ID: 1128061725

View in Genome Browser
Species Human (GRCh38)
Location 15:64739607-64739629
Sequence CTCTCCCTACCCTGACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128061724_1128061725 -2 Left 1128061724 15:64739586-64739608 CCTGCTCTTGGTGTAGGGAGTCT No data
Right 1128061725 15:64739607-64739629 CTCTCCCTACCCTGACAGCCTGG No data
1128061720_1128061725 9 Left 1128061720 15:64739575-64739597 CCACCTGGGGGCCTGCTCTTGGT No data
Right 1128061725 15:64739607-64739629 CTCTCCCTACCCTGACAGCCTGG No data
1128061717_1128061725 20 Left 1128061717 15:64739564-64739586 CCAGGAAGGTCCCACCTGGGGGC No data
Right 1128061725 15:64739607-64739629 CTCTCCCTACCCTGACAGCCTGG No data
1128061718_1128061725 10 Left 1128061718 15:64739574-64739596 CCCACCTGGGGGCCTGCTCTTGG No data
Right 1128061725 15:64739607-64739629 CTCTCCCTACCCTGACAGCCTGG No data
1128061709_1128061725 27 Left 1128061709 15:64739557-64739579 CCTTCCCCCAGGAAGGTCCCACC No data
Right 1128061725 15:64739607-64739629 CTCTCCCTACCCTGACAGCCTGG No data
1128061711_1128061725 23 Left 1128061711 15:64739561-64739583 CCCCCAGGAAGGTCCCACCTGGG No data
Right 1128061725 15:64739607-64739629 CTCTCCCTACCCTGACAGCCTGG No data
1128061721_1128061725 6 Left 1128061721 15:64739578-64739600 CCTGGGGGCCTGCTCTTGGTGTA No data
Right 1128061725 15:64739607-64739629 CTCTCCCTACCCTGACAGCCTGG No data
1128061715_1128061725 21 Left 1128061715 15:64739563-64739585 CCCAGGAAGGTCCCACCTGGGGG No data
Right 1128061725 15:64739607-64739629 CTCTCCCTACCCTGACAGCCTGG No data
1128061713_1128061725 22 Left 1128061713 15:64739562-64739584 CCCCAGGAAGGTCCCACCTGGGG No data
Right 1128061725 15:64739607-64739629 CTCTCCCTACCCTGACAGCCTGG No data
1128061708_1128061725 30 Left 1128061708 15:64739554-64739576 CCGCCTTCCCCCAGGAAGGTCCC No data
Right 1128061725 15:64739607-64739629 CTCTCCCTACCCTGACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128061725 Original CRISPR CTCTCCCTACCCTGACAGCC TGG Intergenic
No off target data available for this crispr