ID: 1128055907

View in Genome Browser
Species Human (GRCh38)
Location 15:64700035-64700057
Sequence CAGGCTCCTCCACTTGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128055907_1128055915 8 Left 1128055907 15:64700035-64700057 CCCAGGCCAAGTGGAGGAGCCTG 0: 1
1: 0
2: 3
3: 31
4: 273
Right 1128055915 15:64700066-64700088 CCTAGCTCCTACCCAGGCCCTGG 0: 1
1: 0
2: 3
3: 36
4: 381
1128055907_1128055920 20 Left 1128055907 15:64700035-64700057 CCCAGGCCAAGTGGAGGAGCCTG 0: 1
1: 0
2: 3
3: 31
4: 273
Right 1128055920 15:64700078-64700100 CCAGGCCCTGGCAGGCCAGTTGG 0: 1
1: 0
2: 2
3: 59
4: 423
1128055907_1128055913 2 Left 1128055907 15:64700035-64700057 CCCAGGCCAAGTGGAGGAGCCTG 0: 1
1: 0
2: 3
3: 31
4: 273
Right 1128055913 15:64700060-64700082 CCAAGGCCTAGCTCCTACCCAGG 0: 1
1: 0
2: 0
3: 19
4: 187
1128055907_1128055916 12 Left 1128055907 15:64700035-64700057 CCCAGGCCAAGTGGAGGAGCCTG 0: 1
1: 0
2: 3
3: 31
4: 273
Right 1128055916 15:64700070-64700092 GCTCCTACCCAGGCCCTGGCAGG 0: 1
1: 0
2: 1
3: 54
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128055907 Original CRISPR CAGGCTCCTCCACTTGGCCT GGG (reversed) Intronic
900289748 1:1918904-1918926 CAGGCTGCTCCAGCGGGCCTGGG + Exonic
900675213 1:3881143-3881165 CAGGCTCCCTCACATGGCCATGG - Intronic
900706351 1:4082565-4082587 CAGGCTCCTGCCATTGCCCTGGG + Intergenic
900791077 1:4681350-4681372 CAGCCTCCTTTCCTTGGCCTGGG - Intronic
901000779 1:6147875-6147897 AAGGCTCCTCCACTGGCTCTTGG + Intronic
901202154 1:7473018-7473040 CAGGCTTCCCCACAAGGCCTGGG + Intronic
901258972 1:7857183-7857205 CCTGCTCCTCCACTTTTCCTGGG - Intergenic
903465380 1:23548816-23548838 CAGGCTCTGACACTTGGGCTAGG + Intergenic
903849470 1:26297367-26297389 CAGGCACCTCCCCTGGGCCCAGG - Intronic
904317502 1:29675202-29675224 CAGGGTCCTGCACATGGCCTGGG + Intergenic
904445874 1:30572578-30572600 CAGCCTCCTCCACTGGCCCACGG + Intergenic
905778220 1:40684672-40684694 CAGGCGCACCCACTTGGCCATGG + Intergenic
905861390 1:41354290-41354312 CTGTCTGCTCCATTTGGCCTGGG + Intergenic
906207092 1:43992556-43992578 CAGGGTCCTGCACTTTGCCTTGG + Exonic
907332609 1:53681079-53681101 CAGGCCCCTCTTCTCGGCCTTGG + Intronic
911154181 1:94623016-94623038 CAGGCAGCTCCACCAGGCCTGGG - Intergenic
911292685 1:96077070-96077092 CTGGCTCCTCCACTTGAGCTGGG + Intergenic
912542251 1:110425852-110425874 CCGGCTACTTCACTTGGCCATGG + Intergenic
913486620 1:119337442-119337464 CAGGCTGCTTCTCTTGCCCTGGG + Intergenic
916889833 1:169104971-169104993 CAGCCTCCCCCACTGGGGCTTGG + Intergenic
917373806 1:174325908-174325930 CTGGCTCTCCCACATGGCCTAGG + Intronic
917477965 1:175385150-175385172 CAGTCTCATCCTCTTTGCCTTGG - Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918996505 1:191768190-191768212 CAGTCTCCTTCACTTGCCCTTGG - Intergenic
920849419 1:209618519-209618541 CAGGCTCCCCAACGTGGACTTGG - Exonic
920976194 1:210787631-210787653 CAGGTTCTTGCACTTGGACTGGG - Intronic
922595616 1:226810639-226810661 CACCGTCCTCCACTTGGCATGGG - Intergenic
1063679358 10:8172234-8172256 CAAGCTCCCCCACATGGCATTGG - Intergenic
1066366524 10:34782305-34782327 CAGCCTCCTCCACTGGGCGCTGG + Intronic
1067802464 10:49368469-49368491 CTGGCTGCTCCACTTCTCCTAGG + Intronic
1069473744 10:68715253-68715275 CAGGCTCCTCACCTTGACCTAGG - Intergenic
1069836666 10:71313544-71313566 CTTCCTCCTCCACTTGGCCCAGG - Intergenic
1070587797 10:77779850-77779872 CAGAGACCTCCCCTTGGCCTAGG + Intergenic
1073111320 10:101064602-101064624 CAGGGGCCTCCACTTGACCCAGG - Exonic
1075442050 10:122487723-122487745 CAGGCTCTGCCATCTGGCCTAGG - Intronic
1076126160 10:127975780-127975802 CTCGCTCCTCCAATTGGGCTCGG - Intronic
1076263047 10:129086218-129086240 CAGGCTAAACCACATGGCCTAGG + Intergenic
1077117876 11:893485-893507 CATGCTCACCCACTTGGCCGAGG - Exonic
1077169562 11:1160182-1160204 CAGGGTCCTCCAGGTGGTCTTGG + Intronic
1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG + Intergenic
1078254705 11:9648112-9648134 CAGGCTCTGCCTCTTGCCCTTGG + Intergenic
1078514253 11:12009061-12009083 CAGCCCCCTCCCCTTGGCGTCGG + Exonic
1079411655 11:20193259-20193281 CAGGCTCCCCCACTTAGCCGTGG - Intergenic
1080516327 11:33024577-33024599 CAGGCTACACCACATAGCCTAGG - Intronic
1080896661 11:36453880-36453902 CAAGCTCCTCCCCTTGGCCTGGG - Intronic
1082961014 11:58918923-58918945 CTGGCTGGTCCACTTGTCCTGGG + Intronic
1083737196 11:64688169-64688191 CTCGTTTCTCCACTTGGCCTTGG - Intronic
1083889780 11:65589964-65589986 CAGCCTCCTCCCCTGGGCTTGGG - Exonic
1084657702 11:70528762-70528784 CACCCTCCCCCACTTGGCGTAGG - Intronic
1084673640 11:70622016-70622038 CAGGCCCCTCCACATGGCGCTGG - Intronic
1084760210 11:71266113-71266135 CAGCCTCCTCCACCTGCCTTGGG + Intergenic
1084945175 11:72634401-72634423 CAGCCTCCCCCACTTCCCCTGGG - Intronic
1085815754 11:79735438-79735460 CAGGCTCCTCTACTTGAGCCTGG + Intergenic
1086110676 11:83194690-83194712 CAGGCCCCTCCACTTCCTCTAGG + Exonic
1086600678 11:88629655-88629677 CTGTCTCCTCCAATTGCCCTTGG + Intronic
1088798383 11:113283821-113283843 CAGGATTCTGCACTTGGCATTGG - Intergenic
1088833348 11:113556813-113556835 CAGGCTCCTCCAAGATGCCTTGG - Intergenic
1089046490 11:115505145-115505167 CAGGCTCCTCCGCTTGTCGAGGG + Intergenic
1089144144 11:116312126-116312148 CCGGCTCCTTCACTGGGCCGTGG + Intergenic
1089508548 11:118980783-118980805 CAGGCTTCCACACTTGGCCTTGG - Intronic
1089596926 11:119586357-119586379 CAGAGACCTCCCCTTGGCCTAGG - Intergenic
1096363011 12:51004489-51004511 CATCCTCCTCCCCTTGGGCTGGG + Intronic
1096673020 12:53211357-53211379 CAGGGTCTTCCTCTTGCCCTGGG + Exonic
1097955828 12:65484324-65484346 CAGGGTCCTGCACCTGGCCCAGG + Intronic
1098291684 12:68962598-68962620 CAGACTCCTCCTCTTGGCAAGGG + Intronic
1101678311 12:106939953-106939975 CAGACCCCTCCTCTTGGCCAAGG - Intergenic
1102579356 12:113876353-113876375 CTCTCTCCTCCACTTGGCCTCGG + Intronic
1104084038 12:125458233-125458255 CAGGCTCCATCCCTTGTCCTTGG - Intronic
1104148183 12:126055537-126055559 CAGGCTTCCCCACATGCCCTGGG - Intergenic
1104801165 12:131556055-131556077 CAGGCAGCTCCACCCGGCCTCGG - Intergenic
1107711556 13:43155168-43155190 CAGGTTCATGGACTTGGCCTTGG - Intergenic
1108575597 13:51787561-51787583 CTGGCTCCTTCACTTGACCTTGG + Intronic
1109531860 13:63660104-63660126 CATGTCCCTGCACTTGGCCTGGG - Intergenic
1113465387 13:110508902-110508924 GAGGCTCCTCAACTTGGAATAGG + Intronic
1113593994 13:111518567-111518589 CAGGCTCCACCACACGGCCTAGG - Intergenic
1113971868 13:114197480-114197502 CAGACCCCTCCTCTTGGCCAAGG - Intergenic
1118892893 14:69924536-69924558 CAGACTCCTCACCATGGCCTGGG + Intronic
1120163021 14:81165520-81165542 CATGCTCCTCCATGTGGCCTGGG - Intergenic
1121643974 14:95505128-95505150 CCGGCTCCTTCACTTGTGCTTGG - Intergenic
1122347150 14:101067621-101067643 CAGGCCCCTTCCCTTGGGCTTGG + Intergenic
1122406691 14:101505150-101505172 CACGCACCTCAACGTGGCCTTGG + Intergenic
1122882823 14:104697670-104697692 CAGGGTCCCCCTCTGGGCCTGGG - Intronic
1124003142 15:25776284-25776306 CGGGTTCCTCCACTTTGCGTGGG - Intronic
1124110762 15:26783980-26784002 CATGCCACTGCACTTGGCCTGGG - Intronic
1124156772 15:27233028-27233050 CAGGCACCTCCTCTTGTCCCTGG + Intronic
1124997734 15:34740101-34740123 CAGGCTCCTTCTCTGTGCCTGGG - Intergenic
1125404163 15:39335532-39335554 CAGGCTCCTCTTCTTGGACCTGG - Intergenic
1125420656 15:39501112-39501134 CAGCCACCTCCTTTTGGCCTCGG + Intergenic
1125606937 15:40944795-40944817 CAGCCTTCCCCACTTGGCCCTGG + Intergenic
1125907180 15:43403748-43403770 CACGCTCATCCAGTGGGCCTAGG - Exonic
1126666164 15:51077789-51077811 CAGGCTCCTCCCCCTGCCCAAGG - Intronic
1126736197 15:51734311-51734333 CATGTTCCTCAAATTGGCCTGGG - Intronic
1126780863 15:52137841-52137863 CTGGCTGCTCCACAGGGCCTGGG + Intronic
1128055907 15:64700035-64700057 CAGGCTCCTCCACTTGGCCTGGG - Intronic
1129537583 15:76326785-76326807 CATGCCACTGCACTTGGCCTGGG - Intergenic
1129614113 15:77084354-77084376 CTGGCTTCTCCTCTTGGCCTCGG + Intergenic
1132983173 16:2749603-2749625 CAGGGTCCTCCACCAGGCCATGG + Intergenic
1133092288 16:3413887-3413909 CCGCCTCCTCCTCTGGGCCTGGG + Intronic
1133267200 16:4592243-4592265 CAGCCTCCCACACATGGCCTGGG + Intronic
1133916458 16:10113334-10113356 CAGAGACCTCCTCTTGGCCTAGG - Intronic
1134245748 16:12538682-12538704 CAGGCTCGCCCACTGGTCCTGGG - Intronic
1135961328 16:26996770-26996792 CAGACTCCTCCACATCGCATAGG + Intergenic
1136109003 16:28052978-28053000 CAGGCAGCTCCACTTGGCCCGGG - Intronic
1138203633 16:55108209-55108231 CAGGGTCCTGAACCTGGCCTAGG - Intergenic
1138924682 16:61576612-61576634 CATGCTCCTCTACCTGGCTTTGG - Intergenic
1139465533 16:67151966-67151988 CAGGCTCCACCACATGGGCTGGG - Intergenic
1140342044 16:74173993-74174015 GAGTCTCCTGCACTTGGACTTGG - Intergenic
1140752732 16:78040613-78040635 TAGGCTACACCACATGGCCTAGG - Intronic
1141646621 16:85371141-85371163 CAGTCAGCTCCCCTTGGCCTGGG - Intergenic
1141733039 16:85834976-85834998 CTGGCTCCTGCACCTGCCCTGGG - Intergenic
1141905593 16:87024016-87024038 CAGGCTCCACCATCTAGCCTGGG + Intergenic
1142144424 16:88487009-88487031 CAGGCACCTCCACATTCCCTGGG + Intronic
1142478408 17:203485-203507 CAGGCTCTCCCACATAGCCTAGG + Intergenic
1142856931 17:2736043-2736065 CAGGCTCCTCCAAGTGGCAGAGG + Intergenic
1144209563 17:13002982-13003004 CATACTCCTCCACCTGGCCCTGG + Intronic
1145019367 17:19417489-19417511 CAGGCTCTTCCACTAGGACTTGG + Intergenic
1145247175 17:21276926-21276948 CAGCTTCCTCCACTCTGCCTAGG + Intergenic
1145988890 17:29066205-29066227 CAGGCTGCTCCACCTGTTCTCGG - Intergenic
1146285371 17:31571048-31571070 AAGGCAACTCCACTTGGCCAGGG - Intergenic
1147987162 17:44313242-44313264 CAGGCCCCTCACCTTGGCCCGGG - Exonic
1148019091 17:44541876-44541898 CAGCATCCTCCACTTGGCCGAGG - Intergenic
1148064321 17:44857672-44857694 GAGGGTCCTCCACAGGGCCTTGG + Intronic
1148175260 17:45558404-45558426 CAGGCTCCTCCACCAAGCCAAGG + Intergenic
1148296111 17:46504590-46504612 CAGGCTCCTCCACCAAGCCAAGG - Intergenic
1150226930 17:63529388-63529410 CAGGCTGCTGCTCTGGGCCTAGG - Intronic
1150321402 17:64217338-64217360 CAGGTCCTTCCTCTTGGCCTTGG - Intronic
1150406477 17:64905348-64905370 CAGGCTCCTCCACCAAGCCAAGG + Intronic
1151274695 17:73025221-73025243 CTGTCTCCTCCACGTGGACTTGG - Intronic
1151843193 17:76632295-76632317 CAGGCACCTTAACTTGGCCGTGG + Intronic
1151973499 17:77471230-77471252 CAGGCTCCTACTCATGGCCCAGG + Intronic
1152289355 17:79430018-79430040 CAGGCTCCCCCACCTCGCCTCGG - Intronic
1152637680 17:81436788-81436810 CAGGTTCCCAGACTTGGCCTGGG + Intronic
1152754722 17:82082469-82082491 CAGGGTCCCCCCCTTGGTCTTGG + Intronic
1152816267 17:82409976-82409998 CAGGCTCCTGAGCTTGGCCCAGG - Intronic
1152871443 17:82755686-82755708 CAGACCCCTCCTCTTGGCCAAGG - Intronic
1152876940 17:82791858-82791880 CAGGCCGCACCACCTGGCCTGGG - Intronic
1153085243 18:1278568-1278590 CATGCTCCTCCAGATGGCTTTGG + Intergenic
1154494130 18:14943624-14943646 TAGGCTCCACCATCTGGCCTGGG + Intergenic
1155977805 18:32150415-32150437 CACACTACTGCACTTGGCCTGGG - Intronic
1158276005 18:55768263-55768285 CAGGAGCCTCCACTGGGCTTTGG + Intergenic
1158499006 18:57983270-57983292 CTGCCTCCTCCACCTGCCCTTGG - Intergenic
1160714079 19:567585-567607 CTGGCTGGTCCACTTGTCCTGGG + Intergenic
1160810440 19:1010795-1010817 CAGGCGCCGCCACTGGGCCCCGG - Exonic
1161581576 19:5083592-5083614 CAGGCTCGGCCACGTGGCCCTGG + Intronic
1161898265 19:7099037-7099059 TCGGCTCCTCCCATTGGCCTTGG - Intergenic
1161902060 19:7126325-7126347 CAGGGTCGACCACTTGGGCTGGG - Intronic
1162228400 19:9243945-9243967 CAGGCTCCTGCACAGGGACTGGG - Intergenic
1162497411 19:11030980-11031002 CAGCCTCCTCCACATTGTCTTGG + Intronic
1162763365 19:12902152-12902174 TAGGCTCTTCCACGTAGCCTAGG + Intronic
1163748176 19:19060262-19060284 CAGCGTCCTCCCCTGGGCCTGGG + Intronic
1165227856 19:34366778-34366800 CACGCCCCTGGACTTGGCCTAGG - Exonic
1165403634 19:35617345-35617367 GAGGCTGCCCCTCTTGGCCTGGG - Exonic
1165419891 19:35717604-35717626 CAGGCTCCTCCCATTGTTCTTGG - Intergenic
1166391626 19:42411732-42411754 CAGGCTTGTCCACTGGTCCTGGG + Intronic
1167687344 19:50964781-50964803 TGGGCTCCTCCACTTGGCACTGG + Intronic
1167709663 19:51102621-51102643 CAGGTTCCTCGCCATGGCCTGGG + Intronic
925190724 2:1881194-1881216 TAGCCTCTTCCACTGGGCCTAGG + Intronic
925276342 2:2650984-2651006 CAGGATCCTGCCCTTGGCATCGG - Intergenic
925293764 2:2764895-2764917 CAGGCTGCACCACGTGGCCCAGG + Intergenic
925361804 2:3285192-3285214 CAGGTTCTTCCTCTTGGGCTGGG - Intronic
925975461 2:9138980-9139002 CAGGCTCCCCCGCTGGGCCAGGG + Intergenic
926221305 2:10937315-10937337 CAGACTAACCCACTTGGCCTTGG - Intergenic
926703371 2:15819044-15819066 CTGGCTCCATCACTTGACCTTGG + Intergenic
927889564 2:26739857-26739879 CAGCCTCCTCCCCTGGGCCAGGG - Intergenic
928840601 2:35600017-35600039 CTTGCCACTCCACTTGGCCTAGG + Intergenic
931857324 2:66316831-66316853 CTGGTCCATCCACTTGGCCTTGG - Intergenic
932429780 2:71667401-71667423 GACGCTCCTCCACTGGGCCCAGG - Exonic
932749595 2:74362938-74362960 CTGCCCCCTCCACTTGGCCCAGG - Intronic
933887554 2:86733729-86733751 CAGGCTCATGCATTGGGCCTGGG + Intronic
933922623 2:87062983-87063005 CAGGCTCATGCATTGGGCCTGGG - Intergenic
934559799 2:95307153-95307175 CAGGCTCCTCCATCTGGCTGAGG - Intronic
934845039 2:97657060-97657082 CACCCACCTCCACGTGGCCTAGG + Intronic
935149027 2:100417403-100417425 TAGGCTCCTCCCCTGGCCCTGGG + Exonic
935540044 2:104338153-104338175 CATGCTTCTCCATTTGGCTTGGG - Intergenic
936261602 2:110964586-110964608 TAGGCTCCACCACATAGCCTAGG - Intronic
936489303 2:112956713-112956735 CACCCTCCTCCACTTGGGCCGGG - Intergenic
937103585 2:119290251-119290273 CAGCCTCCTCCATTTGGCCCAGG - Intergenic
937911148 2:127076133-127076155 CAGCCATCTCCAATTGGCCTGGG - Intronic
938093669 2:128448433-128448455 CAGGCTGCGCCACAGGGCCTTGG + Intergenic
938657449 2:133448681-133448703 CATGCCACTGCACTTGGCCTGGG - Intronic
940961230 2:159788415-159788437 TAGGCTCCAGCACGTGGCCTAGG + Intronic
942322291 2:174746179-174746201 CACCCTCCTCCTCTTGCCCTTGG + Intergenic
944581541 2:201137041-201137063 CAGAGACCTCCCCTTGGCCTAGG + Intronic
944874258 2:203945569-203945591 TAGGCTACTCCACATAGCCTAGG - Intronic
944929349 2:204500657-204500679 CAGGCTCATCCCCTGAGCCTGGG - Intergenic
945770284 2:214034522-214034544 CTTGCTGCTCCACTTGCCCTTGG - Intronic
946522293 2:220479499-220479521 CAGGCTGCTGCACTCAGCCTGGG + Intergenic
947441429 2:230125207-230125229 CAGGCTCCTCCACTTCCTCTTGG + Intergenic
947864158 2:233384608-233384630 CTGTCTCCTCCCCTTCGCCTCGG + Intronic
948423878 2:237876179-237876201 CAGTCTCCGGCACGTGGCCTGGG - Intronic
948853264 2:240718579-240718601 CAGGCTCCTGAACTTGTCCAGGG + Intronic
949060519 2:241953850-241953872 CTGGCTCCTCCCCCCGGCCTGGG - Intergenic
949076145 2:242059337-242059359 CAGACTCCTCCCCTTGGCCAAGG + Intergenic
1169883914 20:10376723-10376745 ATGGCTTCTCCACCTGGCCTGGG - Intergenic
1171196775 20:23206053-23206075 CAGGCTCCTGCACCTGGTCAGGG - Intergenic
1172292984 20:33789441-33789463 CTGGCCCCTCCACTAGCCCTGGG - Intronic
1172655176 20:36532463-36532485 CAGTCTCCTCACCTTGGCCTTGG + Intergenic
1174163470 20:48568099-48568121 CAAGCTCCTCACCATGGCCTTGG - Intergenic
1174318421 20:49721003-49721025 GTGGCCTCTCCACTTGGCCTGGG - Intergenic
1175147211 20:56905960-56905982 GAGCCTTCTCCACCTGGCCTGGG - Intergenic
1176066201 20:63197309-63197331 CATGCTCTTCCCCTTGGCGTGGG - Intronic
1177914731 21:27074840-27074862 CAGGCTTCTGCTCTTGGACTGGG - Intergenic
1180019302 21:45111175-45111197 CAGGCTCCTCCTGTTGGCGTGGG + Intronic
1183077400 22:35435726-35435748 CAGCCTCCCTAACTTGGCCTTGG + Intergenic
1183338926 22:37267295-37267317 CTGGCTCCTCCTGTGGGCCTCGG + Intergenic
1183364789 22:37401115-37401137 CAGGCAGCCCCACCTGGCCTAGG - Intronic
1184649927 22:45915080-45915102 CACACTCCTCCTCTAGGCCTCGG - Intergenic
950634266 3:14303881-14303903 CTGGCTCCTCCCCTTGGCTTTGG + Intergenic
952233515 3:31455718-31455740 AAGGCTCCTCCCCCTGGCCCCGG - Intergenic
954681696 3:52349538-52349560 CCAGCTCCTTCCCTTGGCCTGGG - Intronic
956523421 3:70130680-70130702 CTGGCTTCTCCATGTGGCCTGGG - Intergenic
956744284 3:72299322-72299344 GAGGCTCCTGAACATGGCCTTGG + Intergenic
961602247 3:128071230-128071252 CAGGCTCCTCCATATGGCCCAGG + Exonic
961715668 3:128855844-128855866 CTGGCTGGTCCACTTGTCCTGGG + Intergenic
962285967 3:134085749-134085771 CAGGCTCCTCTACCTGCCCTGGG + Intronic
965487750 3:169299292-169299314 CCAGCCCCTCCTCTTGGCCTCGG - Intronic
967219662 3:187237801-187237823 CAGGCTACACTCCTTGGCCTGGG + Intronic
967265800 3:187691233-187691255 CCTTCTTCTCCACTTGGCCTGGG + Intergenic
967367571 3:188705012-188705034 CAGGGTCCTTCACTTGGCCTGGG + Intronic
968291492 3:197542952-197542974 CAGGCTCTTCCACAGGGCCTTGG - Intronic
968489291 4:881441-881463 CAGCCTCCTCCACACGGCCAGGG + Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
968983869 4:3865104-3865126 CAGGCCCCTCCACAGGGCCTGGG - Intergenic
969717644 4:8875770-8875792 CGGCCTCCTCCACTTGTCCTGGG - Intergenic
970212035 4:13720044-13720066 CAGGTTTCGCCACTTTGCCTAGG + Intergenic
971108974 4:23561127-23561149 CAACCCCCTCCACTTTGCCTTGG - Intergenic
971257595 4:25029403-25029425 CAGGCCCCTACAATTTGCCTTGG + Intronic
973948154 4:55981940-55981962 CAGGCTCCTCAACTTATACTGGG + Intronic
977591417 4:98831838-98831860 CAGTCTCATTCACTTGGGCTGGG + Intergenic
978172171 4:105686201-105686223 CAGGCACCGCCACTATGCCTGGG + Intronic
978385647 4:108173151-108173173 CAGGCGCCTGAACTTGGCATGGG + Intergenic
981979782 4:150777135-150777157 CATGCCCCTGCACTTTGCCTGGG - Intronic
984619596 4:181937281-181937303 CAAACTCTTCCTCTTGGCCTAGG - Intergenic
985257654 4:188085586-188085608 CAGGCTACACCACATAGCCTAGG - Intergenic
993431956 5:87842676-87842698 CAGGCAACACCACTTGTCCTTGG + Intergenic
995237658 5:109848622-109848644 CAGGTCCCACCACTTGTCCTTGG + Intronic
995478558 5:112572397-112572419 CAATCTCCTCCACTTGGCCTAGG + Intergenic
996769788 5:127073816-127073838 CTGCCTCCTCCACTAGGTCTTGG + Intergenic
997626763 5:135336437-135336459 CAGGCTCCTTCACATAGGCTGGG - Intronic
998132962 5:139660385-139660407 CAGGCTCCTCCAATCTGCCCTGG - Intronic
998390306 5:141783123-141783145 CAGGCTGCCCCACTGGCCCTAGG - Intergenic
999735032 5:154506549-154506571 CAGGCTCCGCCCCTGGGACTGGG - Intergenic
1000121601 5:158203273-158203295 AAGGCTCCTGCCATTGGCCTGGG + Intergenic
1000472376 5:161661043-161661065 CTCGCTGCTCCACTTGTCCTTGG + Intronic
1001339746 5:170832317-170832339 CACGCTCCTCCACTTTTCCTTGG + Intergenic
1002459362 5:179365317-179365339 CTGGCCTCTCCACTAGGCCTGGG - Intergenic
1002466260 5:179410353-179410375 CAGGCCCCTCCTCTGGGCGTGGG - Intergenic
1003377753 6:5594974-5594996 GAGGATCCTCCAGTTGGCCCTGG - Intronic
1006188214 6:32192194-32192216 CAAACTCCACCACTCGGCCTTGG - Exonic
1006294261 6:33163009-33163031 CTGTCTCTTCCACTTGGTCTGGG - Exonic
1008354509 6:50535389-50535411 CAAGATCCTCCACTTGACCCTGG + Intergenic
1010544478 6:77133538-77133560 AAGGCTCCTCCACTCTGGCTGGG - Intergenic
1011249265 6:85353776-85353798 AAGCCTCCTCCACTTGCCATGGG + Intergenic
1012218204 6:96614869-96614891 CAGCCTCCTCCACTTTAACTTGG - Intronic
1012410288 6:98948137-98948159 AAAGCTCCTCCCCCTGGCCTGGG - Intergenic
1012432386 6:99178293-99178315 CAGACTCCTCCTCTTGGCCAAGG + Intergenic
1014222823 6:118815540-118815562 CAGGCTCTTCCACTTGCGCAAGG + Exonic
1019269500 7:139187-139209 CAGGCCCCTCCTCTGGGTCTTGG - Intergenic
1019306503 7:337850-337872 CAGGCTCCTCCACTGGTCCAGGG - Intergenic
1019306539 7:337982-338004 CAGGCTCCTCCGCTGGTCCAGGG - Intergenic
1022622842 7:32002405-32002427 TAGTCTCCTCCACATGACCTTGG + Intronic
1024626342 7:51211117-51211139 CAGCCTCTTCCACTTGCCCATGG - Intronic
1028860369 7:95642289-95642311 CTTCCTCCTCCACTTGTCCTTGG + Intergenic
1029527597 7:101104501-101104523 GGGGCTCCTGCACTTGGCCAGGG + Intergenic
1029652495 7:101903139-101903161 CCTGCCCCTCCTCTTGGCCTCGG - Intronic
1030353845 7:108521867-108521889 CAGACCCCTCCTCTTGGCCAAGG + Intronic
1030515669 7:110534670-110534692 CAGGCTTCTCCCCGGGGCCTGGG + Intergenic
1032018103 7:128392533-128392555 CAGAGACCTCCCCTTGGCCTAGG + Exonic
1032804129 7:135339000-135339022 CAGGCTCTTCCTCTTGGCTGGGG - Intergenic
1033097362 7:138442675-138442697 CAGAGACCTCCCCTTGGCCTAGG - Intergenic
1034391741 7:150792554-150792576 ATGGCTTCTCCACTTGGCTTGGG - Intronic
1035783605 8:2247214-2247236 CTGGCTCCTCCTCTTGGAGTTGG - Intergenic
1036773496 8:11594261-11594283 CAGGCTGCTCCACCCTGCCTGGG + Intergenic
1037713147 8:21371644-21371666 CAGCCTCCTCCAGTTCTCCTGGG + Intergenic
1038804316 8:30776532-30776554 CAGCCTCCTCCACCTCTCCTGGG - Intronic
1042312720 8:67394699-67394721 CAGCCTCCTCCATTTAGCCAGGG + Intergenic
1044843278 8:96356201-96356223 TAGGCTATTCCACATGGCCTGGG + Intergenic
1048218926 8:132523722-132523744 CAGGATCCTCCACTTCACGTGGG - Intergenic
1048426478 8:134328481-134328503 CAGGTTCCTCTGCTTGGCTTGGG - Intergenic
1049771956 8:144387007-144387029 TAGGCCCCTGCACTTGGCCCAGG - Intronic
1052124517 9:24758660-24758682 TAGGCTCCTCAACTTCGCATGGG + Intergenic
1052941079 9:34132708-34132730 CAGAGACCTCCCCTTGGCCTAGG + Intergenic
1053299907 9:36941635-36941657 CAGACTCCCCCTCTTTGCCTGGG + Intronic
1054906989 9:70420539-70420561 CAGGATCCAGCACTGGGCCTGGG - Intergenic
1056430655 9:86524964-86524986 CTGGATCCTCCACTCAGCCTTGG + Intergenic
1056827597 9:89887533-89887555 CAGGCTCCTAGAAGTGGCCTTGG - Intergenic
1057524712 9:95788241-95788263 CCGGCTCCTCCCCTTGCTCTTGG + Intergenic
1058736782 9:107900915-107900937 CAGACTACTCCTCTTGGCTTGGG - Intergenic
1058993084 9:110273343-110273365 CTTGCTCCTCCACTTTGACTAGG + Intergenic
1059677030 9:116549476-116549498 CAGGCTCCAGCCCTGGGCCTGGG - Intronic
1060860181 9:126947655-126947677 CAGGCTCCTCCCTGTGGCTTAGG - Intronic
1061211824 9:129198139-129198161 CAGTCTCGGCCACTTGGCCAAGG + Intergenic
1061499096 9:130992087-130992109 CCTGCTCCTCCTCTAGGCCTGGG - Intergenic
1061574095 9:131495418-131495440 AAGGTTCTTCCAGTTGGCCTTGG + Intronic
1062111609 9:134785142-134785164 CAGGCCCTTCCCCATGGCCTCGG + Intronic
1185510770 X:662686-662708 CAGGTTTCTCCATTTAGCCTGGG + Intergenic
1186004376 X:5051914-5051936 GAGGCTACTCAGCTTGGCCTGGG + Intergenic
1187470105 X:19562078-19562100 CAGGCTCCTAACCTTGGCCAAGG + Intronic
1189319941 X:40081883-40081905 CAGGTCTCTCCACTTGGCCCTGG - Intronic
1189658905 X:43277625-43277647 CAGAGACCTCCCCTTGGCCTAGG + Intergenic
1194524780 X:94966141-94966163 CAAGCTCCTCCAGTTAGTCTAGG + Intergenic
1196437996 X:115692313-115692335 CAGGCCACTCCACTCAGCCTGGG - Intergenic
1197014272 X:121604901-121604923 CATGCTCCTCTAAGTGGCCTTGG - Intergenic
1198297901 X:135304975-135304997 CTGTCACCTCCAGTTGGCCTTGG - Intronic
1198453509 X:136792242-136792264 CAAGATCCTCAACTTGGGCTGGG + Intergenic
1199693964 X:150330416-150330438 CAGTCTGTTCCACTTGGCCAGGG - Intergenic
1199787798 X:151120289-151120311 AAGGCTCTTCCACTTCCCCTGGG - Intergenic
1201947174 Y:19523839-19523861 CAGGCTCCTGCATTGGGCTTAGG - Intergenic