297 TTGCAGAAACAGTTAGAGAATGG - Intronic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1160365257 18:78319225-78319247 CTGCAGAAGCAGGAGAAGAGAGG - Intergenic
1161163175 19:2771889-2771911 CGGAAGGAGCAGGTGGAGAAGGG - Intronic
1161299699 19:3536837-3536859 CTGCAGAAGCAGCTTCTGAGGGG + Intronic
1163786170 19:19275966-19275988 CTGCAGAGGGAGGTTGGGGAGGG - Intergenic
1164441576 19:28283809-28283831 GTGGAGAAGAAGGTGGAGAAAGG - Intergenic
1166523398 19:43495977-43495999 ATCCAGAAGCAGGTGGGGAAAGG + Intronic
1167012182 19:46815962-46815984 CTGAAGAGGTAGGTTGAGATGGG + Intergenic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
925759206 2:7168159-7168181 CTGCAGCAGGAGGGTGAGAGTGG + Intergenic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926706343 2:15840460-15840482 CTGCAAATGCAGGTTGAAAAAGG - Intergenic
927408268 2:22796836-22796858 CTGCAGAGGCAGATACAGAAGGG + Intergenic
928107147 2:28477915-28477937 CTGCAGAAGCAGACTCAGAAGGG - Intronic
928174547 2:29024775-29024797 CTGCAGAGGCAGCCTGAGCATGG + Intronic
929589237 2:43134448-43134470 CTGCAGGAGCAGGGTGGGATGGG - Intergenic
930818534 2:55622463-55622485 AGGCAGAAGCAGGATGAAAAGGG - Intergenic
930897926 2:56467111-56467133 CAGCTAAAGCAGGGTGAGAAGGG + Intergenic
931290169 2:60865703-60865725 CTTTAGAAGCAGTATGAGAACGG + Intergenic
931634559 2:64329838-64329860 CTCCAGAAGAAGGTTAAGTAAGG - Intergenic
931936006 2:67197190-67197212 CTCCAACAGCAGGTTGAGGATGG - Intergenic
932757447 2:74418153-74418175 CTGGAGAAGGAGGAAGAGAAGGG - Intronic
933195726 2:79387393-79387415 GTTCAGAAGCAAGTTCAGAATGG - Intronic
933537508 2:83594943-83594965 CTGCAGAAGTGAGATGAGAAAGG + Intergenic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934173977 2:89563159-89563181 CTGGACAAGCAGATTGTGAAGGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
934284292 2:91637508-91637530 CTGGACAAGCAGATTGTGAAGGG + Intergenic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
935702051 2:105821399-105821421 CGGCAGAAGGAGGCTGAGATGGG - Intronic
935967225 2:108492494-108492516 TTGCAGAACCCAGTTGAGAAAGG + Intronic
937962118 2:127468097-127468119 TTGAAGAAGCAGGCTCAGAAAGG - Intronic
938310537 2:130285942-130285964 CTGGAGGAGCAGGGAGAGAATGG + Intergenic
939376860 2:141379958-141379980 CTTCAGGAGCAGGCTGAGGAAGG - Intronic
939904218 2:147890869-147890891 TTGCAGAATCAGCTTGAGGAGGG + Intronic
941883994 2:170509739-170509761 TTACAGAAGCAGGGTGACAATGG - Intronic
942485302 2:176433061-176433083 CTCCAGAAGCTTCTTGAGAAAGG + Intergenic
942971041 2:181958216-181958238 CTGCAGGATCGGGCTGAGAAAGG - Intronic
945657014 2:212636668-212636690 CTGCATAAGCAGTTTTTGAATGG + Intergenic
946553689 2:220831267-220831289 CTGCAGGAGGATGTTGATAATGG - Intergenic
947252417 2:228122678-228122700 CAGCAAAAGCAGGTCAAGAATGG - Intronic
948285579 2:236782142-236782164 CTGCAGAAGGTGTGTGAGAATGG + Intergenic
949044269 2:241863777-241863799 CTGCAGAAGCAGTTTCGGGATGG - Intergenic
1169777003 20:9265892-9265914 CTGAAGAAGCATCTTGGGAATGG + Intronic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170534747 20:17329026-17329048 CTCCATTAGCAGGTTGGGAATGG + Intronic
1170571562 20:17635633-17635655 CTTCAGGAGCAGCTGGAGAATGG - Exonic
1171089566 20:22271115-22271137 CTTCCAAAGCAGGTTGAAAAAGG - Intergenic
1171393384 20:24815655-24815677 CAACAGAGGCAGGTGGAGAAGGG - Intergenic
1171883582 20:30635384-30635406 ATATAGAAGCAGGTTCAGAAGGG - Intergenic
1172111235 20:32546358-32546380 CTGTAAAAGGAGGCTGAGAAAGG - Intronic
1172192401 20:33069830-33069852 CGGCAGAAGGAGCTTGAGGACGG - Intronic
1172271530 20:33658108-33658130 CTCCAGAGGCAGTGTGAGAAGGG - Intronic
1172285313 20:33736253-33736275 TTGCAGAGGCAGTTTCAGAATGG - Intronic
1175629757 20:60525692-60525714 CTGCCCAAGCAGGAAGAGAAAGG - Intergenic
1175750558 20:61494087-61494109 CTCCAGGAGCAGGTGGAGACAGG + Intronic
1176186645 20:63783879-63783901 CTGCTGAAACAGGCTGTGAAAGG + Intronic
1176843280 21:13857483-13857505 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176843768 21:13860968-13860990 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1176846444 21:13880288-13880310 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176848699 21:13896360-13896382 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1178661673 21:34511834-34511856 CTGCAGAAGCACATGGAGAAGGG - Intergenic
1181462632 22:23094573-23094595 CTGCAGAAGGAGGTAGAGGGGGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182510108 22:30813589-30813611 CTGCAGCAGCTGGGTGAGGATGG - Intronic
1183029861 22:35095479-35095501 ATGGAGAAGGAGGTTGGGAATGG + Intergenic
1183331619 22:37225291-37225313 CTGCTTAAGCAGGTTGAGTTGGG + Exonic
1183902522 22:41017269-41017291 ATGCAGAAGCAGGCTGGGCACGG - Intergenic
1184395907 22:44240047-44240069 GTGCAAAAGCAGTTTGATAAGGG - Intergenic
1184940631 22:47762172-47762194 CTGCAGAAGGAGGTTGGCCAAGG - Intergenic
1185344915 22:50306936-50306958 CTGCAGGAGCAGGGTGCGGAGGG + Intronic
950601005 3:14035470-14035492 CTGCAGAAGCAGTGGCAGAAAGG + Intronic
950662551 3:14475574-14475596 CTGAAGAGGCTGGTGGAGAAGGG + Intronic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951811290 3:26702970-26702992 CTGTAGTAGATGGTTGAGAATGG + Intronic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954460973 3:50626746-50626768 ATGCAGAGACAGGTTCAGAAAGG + Intronic
954989999 3:54832428-54832450 CTGCAGAAGAAGGAAAAGAAAGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
957160864 3:76608229-76608251 CTGCCCAAGAAGGGTGAGAAAGG - Intronic
957749583 3:84395787-84395809 CTGAAAAATCAGGTTGAGAACGG - Intergenic
960115190 3:113885934-113885956 CATCGGGAGCAGGTTGAGAAGGG - Intronic
960229130 3:115204167-115204189 CTGCAGAAGCATGTGGCAAAGGG - Intergenic
960583703 3:119301713-119301735 CTGCAGCAGTGGGTGGAGAAAGG + Intronic
960944525 3:122957031-122957053 CTGGAGAAGCTGGTGGAGAGAGG + Intronic
961053763 3:123768900-123768922 CTGGAGAAGCAGGCAGAGAGGGG - Intronic
961356051 3:126340719-126340741 CTGAAAAAGCAGGTGGAGATGGG - Intergenic
964057357 3:152477655-152477677 GTACAGAAGCTGGATGAGAAAGG - Intergenic
964140167 3:153388867-153388889 ATGCTGAAGAAGGTTAAGAAAGG - Intergenic
968077078 3:195821865-195821887 CTGGAGGAGCAGGGTGAGAGAGG + Intergenic
968351015 3:198051924-198051946 ATGCAGAAGCAAGTTCAGAAGGG - Intergenic
968351056 3:198052383-198052405 ATGCAGAACCATGTAGAGAAAGG + Intergenic
968494282 4:906874-906896 CCGCAGAAGCAGCTTGTGAGGGG - Intronic
968641141 4:1715699-1715721 CTGCAGGAGCAGGGTGGGAGGGG - Intergenic
968886166 4:3334084-3334106 CTGAGGAAGCTGGTTGAAAAAGG + Intronic
968961953 4:3750171-3750193 CTGCAGCAGCAGGGACAGAAGGG + Intergenic
969145742 4:5122888-5122910 CAGCTGAAGTAGGTGGAGAAGGG - Intronic
969673216 4:8601180-8601202 GTGCTGAAGCAGGTTGGGGAAGG - Exonic
969827823 4:9771975-9771997 CTGGACAAGCAGATTGTGAAGGG + Intronic
970523016 4:16904230-16904252 CTGAAGAAGCAGGTTGTATAGGG - Intergenic
971956755 4:33430327-33430349 TTGTAAAAGAAGGTTGAGAAAGG - Intergenic
971996483 4:33972253-33972275 CTGCAGAAAAAGGGTCAGAAGGG - Intergenic
972720296 4:41689886-41689908 CTCCAGCAGGAGGCTGAGAATGG + Intronic
973367234 4:49217652-49217674 ATGTAGAAGCATGTTCAGAAGGG - Intergenic
974810649 4:66941744-66941766 CTACAGAAGAAGGCTGAAAATGG + Intergenic
975770791 4:77720325-77720347 CTGAAGAAGCAGCTTAAGGATGG + Exonic
976387668 4:84480191-84480213 CTGCAGAGGCAGGGAGGGAAGGG + Intergenic
976633955 4:87268658-87268680 CTTCAGATTCAGATTGAGAAGGG + Intergenic
978270154 4:106878967-106878989 GTGCTCAAGCAGGGTGAGAAGGG - Intergenic
978387772 4:108192765-108192787 CTGCAGAAGGAGGTGGAGAGGGG + Intergenic
981206566 4:142047870-142047892 CCACAGTGGCAGGTTGAGAAAGG - Intronic
984447360 4:179853655-179853677 AGGCAGAAGCAGGTAGGGAATGG + Intergenic
984465527 4:180095999-180096021 CTCAAGAAGCAAGTTTAGAAGGG + Intergenic
984623389 4:181978290-181978312 TGGCAGAACCAGGATGAGAAGGG + Intergenic
984870553 4:184321217-184321239 ATGATGAAGTAGGTTGAGAAGGG + Intergenic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
986035653 5:3934721-3934743 CTGCTGGAGCATGTTGATAATGG - Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
987248429 5:16074594-16074616 TCACAGAACCAGGTTGAGAATGG + Intronic
987964150 5:24850636-24850658 CTGCAGCAACCGGTTCAGAATGG + Intergenic
988650497 5:33143899-33143921 ATGAAGAAACAAGTTGAGAAAGG + Intergenic
989466004 5:41756697-41756719 CTGCTGAAGAAGGGGGAGAAAGG + Intronic
989767137 5:45100867-45100889 CAGCAGAAGCAAGTTTAGAGGGG + Intergenic
990013406 5:51027488-51027510 CTGCAGAGGAAGCTTGAGATGGG + Intergenic
991269883 5:64767542-64767564 CTGTAGAAGGAGGTTCAAAAAGG + Intronic
992056691 5:72997548-72997570 CATCGGGAGCAGGTTGAGAAGGG - Intronic
992643036 5:78785899-78785921 CTGCAGAAGAAGGGTCAGAGAGG + Intronic
993005483 5:82424464-82424486 ATGCAGGTGCAGGTTGAAAAAGG - Intergenic
996230771 5:121060879-121060901 CTTCAGAAGCATGTGGAGCATGG + Intergenic
996316345 5:122164823-122164845 ATACAGAGGCAGGGTGAGAAGGG - Intronic
997300219 5:132798208-132798230 GTGCAGAAACAGGTTGAAGAGGG - Intronic
998192164 5:140035263-140035285 TTGGAGAAGTAGTTTGAGAAGGG - Intronic
1001370800 5:171198829-171198851 CTGAAGAAACAGGCAGAGAAAGG - Intronic
1002170048 5:177369868-177369890 CTGCAGGAGCAGGTGGAGTGTGG - Intronic
1003320755 6:5049058-5049080 CTGCAGAGGAAGATTGGGAAAGG + Intergenic
1005048408 6:21663704-21663726 GTTCACAAGCAGGTTGGGAAAGG + Intergenic
1005411575 6:25553780-25553802 TTGCAGAGGCAGGTTGAAATTGG + Intronic
1006467358 6:34203565-34203587 ATGCAGAAGCAGGAAAAGAATGG + Intergenic
1007322416 6:41037302-41037324 CTGCAGAAGCTCCTTGAGAGCGG - Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1010126492 6:72438389-72438411 CTGCAGCAGCATGTTGAAATTGG + Intergenic
1011411986 6:87075471-87075493 CTGCAGTAGGAGGTTGGGACAGG - Intergenic
1013848656 6:114486205-114486227 CAGCAGAAGCTGGTGGATAAGGG + Intergenic
1014284650 6:119482992-119483014 CTACAGAGGAAGGTTGATAAAGG - Intergenic
1014609940 6:123529934-123529956 CAGCAGAAGCAAATTAAGAAAGG - Intronic
1014708301 6:124775305-124775327 CTGCAAAAGAAGGTTCAGAATGG - Intronic
1016408576 6:143757640-143757662 CTTCAAGAGAAGGTTGAGAAAGG - Intronic
1017024968 6:150173576-150173598 CTGCAGAAGAAGGCTGAAATTGG - Intronic
1017987912 6:159460662-159460684 CTGCAGGAGCAGGTAGGGAGGGG - Intergenic
1019153840 6:170025942-170025964 CTGCATATGCAGGTTCAAAAGGG - Intergenic
1019561388 7:1660450-1660472 CTGCAGGAGCAGGTTGGGATGGG - Intergenic
1019751986 7:2736550-2736572 CAGCAGCAGCAGGTTGATATGGG + Intronic
1020445014 7:8259866-8259888 CTGCTGAGGCAGATTGCGAATGG + Intronic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1021888448 7:25163826-25163848 TTGCAGAGGCACGGTGAGAAGGG - Intronic
1022808756 7:33848820-33848842 CTGCAAAAGCAGATTGGAAAGGG - Intergenic
1028390262 7:90308147-90308169 ATGAATAAGCAGGTTCAGAATGG - Intronic
1029514191 7:101015815-101015837 CTGCAGCGGCAGGTAGGGAACGG - Intronic
1029637468 7:101794516-101794538 AAGCAGAAGCAGGTTGGGAGCGG + Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030319672 7:108152189-108152211 CTGCAGAAGGTGTTGGAGAAGGG + Intronic
1030960831 7:115919841-115919863 CTGCTGAAGCAGTTTATGAATGG + Intergenic
1031597942 7:123669391-123669413 CAGCAGAAGCAGGTTTGGGAGGG + Intergenic
1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG + Intergenic
1034056262 7:148038333-148038355 CTGCGGAAGCAGCTTGGGAAAGG - Intronic
1034281140 7:149855372-149855394 CAGCCGCAGCAGGTTGAGGAGGG - Intronic
1034321380 7:150186088-150186110 CTGCACAGGCAAGGTGAGAAAGG + Intergenic
1034771374 7:153781192-153781214 CTGCACAGGCAAGGTGAGAAAGG - Intergenic
1034970026 7:155413089-155413111 CTCCAGCAGCAGGGTGAGGAAGG + Intergenic
1036018062 8:4808262-4808284 CTACAGATGCTGGTTGAAAAAGG + Intronic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036546681 8:9777560-9777582 CTGGAGATGCAGGTTGACACGGG + Exonic
1039601960 8:38846808-38846830 CTGCAGCAGAAGGTACAGAAAGG + Exonic
1041512425 8:58666610-58666632 AGGCAGAAGCAGGTTGGGAATGG + Intergenic
1041876861 8:62698398-62698420 CTGCAGGAGGAGCTTGAGTAGGG - Intronic
1043671815 8:82895873-82895895 CTGCAGAATCAGGATCAGAGGGG + Intergenic
1044431368 8:92111622-92111644 CTGCTGAAGAAGGATGAGAAGGG - Intergenic
1045799342 8:106083793-106083815 CTGTAGAAACATGTAGAGAAAGG - Intergenic
1046247555 8:111584700-111584722 ATGCAGAAGAAGCTGGAGAATGG + Intergenic
1046380127 8:113438831-113438853 CTGCATATGCAGGTTTCGAAGGG + Intergenic
1047343247 8:124002741-124002763 CAGAAGAAGCAGGTTTGGAAAGG + Intronic
1048477162 8:134754097-134754119 CTGGGGAAGCAGGGTGAAAAAGG + Intergenic
1048522317 8:135168333-135168355 GTGCAGGAGCAAGTTAAGAAGGG - Intergenic
1051257803 9:15232871-15232893 CTGCAGCAGCCAGTTGAGAAGGG - Intronic
1051784786 9:20730553-20730575 CTTTAGAAGCAGCTTGAGAGAGG + Intronic
1052752620 9:32508104-32508126 CTACAGAAGCAAGTGGAAAATGG + Intronic
1052879869 9:33594927-33594949 ATGTAGAAGCAGTTTCAGAAGGG + Intergenic
1053496110 9:38549293-38549315 ATGTAGAAGCAGGTTCAGAAGGG - Intronic
1053665650 9:40315683-40315705 ATGTAGAAGCAGGTTCAGAAGGG + Intronic
1053915233 9:42940730-42940752 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054376806 9:64455713-64455735 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054518964 9:66060601-66060623 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1054519394 9:66063548-66063570 ATGCAGGAACAGGTTCAGAAGGG - Intergenic
1056586222 9:87929104-87929126 AAGTAGAAGCAGGTTCAGAAGGG - Intergenic
1056610660 9:88123839-88123861 AAGTAGAAGCAGGTTCAGAAGGG + Intergenic
1056725135 9:89107599-89107621 CTGCAGGTGCAGGCTGAGAGAGG + Intronic
1056743989 9:89284051-89284073 ATGGAAAAGGAGGTTGAGAAGGG - Intergenic
1057061529 9:92008146-92008168 CTGCAGTAGCAGTTTCAGAGAGG + Intergenic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1057676033 9:97136811-97136833 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1058642940 9:107104825-107104847 TTGCAGAAGGAAGTTGAGATGGG + Intergenic
1058721830 9:107771439-107771461 CTGCAGAAGCAAGTTGTCCATGG - Intergenic
1060421498 9:123472693-123472715 CTGCAGAAGCAAGCAGAGTATGG + Intronic
1060952028 9:127610067-127610089 GTGCTGAAGCAGATGGAGAAGGG - Intergenic
1061846329 9:133390550-133390572 CTGCAGAACCAGGTGGGGCAGGG + Intronic
1062095239 9:134699742-134699764 CTGCAGGAGCAGTTTGATCAAGG + Intronic
1188690113 X:33118890-33118912 GTGAAGAAGCATGCTGAGAAAGG - Intronic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1195821429 X:108949609-108949631 CAGCAGAAGCAGGTTTAAATAGG - Intergenic
1195900380 X:109791300-109791322 CTTGAGAAGCAGGTTGAGAGAGG + Intergenic
1196322238 X:114355122-114355144 GGGGAGAAGCAGGTTGAAAAGGG - Intergenic
1197049807 X:122044902-122044924 CTGGAGAAGGAGGTAGAGAGAGG - Intergenic
1197441984 X:126502737-126502759 AAGCAGTAGCAGGTTGAGGATGG + Intergenic
1197881242 X:131169223-131169245 CTGGAGCAGCAGGTAAAGAAAGG + Intergenic
1199600629 X:149539565-149539587 CTGGAGATGCAGGGTGAGCAGGG - Intergenic
1199732448 X:150649403-150649425 AGGCAAAAGCAGGTTGTGAAAGG - Intronic
1200034647 X:153319560-153319582 CTGCAGAAGGCCGTGGAGAAGGG - Intergenic
1200085142 X:153600398-153600420 CTGCAGAAGCTGGAAGAGCAAGG - Intergenic