ID: 1128052230

View in Genome Browser
Species Human (GRCh38)
Location 15:64674583-64674605
Sequence CTGAATTTGCTTGAAGGAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 217}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128052230_1128052239 18 Left 1128052230 15:64674583-64674605 CCTTCTCCTTCAAGCAAATTCAG 0: 1
1: 0
2: 4
3: 19
4: 217
Right 1128052239 15:64674624-64674646 GAAAAAGTTGAGTGGGGAAGGGG 0: 1
1: 0
2: 5
3: 49
4: 518
1128052230_1128052237 16 Left 1128052230 15:64674583-64674605 CCTTCTCCTTCAAGCAAATTCAG 0: 1
1: 0
2: 4
3: 19
4: 217
Right 1128052237 15:64674622-64674644 AAGAAAAAGTTGAGTGGGGAAGG 0: 1
1: 0
2: 7
3: 70
4: 826
1128052230_1128052234 10 Left 1128052230 15:64674583-64674605 CCTTCTCCTTCAAGCAAATTCAG 0: 1
1: 0
2: 4
3: 19
4: 217
Right 1128052234 15:64674616-64674638 CTCTGTAAGAAAAAGTTGAGTGG 0: 1
1: 1
2: 1
3: 16
4: 217
1128052230_1128052236 12 Left 1128052230 15:64674583-64674605 CCTTCTCCTTCAAGCAAATTCAG 0: 1
1: 0
2: 4
3: 19
4: 217
Right 1128052236 15:64674618-64674640 CTGTAAGAAAAAGTTGAGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 248
1128052230_1128052238 17 Left 1128052230 15:64674583-64674605 CCTTCTCCTTCAAGCAAATTCAG 0: 1
1: 0
2: 4
3: 19
4: 217
Right 1128052238 15:64674623-64674645 AGAAAAAGTTGAGTGGGGAAGGG 0: 1
1: 0
2: 2
3: 70
4: 717
1128052230_1128052235 11 Left 1128052230 15:64674583-64674605 CCTTCTCCTTCAAGCAAATTCAG 0: 1
1: 0
2: 4
3: 19
4: 217
Right 1128052235 15:64674617-64674639 TCTGTAAGAAAAAGTTGAGTGGG 0: 1
1: 0
2: 1
3: 24
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128052230 Original CRISPR CTGAATTTGCTTGAAGGAGA AGG (reversed) Exonic
902163981 1:14554478-14554500 CTGATTTGGCTTAAAGGAGAGGG - Intergenic
902170063 1:14602912-14602934 CTGCATTTGTTAGAAGGGGATGG + Intronic
902302903 1:15515284-15515306 CTGCATTTGCTTGAAGTGTAAGG - Intronic
902418937 1:16262336-16262358 TTGAATTTGTTTAAAGCAGATGG + Intronic
904791046 1:33021510-33021532 CTTAATTCCTTTGAAGGAGATGG - Intronic
904894175 1:33801755-33801777 AGGAATTTGCCTGGAGGAGAAGG + Intronic
904922472 1:34019795-34019817 CTGAACTGGCTTGAGGGACAGGG - Intronic
906970303 1:50506444-50506466 GTGATTTTGCCTGAAGGAGAAGG - Intronic
907540581 1:55213424-55213446 CTGAAGTAGCTTGAACAAGAAGG - Intronic
907619850 1:55966094-55966116 CTGACTTTGAGTGCAGGAGAGGG - Intergenic
908704344 1:66934823-66934845 CTTAATTTTATTGGAGGAGAGGG + Intronic
910511129 1:88006228-88006250 CTGAATTTACATGATGGGGAGGG - Intergenic
911674937 1:100647839-100647861 CTGAATGTGCCTGTAGGAGGTGG - Intergenic
912762945 1:112385343-112385365 ATGAATTTGCTTTAAGAAGGGGG + Intergenic
917691355 1:177472761-177472783 CGGAAGTTGCTGGAGGGAGAAGG + Intergenic
917754449 1:178085094-178085116 CTAAAGTAGATTGAAGGAGAAGG - Intergenic
918449406 1:184644514-184644536 TTGAATGTGGTTGGAGGAGAAGG - Intergenic
918601724 1:186372214-186372236 TTTAATTTGATTGATGGAGAAGG - Intronic
921346028 1:214185949-214185971 CTGATTTTTCCTCAAGGAGAAGG + Intergenic
923043042 1:230333397-230333419 CAGAAGTTTCTTGAAGTAGATGG - Intronic
923765185 1:236886754-236886776 CAGAACTTCCTTCAAGGAGACGG - Intronic
924747777 1:246853546-246853568 CTGAACTTCCTTGAAGCAGTTGG - Intronic
1065524597 10:26607090-26607112 CTAAGTCTGCTTGAAGAAGACGG + Intergenic
1070247246 10:74744013-74744035 CTGTCTTTGCTTGGATGAGACGG - Intergenic
1073656022 10:105417738-105417760 CTGAGTTTGCTTCAAGCACATGG - Intergenic
1074228088 10:111506993-111507015 TTGAAGCTGCTTGAAGCAGAAGG - Intergenic
1074799495 10:116985030-116985052 CTGATTTTGCATGAAGTATATGG - Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076141444 10:128081758-128081780 CTGAATTTGCATGAAGTTGTTGG - Intronic
1076363683 10:129908576-129908598 CTGAGTTTTCTTGGAGGAGTTGG - Intronic
1076793811 10:132789375-132789397 CTGGAATTGCTGGAAGGGGAAGG + Intergenic
1078478827 11:11658551-11658573 ATGACTTTGCTTCATGGAGAGGG - Intergenic
1082064681 11:47890539-47890561 GTGAATTTGTTTTGAGGAGAGGG - Intergenic
1082735768 11:56854069-56854091 CTGACTGTGCTTAAAGAAGAGGG + Intergenic
1085726427 11:78958881-78958903 CTCAAATTGGTGGAAGGAGATGG + Intronic
1088550744 11:111010105-111010127 GAGAACTTGCTAGAAGGAGATGG - Intergenic
1090912247 11:131131533-131131555 ATGAAGTGGCTTGTAGGAGAGGG + Intergenic
1094407198 12:30129176-30129198 CTGAATTTCCTTGAAGAAGGAGG - Intergenic
1094498981 12:31006606-31006628 CTGATTTTGCAGGAGGGAGAAGG + Intergenic
1097448401 12:59704923-59704945 CTGAATTTCTTTGAAGAATACGG - Exonic
1098777889 12:74644822-74644844 ATGAATTTGCTAGCAGAAGAGGG - Intergenic
1100225042 12:92548006-92548028 CTGAAATTGCTGGGAAGAGAGGG - Intergenic
1100474408 12:94922390-94922412 CTGAATTTTCTTGGTGGAGTTGG - Intronic
1101135201 12:101737039-101737061 CAGAATATGCTGGAAGGAGTTGG - Exonic
1102942518 12:116956211-116956233 CTGCCTTTGCTGGAAGGAGCAGG + Intronic
1105864771 13:24449618-24449640 CTGTGTTTCCTTGAATGAGAGGG - Intronic
1106728474 13:32512542-32512564 CAGAATTTGTCAGAAGGAGAAGG + Intronic
1107240809 13:38231601-38231623 CTGAACATGCTTGTAGGAGGTGG - Intergenic
1107896911 13:44974516-44974538 CTGAAACTGCATGAAGGTGAAGG + Intronic
1108281286 13:48864739-48864761 CAGAATGTGCATGAAAGAGAGGG + Intergenic
1109666867 13:65551650-65551672 CAGAATTTGCTTGCCTGAGAAGG + Intergenic
1110265606 13:73533805-73533827 CTGAATATGTTTTTAGGAGATGG + Intergenic
1110273881 13:73621024-73621046 CTGAATTTGGTCAATGGAGAGGG + Intergenic
1112504295 13:99966354-99966376 CAGGATTTCATTGAAGGAGAGGG + Intronic
1116003145 14:39266304-39266326 CTGGATTTGTTCGTAGGAGACGG - Intronic
1118141809 14:63092055-63092077 CTGACTTTGCTTGAATGAGGAGG - Intronic
1118694064 14:68366887-68366909 CTGAACTTGGTTGAAAGAAAAGG + Intronic
1120020345 14:79523189-79523211 CTGAAATTGCATTAAAGAGATGG - Intronic
1121824794 14:97001225-97001247 TTGAATTAGCTTAAAGGAAAAGG - Intergenic
1123500049 15:20873213-20873235 ATGAATTTGCTGAAAGGAGTTGG - Intergenic
1123557297 15:21446911-21446933 ATGAATTTGCTGAAAGGAGTTGG - Intergenic
1123593522 15:21884178-21884200 ATGAATTTGCTGAAAGGAGTTGG - Intergenic
1123811801 15:23934232-23934254 CTGAATTTGTTTGATGAAGTAGG + Intergenic
1127128371 15:55835907-55835929 CTGAATTTCAATGAGGGAGAAGG - Intronic
1127966701 15:63928133-63928155 CTGAATTTGATGCAAAGAGAAGG - Intronic
1128052230 15:64674583-64674605 CTGAATTTGCTTGAAGGAGAAGG - Exonic
1128916079 15:71563796-71563818 TTGAATATACTTAAAGGAGATGG - Intronic
1130277469 15:82488971-82488993 CTGCTTCTGCTTGAGGGAGAAGG - Intergenic
1131164100 15:90129786-90129808 CTGTATTTTCTCGAAGGAGGTGG + Intergenic
1131944769 15:97608120-97608142 CTGAATTTGCTGGAGGGAGGTGG + Intergenic
1134571717 16:15297055-15297077 CTGAAATTGCTTAAACAAGATGG - Intergenic
1134730665 16:16458988-16459010 CTGAAATTGCTTAAACAAGATGG + Intergenic
1134874351 16:17683724-17683746 CTCAATTTGCCTGAACCAGAGGG - Intergenic
1134936766 16:18252908-18252930 CTGAAATTGCTTAAACAAGATGG - Intergenic
1140236013 16:73159587-73159609 CTGAGTTGGCTTGACCGAGATGG - Intergenic
1140861583 16:79023105-79023127 CTGTATTTGGTTTAAGGAGGGGG + Intronic
1141358395 16:83371282-83371304 CTGAAGATGCAGGAAGGAGAGGG - Intronic
1141397092 16:83714788-83714810 CTTAATCTGCTTGAAGGAGAGGG + Intronic
1146198583 17:30834757-30834779 CTAAATTTGCTTAAAAAAGATGG + Exonic
1146813276 17:35921342-35921364 CTTTATTTGCTTGTAGGAGGTGG - Intronic
1147231743 17:39024443-39024465 CTTTATTTGCTTGTAAGAGACGG + Intergenic
1147718003 17:42521077-42521099 CCGAATATGCTCGAAGGAGAAGG - Exonic
1148257374 17:46147251-46147273 CTGAATATGCTGTAAAGAGAAGG + Intronic
1150113846 17:62527033-62527055 CTGCAGTGGCATGAAGGAGAGGG - Intronic
1203177638 17_KI270729v1_random:31066-31088 ATGAATTTACTTGAATGTGATGG + Intergenic
1154217273 18:12424217-12424239 CTGAGTTTTCTGGAAGGATAAGG - Intronic
1154458652 18:14556175-14556197 ATGAATTTGCTGAAAGGAGTTGG - Intergenic
1155682127 18:28501227-28501249 CAGAATTTGTTAGAGGGAGAAGG + Intergenic
1156944904 18:42816801-42816823 CTGATTTAGCTAGGAGGAGAGGG + Intronic
1157109073 18:44802652-44802674 CTGAATCTGCTTGAGAGAGAAGG + Intronic
1157365383 18:47059468-47059490 CGGACTTTGCTTGATGGAGTAGG + Intronic
1157530203 18:48413917-48413939 CAGCATTTTCTTGAGGGAGATGG - Intergenic
1164662071 19:29983620-29983642 CTGAATTTTTTTTAAGCAGAAGG - Intronic
1165080874 19:33305339-33305361 AGGAATTTGCTGGAAGGATAAGG + Intergenic
1165966601 19:39586399-39586421 CAGAATATGGTTGAAGTAGATGG - Intergenic
926947073 2:18200010-18200032 CTGAATGTGCCTGTGGGAGAGGG + Intronic
927569645 2:24147065-24147087 GTGAATTTTGTAGAAGGAGAAGG + Exonic
928112719 2:28523675-28523697 ATGAACTTGATTGGAGGAGAGGG - Intronic
928707122 2:33962044-33962066 CTAAGTTTTCTTTAAGGAGAAGG + Intergenic
929080966 2:38121774-38121796 TTGTATTTACTGGAAGGAGAAGG + Intergenic
929352366 2:40973088-40973110 CTGAAAGTGATTGAAGGGGAGGG - Intergenic
929458069 2:42080251-42080273 CTGAAATAGGTTGAAGAAGATGG - Intergenic
930626195 2:53700132-53700154 CTGAATTGGGGTGAAGGAGTTGG - Intronic
932062399 2:68519588-68519610 CTCAATTTGCAGGAAGGAAATGG - Intronic
933032116 2:77341787-77341809 CTCAATTTGGGTAAAGGAGAAGG + Intronic
933895589 2:86807773-86807795 CTGAATCAGCCTAAAGGAGACGG + Exonic
935287272 2:101576285-101576307 CTGACTCTGTGTGAAGGAGAGGG + Intergenic
938239274 2:129730671-129730693 CTGAATTTGCCTGAAAGACCCGG - Intergenic
939403668 2:141728923-141728945 CTGAATTTGCTAGGTGGAGAGGG + Intronic
941415974 2:165221911-165221933 CTGAATTTGGGTCATGGAGAGGG - Intergenic
941842390 2:170100274-170100296 CTCAATCTGCTAGAAGGAAATGG + Intergenic
942243441 2:173985302-173985324 CTGAACCTGTCTGAAGGAGAGGG + Intergenic
942735368 2:179104890-179104912 CTGCTTTTTCTTGAAGTAGAGGG + Exonic
943115402 2:183663618-183663640 CTGAAACAGCTTGATGGAGAGGG + Intergenic
943165730 2:184322933-184322955 CTGAAGTTCCTTGAAGAAGAAGG + Intergenic
945625729 2:212203392-212203414 CTGAAGTTGAGTGAAGGAGAAGG + Intronic
946645034 2:221824150-221824172 TTGTATTTGGTTGAAAGAGAGGG + Intergenic
946824682 2:223665030-223665052 CTGCATGTACTTGAATGAGAGGG - Intergenic
1168887761 20:1271721-1271743 GTGGATTTGCTGGAGGGAGAGGG + Intronic
1173126151 20:40337826-40337848 CTGAGTTTGATTGAAGCACATGG + Intergenic
1173160976 20:40652585-40652607 CTGGCTTTGCCTGAAGGAGGAGG + Intergenic
1173220808 20:41131599-41131621 CTGTATATGCCTGAAAGAGATGG - Intergenic
1173758859 20:45542284-45542306 TTGTTTTTCCTTGAAGGAGATGG - Intronic
1174004301 20:47398242-47398264 CTTAATTTAAATGAAGGAGAAGG + Intergenic
1176307448 21:5131312-5131334 CTGCATCTGCTTGGAGGAGGAGG - Exonic
1176815497 21:13597166-13597188 ATGAATTTGCTGAAAGGAGTTGG + Intergenic
1177529611 21:22342332-22342354 CTAAATTTGCTTGGGGGTGAGGG - Intergenic
1177686020 21:24438409-24438431 CTGAAGTTGCTTGAAAAAGCTGG + Intergenic
1179849612 21:44130718-44130740 CTGCATCTGCTTGGAGGAGGAGG + Exonic
1181596705 22:23919891-23919913 CTGAAGTTGCTCAAAGGAGCTGG - Intergenic
1183957529 22:41390453-41390475 ATGACTTTGCTGGAAGAAGAGGG - Intronic
949339802 3:3017163-3017185 GTGACTTTGCTTTAAGAAGAAGG - Intronic
949666855 3:6349001-6349023 ATGAATTGGCATGAAGGATAAGG + Intergenic
949743330 3:7261802-7261824 CAGCATTTGCTTGTAGGAAAAGG + Intronic
950602376 3:14045970-14045992 CTGCATTTGCTTGAGGGGGAGGG + Intronic
953942092 3:47109058-47109080 CTGAACAGGCTTTAAGGAGAAGG - Intronic
955942367 3:64158612-64158634 CTGAGTTTGCCTAAGGGAGAAGG - Intronic
957376237 3:79362538-79362560 CTGTCTTTCCTTGAAGGAAATGG + Intronic
958777089 3:98498464-98498486 CCAAATTTGCTTGAAGAAGGAGG + Exonic
959265456 3:104131759-104131781 CTGTATTGGCAAGAAGGAGAGGG - Intergenic
959645158 3:108691070-108691092 CTGAAAGAGCTTGAAGCAGATGG + Intronic
962233850 3:133691710-133691732 CTTCATTTGCCTGAAAGAGAAGG - Intergenic
962974126 3:140431415-140431437 CTGAATTCTCTTTAAGGAAAAGG - Intronic
963284989 3:143425674-143425696 CTGAATTTGATTAGTGGAGATGG - Intronic
964645648 3:158956299-158956321 TTGAATGTCCTTGAAGGAGATGG + Intergenic
965810423 3:172586083-172586105 CTGAATTTTCTGGAAGGGGTTGG + Intergenic
966058550 3:175727504-175727526 GGCAATTTGCTTCAAGGAGAAGG - Intronic
967136015 3:186513173-186513195 CTGAGATCGTTTGAAGGAGATGG - Intergenic
967964946 3:194953690-194953712 CTGAGTTTTCTGGAAGAAGATGG + Intergenic
975257752 4:72257594-72257616 CTGAATTTGTGTGAAGAAGGAGG - Intergenic
975696854 4:77022252-77022274 CTGGATTTGAATGAAGGTGAGGG - Intronic
975911037 4:79267132-79267154 ATGAATTTGCTTCAGGAAGAAGG - Intronic
977572912 4:98648347-98648369 CTGATTTTTTTTGAAGGAGAAGG + Intronic
977573114 4:98650228-98650250 TTGAATTTTCAGGAAGGAGAAGG - Intronic
977702338 4:100034951-100034973 TAGAATTTGCTTGCAAGAGAGGG + Intergenic
981432340 4:144676184-144676206 CTGAATTTCTTGGAAGCAGATGG - Intronic
981638715 4:146911258-146911280 CAGAATTTACTGGGAGGAGAGGG + Intronic
982124437 4:152172335-152172357 CTGAATTTCCCTGCAGGCGAAGG - Intergenic
984377126 4:178945913-178945935 CTGAATTCATTTGAAGCAGAGGG + Intergenic
986789742 5:11148332-11148354 CTGAATTAGTTTGAATGAAAGGG + Intronic
987961470 5:24814585-24814607 CTGAATTTGGATGAGGAAGAGGG + Intergenic
988446184 5:31288429-31288451 TTGAACTTGCTTGAAGTACATGG - Intronic
989645706 5:43630320-43630342 TTGAATTTCCTACAAGGAGAAGG - Intronic
989657402 5:43759800-43759822 CTGAATGTGCCTGTAGGAGGTGG + Intergenic
990631518 5:57675530-57675552 CTGAAATTGCTAGAAGTGGAGGG - Intergenic
993881792 5:93371413-93371435 CTGAAGTTTCTTGAATGAGAAGG + Intergenic
994056531 5:95422879-95422901 CTGCTTTTGATTGAAGGGGAAGG - Intronic
994117576 5:96078290-96078312 CTGAAGTGGCCTGAGGGAGAAGG - Intergenic
998781047 5:145657119-145657141 CTGGACTTGCTGGAAGGAAATGG + Intronic
1000659325 5:163919016-163919038 CTGAAAGTGATTAAAGGAGAAGG - Intergenic
1002017648 5:176338068-176338090 CTGGATGTGATTGACGGAGAAGG + Intronic
1004653772 6:17638001-17638023 TAGAAATTCCTTGAAGGAGAAGG - Intronic
1005209670 6:23446123-23446145 CTGGATTTTCTAGACGGAGATGG - Intergenic
1007923927 6:45635761-45635783 CTGATTTTGCTTCAAGAAGAAGG - Intronic
1007955278 6:45912342-45912364 CTGAATTTTCTCCAAGGACAGGG + Intronic
1009353824 6:62714704-62714726 ATGAACATGCTTGAAGGAAATGG + Intergenic
1009790515 6:68395474-68395496 CTATATTTGCATGATGGAGATGG - Intergenic
1009907280 6:69885207-69885229 CTGATTTGGCTTGAAGGACCTGG - Intronic
1012572090 6:100742283-100742305 CTGAACGTGCCTGAAGGAGGTGG + Intronic
1013941826 6:115673142-115673164 CTGAACTTGCTTCAAGAAGTGGG + Intergenic
1016334160 6:142986337-142986359 CATAATTTGCATGAAGGGGAGGG - Intergenic
1016559893 6:145384307-145384329 CTGACTTTGCTTTAACAAGATGG + Intergenic
1018855110 6:167669407-167669429 GTGCATTGGCTGGAAGGAGAGGG - Intergenic
1018925769 6:168205964-168205986 CTGAACTGGCTTAAAGAAGAAGG - Intergenic
1019566825 7:1687020-1687042 CTGATTTTATTTGAAGCAGAAGG - Intergenic
1020331495 7:7021860-7021882 CTGAGTTTACTTGAAGGGGCAGG - Intergenic
1020921227 7:14267317-14267339 CTGAATCTACATGAAGAAGAAGG + Intronic
1021304795 7:19019414-19019436 TTAGATTTGCTTTAAGGAGATGG - Intergenic
1022606835 7:31823740-31823762 CTTAAGTTGCTGGAAGAAGATGG + Intronic
1024473091 7:49783460-49783482 GTGAGTTTGCATGAAGGATATGG + Intronic
1024930127 7:54660466-54660488 TTGAATTTGGGTGAAGGAGCTGG - Intergenic
1026078582 7:67196822-67196844 CTGAATTGGCTTGAATGAGATGG - Intronic
1026439179 7:70428453-70428475 CTGAAATTGCTTTTAGGTGAGGG + Intronic
1026698240 7:72615160-72615182 CTGAATTGGCTTGAATGAGATGG + Intronic
1028776004 7:94677144-94677166 CTTAATTTTCTTTAAGGACATGG - Intergenic
1029865667 7:103625350-103625372 CTAGATTTGGTTGAGGGAGAAGG - Intronic
1030873407 7:114785016-114785038 CTGAAATAGCTGGATGGAGATGG + Intergenic
1031417375 7:121509864-121509886 CAGCATTTGCTTGAAGGGGAGGG + Intergenic
1031601487 7:123716090-123716112 CTGAATTTGCAAGAAACAGAAGG - Intronic
1035317357 7:158004730-158004752 ATGCATTTGCTTGAAGGAGATGG - Intronic
1036063872 8:5356565-5356587 CTGGTTCTGCTTGATGGAGAGGG - Intergenic
1036111398 8:5906992-5907014 CTAAATTGGTTTGAAGGACATGG - Intergenic
1041776754 8:61531306-61531328 CTGAATTTGCTAGATGATGATGG + Intronic
1041819208 8:62010474-62010496 CTGCATTTGCTGGATGGGGATGG - Intergenic
1043114572 8:76234085-76234107 CTGAATTTGATAAAATGAGAGGG + Intergenic
1043140440 8:76581998-76582020 TTGTATTTGCTTAAAGGGGAAGG + Intergenic
1050078891 9:1893999-1894021 CTGATCTTGCTTTAAGGTGAGGG + Intergenic
1051702544 9:19839615-19839637 CTGAATTCGTTTGAAAGTGACGG + Intergenic
1055098217 9:72436427-72436449 CAGATTTTGCTGGAAGGATATGG + Intergenic
1055479929 9:76699498-76699520 CTGAAGTTTCCTGAAGAAGAAGG + Intronic
1056255242 9:84792463-84792485 CTGAATTTGACTGATGGTGAAGG - Intronic
1056653479 9:88489178-88489200 CTGAATTTTCTGGAAGGGGTTGG - Intergenic
1057808860 9:98241998-98242020 CTGAATTTGCTTGAGTGACTAGG - Intronic
1059224371 9:112658410-112658432 TTGAATTTTATTAAAGGAGAGGG + Intronic
1059715044 9:116905749-116905771 CTGAATTTCCTTGGAAGAGTGGG + Intronic
1059887032 9:118757785-118757807 ATGAATTTGATTGGAGGAGAGGG - Intergenic
1062709300 9:137965108-137965130 CTGAATGTGCCTGTAGGAGGTGG + Intronic
1203531861 Un_GL000213v1:152292-152314 ATGAATTTGCTGAAAGGAGTTGG - Intergenic
1185668263 X:1785678-1785700 TTGAATGTTCTGGAAGGAGATGG - Intergenic
1186344005 X:8672430-8672452 CTGAATTGGCTTGAAGCAGTGGG + Intronic
1186503682 X:10072894-10072916 CTGAATTTGCTTTCAGGTCAAGG - Intronic
1186780847 X:12910586-12910608 CAGAATTCGCCTGAAGGGGAGGG - Intronic
1187487813 X:19721135-19721157 CTGAATTTTCTTGATGCAAATGG + Intronic
1188172831 X:26949415-26949437 ATGAATTTGCTTAGATGAGAGGG - Intergenic
1190199040 X:48344660-48344682 CTCTATTTGCTTGGAGGATAAGG + Intergenic
1190204929 X:48395003-48395025 CTGTATTTGCATGGAGGATAAGG - Intergenic
1190205607 X:48400400-48400422 CTGTATTTGCATGGAGGATAAGG + Intergenic
1192111870 X:68373226-68373248 CTGAATTTGTTTGGAGAACAGGG + Intronic
1192793102 X:74403173-74403195 CTGAATTTGCTTCATAGAGATGG - Intergenic
1192804788 X:74499010-74499032 CAGACTTTGGATGAAGGAGAAGG + Intronic
1193062518 X:77221465-77221487 CTGGAAATGATTGAAGGAGATGG + Intergenic
1194351730 X:92829785-92829807 CTAAATTCGCTTAAAGGAGCTGG - Intergenic
1194733445 X:97483268-97483290 CTGAATTTCCTTGAAGCAATAGG + Intronic
1198277515 X:135110540-135110562 CAGCATTTGCTTGTATGAGAAGG + Intergenic
1198782199 X:140249606-140249628 CTGAATCTTGTTGAAGGCGAGGG + Intergenic
1200660045 Y:5946478-5946500 CTAAATTCGCTTAAAGGAGCTGG - Intergenic
1200716970 Y:6557486-6557508 TTGAATTTGCTTTCATGAGAGGG - Intergenic
1201908225 Y:19106541-19106563 CTGTATTTGCTTGAGGAAGGTGG + Intergenic
1202243875 Y:22796424-22796446 CTGAATTTTCTAGAAGAGGAAGG - Intergenic
1202396862 Y:24430174-24430196 CTGAATTTTCTAGAAGAGGAAGG - Intergenic
1202473921 Y:25239918-25239940 CTGAATTTTCTAGAAGAGGAAGG + Intergenic