ID: 1128061720

View in Genome Browser
Species Human (GRCh38)
Location 15:64739575-64739597
Sequence ACCAAGAGCAGGCCCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128061720_1128061725 9 Left 1128061720 15:64739575-64739597 CCACCTGGGGGCCTGCTCTTGGT No data
Right 1128061725 15:64739607-64739629 CTCTCCCTACCCTGACAGCCTGG No data
1128061720_1128061729 18 Left 1128061720 15:64739575-64739597 CCACCTGGGGGCCTGCTCTTGGT No data
Right 1128061729 15:64739616-64739638 CCCTGACAGCCTGGAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128061720 Original CRISPR ACCAAGAGCAGGCCCCCAGG TGG (reversed) Intergenic
No off target data available for this crispr