ID: 1128061729

View in Genome Browser
Species Human (GRCh38)
Location 15:64739616-64739638
Sequence CCCTGACAGCCTGGAAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128061718_1128061729 19 Left 1128061718 15:64739574-64739596 CCCACCTGGGGGCCTGCTCTTGG No data
Right 1128061729 15:64739616-64739638 CCCTGACAGCCTGGAAACTGAGG No data
1128061724_1128061729 7 Left 1128061724 15:64739586-64739608 CCTGCTCTTGGTGTAGGGAGTCT No data
Right 1128061729 15:64739616-64739638 CCCTGACAGCCTGGAAACTGAGG No data
1128061721_1128061729 15 Left 1128061721 15:64739578-64739600 CCTGGGGGCCTGCTCTTGGTGTA No data
Right 1128061729 15:64739616-64739638 CCCTGACAGCCTGGAAACTGAGG No data
1128061717_1128061729 29 Left 1128061717 15:64739564-64739586 CCAGGAAGGTCCCACCTGGGGGC No data
Right 1128061729 15:64739616-64739638 CCCTGACAGCCTGGAAACTGAGG No data
1128061715_1128061729 30 Left 1128061715 15:64739563-64739585 CCCAGGAAGGTCCCACCTGGGGG No data
Right 1128061729 15:64739616-64739638 CCCTGACAGCCTGGAAACTGAGG No data
1128061720_1128061729 18 Left 1128061720 15:64739575-64739597 CCACCTGGGGGCCTGCTCTTGGT No data
Right 1128061729 15:64739616-64739638 CCCTGACAGCCTGGAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128061729 Original CRISPR CCCTGACAGCCTGGAAACTG AGG Intergenic
No off target data available for this crispr