ID: 1128053449

View in Genome Browser
Species Human (GRCh38)
Location 15:64682843-64682865
Sequence GCTTATATTGGCCCACATGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 83}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128053449_1128053459 29 Left 1128053449 15:64682843-64682865 CCTCCATGTGGGCCAATATAAGC 0: 1
1: 0
2: 2
3: 7
4: 83
Right 1128053459 15:64682895-64682917 GAGGGGCCACTGGCCATGGGAGG 0: 1
1: 1
2: 3
3: 41
4: 380
1128053449_1128053457 25 Left 1128053449 15:64682843-64682865 CCTCCATGTGGGCCAATATAAGC 0: 1
1: 0
2: 2
3: 7
4: 83
Right 1128053457 15:64682891-64682913 GTTTGAGGGGCCACTGGCCATGG 0: 1
1: 0
2: 1
3: 21
4: 158
1128053449_1128053454 11 Left 1128053449 15:64682843-64682865 CCTCCATGTGGGCCAATATAAGC 0: 1
1: 0
2: 2
3: 7
4: 83
Right 1128053454 15:64682877-64682899 GTAACACATATTTTGTTTGAGGG 0: 1
1: 0
2: 3
3: 24
4: 234
1128053449_1128053458 26 Left 1128053449 15:64682843-64682865 CCTCCATGTGGGCCAATATAAGC 0: 1
1: 0
2: 2
3: 7
4: 83
Right 1128053458 15:64682892-64682914 TTTGAGGGGCCACTGGCCATGGG 0: 1
1: 0
2: 3
3: 14
4: 136
1128053449_1128053453 10 Left 1128053449 15:64682843-64682865 CCTCCATGTGGGCCAATATAAGC 0: 1
1: 0
2: 2
3: 7
4: 83
Right 1128053453 15:64682876-64682898 GGTAACACATATTTTGTTTGAGG 0: 1
1: 0
2: 0
3: 21
4: 248
1128053449_1128053456 19 Left 1128053449 15:64682843-64682865 CCTCCATGTGGGCCAATATAAGC 0: 1
1: 0
2: 2
3: 7
4: 83
Right 1128053456 15:64682885-64682907 TATTTTGTTTGAGGGGCCACTGG 0: 1
1: 0
2: 0
3: 24
4: 160
1128053449_1128053455 12 Left 1128053449 15:64682843-64682865 CCTCCATGTGGGCCAATATAAGC 0: 1
1: 0
2: 2
3: 7
4: 83
Right 1128053455 15:64682878-64682900 TAACACATATTTTGTTTGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128053449 Original CRISPR GCTTATATTGGCCCACATGG AGG (reversed) Exonic
906469724 1:46118501-46118523 GCTTACAATGGCATACATGGTGG + Intronic
908154170 1:61335452-61335474 GCTTCTCTTTTCCCACATGGGGG - Intronic
1066155926 10:32677835-32677857 GCATATATTGGTTCACATGATGG + Intronic
1066808423 10:39289940-39289962 GCTTATTTTGGAGCACATTGAGG - Intergenic
1066958036 10:42191513-42191535 GCTTATATTGTCCTTCATAGGGG - Intergenic
1067257078 10:44651857-44651879 GCTTACATGGCTCCACATGGAGG + Intergenic
1070370574 10:75778273-75778295 GATCATCTTGGCCAACATGGTGG - Intronic
1070574241 10:77665493-77665515 ACTTAGATGGGCTCACATGGAGG - Intergenic
1073724441 10:106213391-106213413 TTTTGTATTGGCCCACATGCAGG - Intergenic
1074650646 10:115520703-115520725 TTATATATGGGCCCACATGGAGG - Intronic
1076831229 10:132995313-132995335 GCTGAGCTTGCCCCACATGGAGG - Intergenic
1076831242 10:132995376-132995398 GCTGAGCTTGCCCCACATGGAGG - Intergenic
1080907836 11:36564536-36564558 GCTTTTCTTTGCCCACACGGTGG + Intronic
1081007613 11:37766328-37766350 GCATATTTTGGCCCACTTGATGG + Intergenic
1081295817 11:41387800-41387822 GCTTATCTTGGCCAACACAGAGG - Intronic
1083386758 11:62316747-62316769 GCCTATAATGTGCCACATGGGGG + Intergenic
1084201591 11:67562487-67562509 GCTTATAATGGCCAAAATGGAGG + Intergenic
1085386945 11:76162938-76162960 GCCTCTACAGGCCCACATGGAGG - Intergenic
1099246638 12:80200603-80200625 GCTTAGATTCATCCACATGGAGG + Intergenic
1099867205 12:88297923-88297945 ACTTATATTGGCCTACATTTGGG + Intergenic
1105466561 13:20647708-20647730 GCATATATTGGTCCACTTGATGG - Intronic
1110477138 13:75929325-75929347 GATGATGTTGGCCCACATTGTGG - Intergenic
1115151489 14:30291315-30291337 ACTTATATGGGCCCTGATGGAGG + Intergenic
1117767925 14:59102127-59102149 ACTTAAATTGGCCCAAATTGAGG - Intergenic
1122099184 14:99393858-99393880 GCTTTTCTTGGCCCAAATGCAGG - Intergenic
1202935083 14_KI270725v1_random:80384-80406 GCTTATATTGTCCTTCATAGGGG + Intergenic
1128053449 15:64682843-64682865 GCTTATATTGGCCCACATGGAGG - Exonic
1133941961 16:10316809-10316831 AATTATATTGCCCCACATTGCGG - Intergenic
1136520405 16:30792062-30792084 GGATGTATTGGCCCAAATGGGGG - Intergenic
1137362774 16:47834824-47834846 GCCTGTATTGGTCCACTTGGTGG - Intergenic
1151751754 17:76042960-76042982 GCAGATATTGGCCAGCATGGTGG + Intronic
1153198861 18:2629459-2629481 GTATATATTGGCCCATATGCTGG + Intergenic
1153656319 18:7285715-7285737 GCCCACATTGGCCCACATGCTGG - Intergenic
1155762447 18:29584953-29584975 GCCTATATTGGGCCACTTGATGG - Intergenic
1158915080 18:62116660-62116682 CATTATCTTGGCCCACATGGAGG - Intronic
1161721707 19:5906255-5906277 GCTGATATGGGCCAGCATGGTGG - Intronic
1167307663 19:48718685-48718707 GCTTATACTGGCGCACACGCAGG - Intronic
926011103 2:9408625-9408647 AAATAAATTGGCCCACATGGTGG - Intronic
927019835 2:19005034-19005056 CCTAATATTGGCCCACAGAGAGG - Intergenic
929156679 2:38794570-38794592 GCTTATTTTCCCCCACATGCAGG + Intergenic
931955033 2:67413535-67413557 GATTGTATTAGCCCACATAGAGG + Intergenic
933812482 2:86041659-86041681 CCCTATCTTGGCCCAGATGGGGG + Intronic
934465485 2:94259407-94259429 GCTTATATTGTCCTTCATAGGGG + Intergenic
935147420 2:100405387-100405409 CCTGAAATTAGCCCACATGGTGG - Intronic
940498611 2:154465929-154465951 GCATAAACTGGCTCACATGGAGG + Intergenic
941746358 2:169090970-169090992 ACTTACATTGGCCCACAATGGGG - Intronic
943357909 2:186881694-186881716 GCATATATTGGTCCACTTGATGG + Intergenic
1176596504 21:8702610-8702632 GCTTATATTGTCCTTCATAGGGG + Intergenic
1176658590 21:9612886-9612908 GATTCTCTTGTCCCACATGGTGG + Intergenic
1179464348 21:41561856-41561878 GCTCATTCTGGCCCCCATGGTGG - Intergenic
1180279417 22:10680058-10680080 GCTTATATTGTCCATCATAGGGG + Intergenic
1180586630 22:16898593-16898615 GCTTATATTGTCCTTCATAGGGG + Intergenic
1182398666 22:30056996-30057018 GCATATATTGGCCTACTTGATGG - Intergenic
955261788 3:57398298-57398320 GCATATATTGGTCCACTTGATGG - Intronic
967025233 3:185558917-185558939 GCTAATATAGGCCAGCATGGTGG + Intergenic
968848838 4:3063822-3063844 TCTTTTATTGGCCAGCATGGGGG - Intergenic
974647297 4:64711602-64711624 GCTTATTTTGGCTCGCATGGGGG + Intergenic
975592503 4:76014560-76014582 GCATATATTGGTCCACTTGATGG - Intronic
976354695 4:84103660-84103682 GATTATCTTGGCCAACATAGTGG + Intergenic
977026510 4:91825377-91825399 ACATATATTGGCCCACTTGATGG + Intergenic
982854975 4:160370327-160370349 GCCTGTATTTGCCCACAAGGTGG + Intergenic
984537158 4:180990667-180990689 GCTTATATTAGACCACATTCAGG + Intergenic
993542671 5:89171946-89171968 GCATATATTGGCTCATGTGGTGG + Intergenic
994921999 5:106058024-106058046 GTTAATTTTGGCCAACATGGTGG - Intergenic
995839481 5:116430136-116430158 GCACATATTGGCACACATGGTGG - Intergenic
1002771737 6:295902-295924 CCTTATATTTGCCCAGATTGGGG + Intronic
1012537055 6:100311928-100311950 GCTAATATTGGCTGTCATGGAGG - Intergenic
1018308340 6:162481837-162481859 GCTTATGTTGGCCCATATAAAGG - Intronic
1020465946 7:8479775-8479797 GCTTAAATTGTCCCAATTGGAGG - Intronic
1024724889 7:52181888-52181910 GATTAAATTGGCCTCCATGGAGG + Intergenic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1031870648 7:127086936-127086958 GCATATGTTGGCCCACAGGGAGG + Intronic
1032255427 7:130293320-130293342 GCTGATAATAGCTCACATGGAGG + Intronic
1033169602 7:139071935-139071957 TCCTATAGTGGGCCACATGGCGG - Intronic
1033341272 7:140494084-140494106 GATTACCTTGGCCAACATGGTGG + Intergenic
1033650818 7:143342032-143342054 TGTTATCTTGGCCAACATGGTGG + Exonic
1034293130 7:149948017-149948039 CCTTATATTGACCCACATGGTGG + Intergenic
1034812942 7:154148862-154148884 CCTTATATTGACCCACATGGTGG - Intronic
1035767701 8:2120107-2120129 GCTCGTAGTGGCCCACATAGGGG + Intronic
1037189466 8:16105071-16105093 GCATATTTTGGCCCACTTGATGG + Intergenic
1051703984 9:19856950-19856972 GTTTAAATATGCCCACATGGCGG - Intergenic
1051709647 9:19918730-19918752 GCTTTTCTTGGACCACATGTGGG - Intergenic
1051992954 9:23175405-23175427 GCTTATTTTGGCCAATATGCAGG - Intergenic
1053942541 9:43267235-43267257 GCTTATATTGTCCTTCATAGGGG + Intergenic
1054405528 9:64759400-64759422 GCTTATATTGTCCTTCATAGGGG + Intergenic
1054439153 9:65244889-65244911 GCTTATATTGTCCTTCATAGGGG + Intergenic
1054491253 9:65777052-65777074 GCTTATATTGTCCTTCATAGGGG - Intergenic
1057300382 9:93875438-93875460 GCATATGTTGGTCCACTTGGTGG - Intergenic
1060674226 9:125497807-125497829 GCTTATATTGGCCCTGATGATGG + Intronic
1203636318 Un_KI270750v1:116465-116487 GATTCTCTTGTCCCACATGGTGG + Intergenic
1196107931 X:111916188-111916210 GCTCATATTGACCCAAATTGTGG - Intronic
1197210185 X:123821846-123821868 TCTTATAGTGGCCCACGTAGTGG + Intergenic
1201193327 Y:11468086-11468108 GCTTATATTGGCCTTCATAGGGG + Intergenic