ID: 1128062960

View in Genome Browser
Species Human (GRCh38)
Location 15:64746867-64746889
Sequence GGTGAGAAGCCCAGTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128062957_1128062960 -6 Left 1128062957 15:64746850-64746872 CCAAAGCTGGGATCAGAGGTGAG 0: 1
1: 0
2: 3
3: 65
4: 468
Right 1128062960 15:64746867-64746889 GGTGAGAAGCCCAGTGAGGTGGG 0: 1
1: 0
2: 3
3: 45
4: 298
1128062955_1128062960 4 Left 1128062955 15:64746840-64746862 CCAATTGGTGCCAAAGCTGGGAT 0: 1
1: 0
2: 0
3: 29
4: 173
Right 1128062960 15:64746867-64746889 GGTGAGAAGCCCAGTGAGGTGGG 0: 1
1: 0
2: 3
3: 45
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128062960 Original CRISPR GGTGAGAAGCCCAGTGAGGT GGG Intronic
900385577 1:2409112-2409134 GGGGAGAAGCCAAGAGAGGGAGG - Intronic
900487897 1:2932155-2932177 GATGAGAGGCCCAGTGTGGCCGG + Intergenic
900706151 1:4081655-4081677 GGTAAGAAGCCCAGTGCTCTGGG + Intergenic
900995670 1:6122015-6122037 TCTGAGAAGCCCCGGGAGGTGGG + Intronic
901073128 1:6533771-6533793 GGATAGAAGCCCTGTGAGGGTGG - Intronic
902079151 1:13809302-13809324 AGTGAGAAGTCCAGTGAGGAAGG + Intronic
903156328 1:21446064-21446086 GGAGAGAAGTCCAGTGAGAAAGG + Intronic
903230404 1:21918929-21918951 GGGGAGGAGCCCAGTGGGGAGGG - Intronic
903290594 1:22311681-22311703 AGCAAGAAGCCCAGTGTGGTCGG + Intergenic
903849345 1:26296813-26296835 GAGGAGAGGCCCAGAGAGGTGGG + Intronic
904256431 1:29257773-29257795 GGAGAGAAGCCCAGGGTGGGAGG + Intronic
904997859 1:34645117-34645139 GCTGAGAACCCCAGGGAGGCAGG - Intergenic
905231690 1:36518484-36518506 GGTCAGAAGCCCAGTGTGGGTGG + Intergenic
905772920 1:40649888-40649910 GTTGAGAACCCCAGAGAGGCTGG + Intronic
906124590 1:43419944-43419966 GGTGAGAGGCACACTGAGGTGGG + Exonic
908635263 1:66156849-66156871 GGAGCAAAACCCAGTGAGGTAGG - Intronic
909715561 1:78702534-78702556 AGTGTGGAGCCCAGTGAGGTTGG - Intergenic
911661751 1:100509169-100509191 GGTGAGAAGCAAAGGGAGGGAGG - Intronic
913514854 1:119596060-119596082 GGGGAGAATCTCAGTGTGGTGGG + Intergenic
915075662 1:153306554-153306576 GGTGCGAGTCCCTGTGAGGTGGG + Intronic
915301293 1:154953061-154953083 GGGCAGAAGCCCACTGAGGAGGG - Intronic
915393331 1:155563068-155563090 GGCGAGGAGCCCAGGGAGGTAGG - Intergenic
915603172 1:156935243-156935265 GATGAGAAGTCCAGGGAGGGAGG + Exonic
915798736 1:158765933-158765955 GATGAGAACCACAGTGAAGTGGG + Exonic
915847229 1:159279227-159279249 GATGATAACCACAGTGAGGTGGG + Intergenic
915937321 1:160097233-160097255 AGGGAGGAGCCCAGGGAGGTGGG - Intronic
917730086 1:177866345-177866367 GGTCAGAAGTCCAGTGGGCTTGG - Intergenic
917780634 1:178392440-178392462 GGTGAGAAGGCCGGAAAGGTAGG + Intronic
919452210 1:197786031-197786053 GGAGATAAGGCCAGAGAGGTAGG + Intergenic
919893405 1:201992616-201992638 GGAGGGAAGCCCAGTCAGGAGGG - Intronic
920046131 1:203133751-203133773 GGTCAGCAGCCCAGTGGGGCAGG - Intronic
920112636 1:203598098-203598120 GGTGAGAGGGCCAGAGAGGGAGG - Intergenic
920207248 1:204301503-204301525 GGCTGGAAGCCCAATGAGGTGGG - Intronic
920693942 1:208167508-208167530 GATGAGAGGCCCATAGAGGTAGG + Intronic
921224608 1:213005805-213005827 AGTGAGGAGGCCAGTGAGATTGG - Intronic
921286803 1:213616391-213616413 GATGAGAAGACCACTGCGGTGGG + Intergenic
921299466 1:213736677-213736699 GGAGAGAATCCCAGTAAGGTTGG - Intergenic
921796511 1:219350935-219350957 GGTGAGGAGCCCAGTGGGTCAGG + Intergenic
921840744 1:219825722-219825744 AGGGAGAAGGCCAGAGAGGTGGG + Intronic
922054013 1:222023000-222023022 GCTGAGAAGCCAAGTGTGTTTGG - Intergenic
922210629 1:223483808-223483830 GCTGAGAAACCCACTGAGGGAGG + Intergenic
922726203 1:227924124-227924146 GGTGTGAAGGCAAGTGGGGTGGG - Exonic
923254621 1:232210976-232210998 GAGGAGAAGCACAGTGTGGTTGG + Intergenic
1062824561 10:558207-558229 TGCGTCAAGCCCAGTGAGGTAGG + Intronic
1063260617 10:4385354-4385376 GGTGAGAGTCACAGTCAGGTAGG - Intergenic
1063367787 10:5501476-5501498 GGTGAGGGGCCCAGGGAGGGCGG + Intergenic
1066063510 10:31745139-31745161 GGAAAGAAACCCTGTGAGGTGGG - Intergenic
1066304259 10:34124902-34124924 GCTCAGAAGCCCTGTGTGGTAGG - Intronic
1067431861 10:46250512-46250534 GGTGAGAAGCACAGTGGAGAGGG - Intergenic
1067578255 10:47421126-47421148 GGTGAGAAGCACAGTGGAGAGGG + Intergenic
1068822646 10:61395455-61395477 GTTGAGAAGCCCTGGAAGGTTGG + Intergenic
1071249859 10:83806601-83806623 AGCAAGAAGCCCAGTGTGGTTGG - Intergenic
1073093706 10:100967463-100967485 GGCGAGTAGGCCAGTGTGGTAGG - Intergenic
1074307101 10:112289026-112289048 AGATAGAAGCCCAGAGAGGTTGG - Intronic
1074711293 10:116179895-116179917 GGTCATTAGCCCAGAGAGGTTGG + Intronic
1074845512 10:117393962-117393984 TGAGAGAAGGCCAGTGAGGCTGG - Intergenic
1075589260 10:123679676-123679698 GGTGGAGAGCCCAATGAGGTTGG - Intronic
1075624438 10:123951441-123951463 GGGGAGAAGGACAGAGAGGTTGG + Intergenic
1075930436 10:126290349-126290371 GGTCAGAAGCCCAGTGGGCATGG - Intronic
1076133198 10:128027949-128027971 GCTGAGAGGCACAGTGAGGTGGG + Intronic
1076491370 10:130863876-130863898 GGTGGGAGGCCCAGGGTGGTGGG + Intergenic
1077128227 11:954246-954268 GGTGGGAATCCAAGTGAGGTGGG - Intronic
1077485177 11:2835179-2835201 GGTGGGAATAGCAGTGAGGTTGG + Intronic
1077542967 11:3156147-3156169 GGTCAGCAGCCCAGCGAGATGGG - Intronic
1079314285 11:19394751-19394773 GGGTAAAACCCCAGTGAGGTGGG + Intronic
1082811012 11:57479059-57479081 GGTCAGAAACCCAGGGAGCTCGG + Intergenic
1082843938 11:57712106-57712128 GGTCCGAAGCCGAGTGCGGTTGG + Exonic
1083650016 11:64197537-64197559 TGTGAGAAGGCCATTGAAGTGGG + Exonic
1083887567 11:65580371-65580393 AGTGTGAAGCCTAGTGATGTGGG + Exonic
1084960532 11:72713942-72713964 GGTCAGGAGGCCAGAGAGGTGGG + Intronic
1085044757 11:73346429-73346451 GGTGGGCAGCCCAGCCAGGTGGG + Intronic
1085190376 11:74615413-74615435 GCTGAGAAGCCAAGTAAGTTAGG + Intronic
1085259559 11:75196485-75196507 GGAGAGAAGACCAGTAGGGTTGG - Intronic
1086535757 11:87843108-87843130 GTTGAGAAGCACTGAGAGGTGGG + Intergenic
1088109092 11:106241209-106241231 GGTGAGAAGCGTAGAGAGTTGGG + Intergenic
1088193028 11:107247192-107247214 GTTGTGAAGTCCAGTGAGGTAGG + Intergenic
1090382624 11:126337734-126337756 GATGAGAATCCCAGTGCGGCGGG + Intronic
1091116224 11:133016183-133016205 GGTCAGAAGCCCCGTGGGCTCGG + Intronic
1091744354 12:2981763-2981785 GGTGAGAAGCCCAGGGGTGCTGG + Intronic
1095935075 12:47670721-47670743 GGTGAGAAGTCCAGTGGGGCTGG + Intronic
1096229718 12:49890119-49890141 GGACAGCATCCCAGTGAGGTAGG + Exonic
1100225895 12:92555360-92555382 GGTGGGAAGGCCAGTGTGGCTGG - Intergenic
1102438581 12:112944448-112944470 GGTGTGAAGCGCTGTGAGTTAGG - Intronic
1102458551 12:113086363-113086385 CCTGAGAAGGCCAGTGTGGTTGG + Intronic
1102819332 12:115894660-115894682 AGTGAGAAGGCCAGTGTGGTTGG + Intergenic
1103387994 12:120549025-120549047 GGTGAGAGGCAAAGTGATGTGGG + Intronic
1103896398 12:124276157-124276179 GGAGAGAGGCTGAGTGAGGTGGG - Intronic
1104108058 12:125682016-125682038 GGAGAGATGCACAGTGTGGTTGG + Intergenic
1104371594 12:128228497-128228519 GGGGAGAAGGCCAGTGTGGTAGG + Intergenic
1104634239 12:130427705-130427727 GGGGTCAAGCACAGTGAGGTCGG - Intronic
1104998501 12:132673995-132674017 GGGGAGAGGCCCAAGGAGGTGGG - Intronic
1105642391 13:22279284-22279306 GGATAGAACCCCAGTGGGGTTGG + Intergenic
1106411759 13:29515624-29515646 GGTGAGATGCCCAGAGGCGTGGG + Intronic
1107093575 13:36511015-36511037 GGGAAGAAGCCCAGTGCGGCTGG - Intergenic
1108712478 13:53047278-53047300 GGTGAGAAGCTCAGTGAAGATGG + Intronic
1110223147 13:73093908-73093930 GGTGAGAGGCCCAGGCTGGTTGG + Intergenic
1112549117 13:100403500-100403522 GGTGAGAACCACAGTGAGCGGGG + Intronic
1114668845 14:24398524-24398546 GGTGGGGAGCCCAGGGAGGCCGG - Intergenic
1118042113 14:61928591-61928613 GGTGAGAAGCCCAGTCTTCTGGG + Intergenic
1119412510 14:74442464-74442486 AGAAAGAAGGCCAGTGAGGTGGG + Intergenic
1120140568 14:80926012-80926034 GGTGAGGTCCCCTGTGAGGTAGG - Intronic
1121171789 14:91860658-91860680 AGTAAGAAGACCAGTGTGGTTGG - Intronic
1122437623 14:101710715-101710737 GGGGACAAGCCCAGTGAAGGAGG - Intergenic
1123102695 14:105816349-105816371 GGTGGGAAGGCCAGTGGGCTTGG - Intergenic
1124203381 15:27697484-27697506 GAACAGAAGCCCAGTGAGGACGG + Intergenic
1127308286 15:57729088-57729110 GATGAGATGCCCAGGGAGGCCGG + Intronic
1128062960 15:64746867-64746889 GGTGAGAAGCCCAGTGAGGTGGG + Intronic
1128994904 15:72288985-72289007 GGTGAGAAGCTCAGGGAGTGTGG + Intronic
1129762597 15:78139238-78139260 TGGGAGAATCCCAGTGAGCTGGG + Intronic
1129912513 15:79240224-79240246 GGAGAGGAGCCTAGAGAGGTAGG - Intergenic
1130568952 15:85023422-85023444 GGTGGGAAGGCCAGGGAGGTAGG + Intronic
1131056728 15:89379277-89379299 GGTGGGCAGCCCAGTCAGGGGGG - Intergenic
1131217724 15:90553341-90553363 AGTGAGAAGCACAGAGAGTTAGG + Intronic
1131510292 15:93046027-93046049 GGTCAAAAGCCCAGTGTGGTAGG + Intronic
1131668846 15:94598117-94598139 GGGCAGAAGCCCAGTCAGCTTGG - Intergenic
1132255705 15:100373927-100373949 GGTGAGGACCCCAGTGGGGTGGG + Intergenic
1132275890 15:100563633-100563655 GGGGAGAAGGCCAGGGAGGATGG + Intronic
1132582117 16:689665-689687 GGTCAGGAGGTCAGTGAGGTGGG + Exonic
1132929335 16:2450988-2451010 GGAGGGAAGCCCAGTGGGGCTGG - Intronic
1133210815 16:4262531-4262553 GGAGAGAAGCTCAGCAAGGTGGG - Exonic
1133731698 16:8583786-8583808 GGTTTGAACCCCAGTGATGTAGG + Intronic
1134692972 16:16203262-16203284 GGTGAGAAGGACACTGAGGAAGG - Intronic
1136626090 16:31462945-31462967 GGTGAGCAGTGCAGTGATGTGGG + Intronic
1137597854 16:49736819-49736841 GGGCAGTAGCTCAGTGAGGTGGG - Intronic
1137932061 16:52598214-52598236 GGAGAGAAGCCCAAAGAGGGGGG + Intergenic
1137985032 16:53100009-53100031 GCTGAGGAGCCCAGAGAGGGAGG - Intronic
1138280800 16:55771063-55771085 GCTGGGAAGTCCTGTGAGGTTGG - Intergenic
1138530670 16:57632658-57632680 GGTGAGGAGGCCAGTGTGGTGGG + Intronic
1139877914 16:70161167-70161189 TTTGGGAGGCCCAGTGAGGTGGG + Exonic
1141175155 16:81713781-81713803 GGTGAGCAGCCCACGGAGGGAGG - Intergenic
1141667392 16:85472961-85472983 GGAGAGGAGCCCAGTGGGCTTGG - Intergenic
1142135806 16:88451612-88451634 GGTGGGAAACCCAGACAGGTAGG + Intergenic
1142187805 16:88702768-88702790 GGTGAGAACTCGGGTGAGGTGGG - Intronic
1142227560 16:88885024-88885046 GGTGAGCAGCCCGGTGGGGCGGG - Exonic
1142309258 16:89302794-89302816 GGTGAGAATCCCTGTGAGGTGGG - Intronic
1203141197 16_KI270728v1_random:1767920-1767942 TGTGAGAAGCTCAGAGAGGCTGG - Intergenic
1142669731 17:1482643-1482665 GGAGAGAAGCCCAGTGCGGGAGG - Intronic
1142669746 17:1482681-1482703 GGAGAGAAGCCCAGTGCGGGAGG - Intronic
1142669760 17:1482718-1482740 GGAGAGAAGCCCAGTGCAGGAGG - Intronic
1142669784 17:1482788-1482810 GGAGAGAAGCCCAGTGTGGGAGG - Intronic
1144493931 17:15735530-15735552 TGTGGGAGGCCCAGGGAGGTGGG - Intronic
1144906330 17:18641149-18641171 TGTGGGAGGCCCAGGGAGGTGGG + Intronic
1145940059 17:28738646-28738668 GGGGAGAAGGGCAGTGAGGAAGG - Intronic
1146436832 17:32857617-32857639 GGTGAGAAGACCAGTCTGATAGG - Intronic
1149971509 17:61222965-61222987 GGAGAAAAGCCCAGTGTGGCAGG - Intronic
1150124937 17:62629381-62629403 GGTGAGAGGCCCGGTCAGGGAGG + Intronic
1151478339 17:74356018-74356040 GGTGTGAAGGCCAGTGGGATAGG - Intergenic
1151703681 17:75756043-75756065 GGAGAGAGGCCCAGGGAGGTGGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152481389 17:80555935-80555957 GGTGAGAAGCCCTGGGGGCTGGG + Intronic
1155275148 18:24180205-24180227 GGTGTTAAGTCCACTGAGGTTGG + Intronic
1157339336 18:46765430-46765452 GGTGAGAAGACCAGTGCATTAGG - Intergenic
1158465988 18:57690271-57690293 TGGCAGAAGCCCAGGGAGGTGGG + Intronic
1158547111 18:58405777-58405799 GGTGAGCAGCTCAGAGAGGCAGG - Intergenic
1160235202 18:77080374-77080396 GGTGAGGAGCCCAGTGTGGCTGG - Intronic
1161852511 19:6745022-6745044 GGGGAGAAGGACAGTGAAGTGGG + Intronic
1162032887 19:7925042-7925064 GGTGAGATGCGCAGAGAGGAAGG + Exonic
1162153128 19:8659491-8659513 GGTGGGAAGGCCAGTGTGGCTGG + Intergenic
1162489100 19:10981265-10981287 GGTGGGAAGCCCAGCAACGTGGG - Intronic
1162757528 19:12869128-12869150 GGTGAGGAGTCCCGTGAGGATGG - Exonic
1163212653 19:15852539-15852561 GGGGAGAAGCCCAGAGGGATGGG - Intergenic
1164211525 19:23101862-23101884 GGTGAAAGGCCCAGCGAGGCCGG - Intronic
1164305829 19:24003468-24003490 GGAGACAGGCCCAGTGAGGGAGG + Intergenic
1164675385 19:30097124-30097146 GGTGAGATGACCAGGGAGCTGGG + Intergenic
1165158608 19:33802974-33802996 GGTGAGCAGCACAGTGGGGCTGG - Intronic
1165793523 19:38506035-38506057 GGAGAGGGGCCCAGGGAGGTAGG + Intronic
1166050438 19:40255898-40255920 GGTTGGAAGGCCAGGGAGGTGGG + Intronic
1167204779 19:48093655-48093677 AATGAGAAGACCAGTGAGGCTGG - Intronic
1167388335 19:49177920-49177942 GGAGACAAGGCCAGTGAGGCAGG + Intronic
1167838661 19:52095885-52095907 GGTGGGAGGCCCAGGGCGGTAGG + Intergenic
925870980 2:8270381-8270403 GGTAAGGAGCCCAGTGCTGTGGG + Intergenic
926084195 2:10010672-10010694 GGTGGGCAGGCAAGTGAGGTGGG + Intergenic
927209166 2:20628099-20628121 GGTGGCAAGCCCAGTGGAGTCGG - Intronic
927548605 2:23977075-23977097 GGTGAGTAGCCAGGTGTGGTAGG + Exonic
927712159 2:25332713-25332735 GCTGGGAAGCCCAGTGGGGCTGG - Intronic
927857386 2:26536040-26536062 GGGCAGAAGCCCAGGGAGGTAGG + Intronic
932411364 2:71549845-71549867 GGTGGGAGGCCCAGGTAGGTGGG - Intronic
933767218 2:85718503-85718525 GAAGAGAAGCCCACAGAGGTAGG - Intergenic
937036497 2:118786659-118786681 AGAGAGAAGCCCAGTGGGGACGG - Intergenic
937443637 2:121937926-121937948 GGAGAGAGGTCCAGTGAGGTAGG + Intergenic
937766993 2:125672888-125672910 GGTGACAAGCCCAGGCAGTTTGG - Intergenic
938628231 2:133135337-133135359 GAAGAGAAGCCCAGTGTGGCTGG + Intronic
940735228 2:157443690-157443712 GGTGAGATGCTCAGGGAGCTAGG - Intronic
944079457 2:195770629-195770651 GGTGAGAAGCTCTCTTAGGTTGG - Intronic
947173446 2:227336281-227336303 TGTGAGAAGGCCATTGAAGTTGG + Intronic
948193466 2:236077856-236077878 GGAGAGCAGCACAGTGATGTTGG - Intronic
948863188 2:240762847-240762869 TGTGAGAGGCCCAGGCAGGTAGG - Intronic
1170208962 20:13828992-13829014 GCTGGGAAGCACAGTGAGGGAGG - Intergenic
1170687675 20:18584277-18584299 GGTAGGAAGACCAGTGAGGAAGG + Intronic
1171431670 20:25086669-25086691 AGTAAGAAGCCAAGAGAGGTTGG - Intergenic
1172883697 20:38217625-38217647 GGAGCTAAGCCCTGTGAGGTGGG - Intronic
1175087102 20:56468758-56468780 GTTGAGAAGGTCAGTGATGTGGG + Exonic
1175437110 20:58961276-58961298 GGAGAGGAGGCAAGTGAGGTGGG - Intergenic
1176038994 20:63054672-63054694 GGTGAGATGCCCAGTGACCAGGG + Intergenic
1176088309 20:63307909-63307931 GCTGAGATGCCCAGGGAGCTTGG - Intronic
1176413619 21:6462086-6462108 GGTGAGAGGCCCGGTGAGGTCGG - Intergenic
1176728467 21:10465489-10465511 GGGCAGAAGCCAAGTGAGGTAGG - Intergenic
1179689117 21:43070409-43070431 GGTGAGAGGCCCGGTGAGGTCGG - Intronic
1179885342 21:44311927-44311949 GGAGAGAGGCCCAGGGAGGTAGG + Intronic
1180242938 21:46523953-46523975 GGTGAGGAGCTCAGGGAGGCCGG + Intronic
1180835826 22:18928920-18928942 CGTGAGAGGCCCAGGGAGGATGG - Intronic
1181488100 22:23244384-23244406 GGTGAGAAGCCCACTGTAGTGGG - Intronic
1181594012 22:23902758-23902780 GGTGGGAAGCTCAGGGAGGCTGG - Intergenic
1181712097 22:24697153-24697175 CGTGAGAGGCCCAGGGAGGACGG - Intergenic
1181728448 22:24827530-24827552 GGTGGGAAGCCCAGGGAAGGCGG + Intronic
1181777550 22:25170511-25170533 GGAGAGAGGGCCATTGAGGTGGG + Intronic
1182359738 22:29739594-29739616 GGGGAGAGGCCCAGGGAGGCTGG - Intronic
1183629068 22:39022287-39022309 GGTCAGAGGCACAGAGAGGTGGG - Intronic
1183861458 22:40673378-40673400 GGGGAGATGCTCAGTGTGGTGGG + Intergenic
1184717648 22:46291004-46291026 GGTGACAAGCCCAGTGGTTTAGG + Intronic
1184805475 22:46792589-46792611 GCCGAGACGCCAAGTGAGGTTGG - Intronic
1184873632 22:47258381-47258403 TGTGCGAAGCCCAGGGAGGGGGG + Intergenic
1203285917 22_KI270734v1_random:154219-154241 CGTGAGAGGCCCAGGGAGGATGG - Intergenic
949190917 3:1247899-1247921 AGTGAGATGCCCAGTGACATTGG - Intronic
950129004 3:10529023-10529045 GCTGGGATGCCCAGAGAGGTGGG - Intronic
950876809 3:16282885-16282907 GGAGAGTAACTCAGTGAGGTTGG + Intronic
952869965 3:37890081-37890103 CATGAGAAGCCCAGTGGTGTAGG + Intronic
954917703 3:54163058-54163080 GGTCAGAAGACCAGTGTGGCTGG + Intronic
956337580 3:68181197-68181219 GGTGAGAGACTCAGTCAGGTGGG + Intronic
956392494 3:68788547-68788569 GGTGAAAAGCTCAATGATGTTGG - Intronic
958553548 3:95645379-95645401 GGTGTGAGGCCCACTGAGCTAGG - Intergenic
958893737 3:99807850-99807872 GGTGAGAAGTGCAGTGAACTTGG - Intergenic
960012495 3:112849064-112849086 GGTGTGAAGCCCAGAGAGTTTGG + Intergenic
960272925 3:115693986-115694008 GTTGAGCATCCCAGTGAGGCAGG + Intronic
963646004 3:147915490-147915512 GGAGAGAAGCCAGTTGAGGTTGG - Intergenic
966018652 3:175177809-175177831 GGTGATTTGCCCAGTGAGGTAGG + Intronic
966718582 3:183038406-183038428 GGTGAGGCGGCCAGTGTGGTTGG + Intronic
968551117 4:1223732-1223754 GGTGAGGGGCCCCGTGAGGGAGG - Intronic
969227399 4:5807883-5807905 GGGAAGAAACCCAGAGAGGTGGG - Intronic
969609164 4:8217334-8217356 GGCCAGAGGCCCAGAGAGGTGGG - Intronic
970379464 4:15492615-15492637 GGGGAGATTCTCAGTGAGGTGGG + Intronic
971282391 4:25251527-25251549 GGAGAGAATTCCAGTGACGTGGG + Intronic
975494343 4:75021321-75021343 GGTGAGAAGAGAGGTGAGGTGGG - Intronic
975579872 4:75896684-75896706 GATGAGAAGACAAGAGAGGTTGG - Intronic
976775414 4:88700687-88700709 GGTGTGAAGCCGAGGGGGGTGGG + Intronic
978307843 4:107351728-107351750 GGTGAGAAGCAAGGTGGGGTTGG - Intergenic
979049955 4:115917997-115918019 GGTGAGAAATCCTGTGAAGTTGG + Intergenic
979782075 4:124664770-124664792 GGTGAGAATTCCAGTGAGGGTGG + Exonic
980147316 4:129004306-129004328 AGTAAGAAGTCCAGTGAGTTTGG - Intronic
980397156 4:132228357-132228379 AGTGGGAAGCCAAGTCAGGTTGG + Intergenic
980503080 4:133682157-133682179 GGTATGAAGCCAAGTCAGGTGGG + Intergenic
981876868 4:149557471-149557493 TTTGAGAACCCCATTGAGGTTGG - Intergenic
984190243 4:176596782-176596804 GGTTAAATGCCCAGTGTGGTGGG + Intergenic
985032051 4:185799353-185799375 CGTGAGATGCCCAGTGACATTGG + Intronic
985265862 4:188153131-188153153 GGTGAGAAGCGGAGTGAGAGTGG + Intergenic
986282706 5:6336652-6336674 AGTGGGAAGCCTAGTGGGGTAGG - Intergenic
986376458 5:7136920-7136942 TGTGAGTAGCCCAGTGATGTGGG + Intergenic
988282852 5:29172816-29172838 GGTGAGAAGGCCAGAGGGGTAGG - Intergenic
990339500 5:54808520-54808542 GGTGAAGAGCCCAGTGTGGATGG - Intergenic
991442903 5:66669765-66669787 AGTGAGAAGTACAGTGAGGGTGG + Intronic
993872307 5:93267476-93267498 GGGGAGAAGCGCTGTGTGGTGGG + Intergenic
994077557 5:95670353-95670375 GCTGAGAATACCAGTGAGGCAGG - Intronic
996421775 5:123270464-123270486 GGTGAGCAGCTCAGTGACCTTGG + Intergenic
998267661 5:140678162-140678184 GGTGAGAAGCCCAAAGATGCCGG - Intronic
999148831 5:149413347-149413369 GGTCTGAAGCTCAGTGAGGCTGG + Intergenic
999196252 5:149783575-149783597 GGAGAGAAACTCAGTGTGGTAGG + Intronic
999242407 5:150135634-150135656 CGTGTCTAGCCCAGTGAGGTTGG + Exonic
1001031779 5:168268627-168268649 GGTGAGAAGTTCAGAGAGGCCGG + Intergenic
1001426439 5:171625670-171625692 GGTGGCGAGCCCAGTGAGGAAGG + Intergenic
1001591134 5:172866253-172866275 GGAGAGAAGCGGAGGGAGGTGGG + Intronic
1002575756 5:180172798-180172820 GGTGAGAAGCGCAGGGTGGCAGG - Intronic
1002774462 6:317198-317220 GGTGAGACGCCCAGTCTGCTTGG + Intronic
1003888245 6:10540273-10540295 AGTGAGAAGCCTGGAGAGGTAGG - Intronic
1004801576 6:19154089-19154111 GGGCAGAAGCCAAGGGAGGTGGG + Intergenic
1005897693 6:30192024-30192046 TGTGAGCAGCCCAGAGAGGGTGG + Intronic
1006196180 6:32243883-32243905 GCTCAGAAGCCCCGTGAGGAAGG - Intergenic
1006446896 6:34084681-34084703 GGTGGGGAGCCATGTGAGGTGGG - Intronic
1007599371 6:43072255-43072277 GGTCAGAAGCCCAGAGGGGAAGG + Exonic
1007829118 6:44624846-44624868 GGTGGGGAGCCAAGAGAGGTTGG + Intergenic
1008882328 6:56393966-56393988 TGTGAGGTTCCCAGTGAGGTAGG - Intronic
1010951176 6:82038964-82038986 GGAAAGAAGCCCAGTGAGCCTGG + Intergenic
1012137584 6:95577904-95577926 GGCGACGAGGCCAGTGAGGTGGG - Intronic
1013044296 6:106469069-106469091 GGGGAGAGGGCCAGTGAGTTGGG - Intergenic
1013160749 6:107542413-107542435 GGTGAGAAGCCAAATGACGTAGG + Intronic
1015633754 6:135255841-135255863 GCTGAAAAGCCCAGAGGGGTAGG - Intergenic
1018157229 6:160996891-160996913 TGTTAGCAGACCAGTGAGGTGGG + Intronic
1018828132 6:167423192-167423214 GGGGGGAACCCCAGTGTGGTGGG - Intergenic
1019278691 7:189116-189138 GGAGAGAAGGCCTGTGAGGTGGG - Intergenic
1021620990 7:22550770-22550792 GATGTGAAGAACAGTGAGGTAGG - Intronic
1022566461 7:31407627-31407649 GGTGAGAAGGCCAGTTCTGTGGG + Intergenic
1023552623 7:41386298-41386320 GGTCAGGAGCCAAGTGAAGTGGG - Intergenic
1023670691 7:42573100-42573122 GGTGACAAGCCCAGGATGGTGGG + Intergenic
1027722580 7:81763001-81763023 GGTTAGGAGCAGAGTGAGGTAGG + Intronic
1028171621 7:87603621-87603643 TCTGAGAAGCCCAGTGAGTTTGG - Intronic
1028725587 7:94083804-94083826 GGTGAGGAGACCAGTGTTGTTGG + Intergenic
1028834978 7:95365020-95365042 GGTGAGTAGCCGAGTGACCTTGG - Intronic
1029314746 7:99701039-99701061 GGTGAGAGGCACAGGGTGGTTGG - Intronic
1029482222 7:100820044-100820066 GGGAAGAAGCCCAGGGAGGATGG + Intronic
1029539271 7:101173274-101173296 GGTGAGAAGGACAGGGAGCTCGG - Exonic
1029581519 7:101439597-101439619 TGTGAGAAGACCAGTGTGGCTGG + Intronic
1032489807 7:132315910-132315932 GGAGGGAAGCCCAGAGTGGTAGG + Intronic
1033422697 7:141217489-141217511 GGTGAGGACCCCAGGGAGGCTGG + Intronic
1034511926 7:151542665-151542687 ACTGTGATGCCCAGTGAGGTTGG + Intergenic
1034601623 7:152262471-152262493 GGGCAGAAGCCAAGTGAGGTAGG + Intronic
1034944896 7:155255468-155255490 GGAGAGAGTCGCAGTGAGGTAGG + Intergenic
1035029250 7:155846745-155846767 GGTGAGAGACCCTGTGAAGTGGG + Intergenic
1035071623 7:156149029-156149051 CGTGAGGAGCCCAGTGAAGGGGG - Intergenic
1035460520 7:159035777-159035799 GGGGAGAAATCCTGTGAGGTTGG - Intronic
1035471207 7:159109926-159109948 GGAGAGAAGCAGAGTGAGGCAGG + Intronic
1035546059 8:483255-483277 GGTGGGAGGCCCTGTGAGGAGGG - Intergenic
1035974321 8:4290365-4290387 GGAGAGAAGCCCAAAGACGTAGG + Intronic
1036739869 8:11350268-11350290 GGTGAGAAGACAAGTGAGTTTGG - Intergenic
1037225847 8:16588780-16588802 GCTGAGAAGGGTAGTGAGGTGGG - Intergenic
1037950460 8:23015931-23015953 AATGAGAAGCCCAGAGAGGCAGG - Intronic
1038102372 8:24392638-24392660 GGAGAGAAGCCCGGGAAGGTCGG + Intronic
1038499442 8:28031205-28031227 AGTGAGGAGAGCAGTGAGGTTGG - Intronic
1039228488 8:35417233-35417255 GGTGAGAAGGGTAGTGGGGTGGG - Intronic
1042737566 8:72005622-72005644 GCTTTGAAGCCCAGTGAGATAGG - Intronic
1043859388 8:85298358-85298380 GTCGAGATTCCCAGTGAGGTTGG + Intergenic
1044947216 8:97400603-97400625 GCTGAGAAGGGCAGTGGGGTGGG - Intergenic
1045258485 8:100550616-100550638 GGGGAGATTCCCAGTGTGGTGGG + Intronic
1045824546 8:106381479-106381501 GGGCAGAATCTCAGTGAGGTAGG + Intronic
1046444762 8:114303429-114303451 TCTGAGAAACCCAGTGTGGTAGG - Intergenic
1047165315 8:122432095-122432117 GGTGAGGAGGCCAGGGAGATTGG - Intergenic
1047212984 8:122854560-122854582 GGTGAGGAGCACAGTCAGGGTGG - Intronic
1047226115 8:122956609-122956631 GGTGAGAAACCAAAAGAGGTTGG + Intronic
1048880886 8:138871490-138871512 GCTGAGAAACCCAGTGAAGTGGG - Intronic
1049338296 8:142098208-142098230 GGTGAGGAGGCGAGTGGGGTGGG + Intergenic
1049523692 8:143109086-143109108 GGTGAGAGTCCCAGTGAGGGAGG + Intergenic
1050386827 9:5099800-5099822 GGGTAGAAGCCCAAGGAGGTTGG - Intronic
1050592903 9:7178689-7178711 GCTGAGAAACTCAGTGAGGTGGG + Intergenic
1050928610 9:11297315-11297337 TGTGTGAAGCCCAGAGAGTTTGG - Intergenic
1051551818 9:18338328-18338350 GGAAGGAAGCCCACTGAGGTAGG - Intergenic
1054459930 9:65457169-65457191 TGTGAGAAGCTCAGGGAGGCAGG - Intergenic
1054777568 9:69136761-69136783 GGTGAGAAGCCTGGTGATGGTGG + Intronic
1055506087 9:76950887-76950909 GGTGAGAGCAGCAGTGAGGTTGG - Intergenic
1057754533 9:97821443-97821465 GGGGAGAAGCCCAGAGAGATGGG + Intergenic
1058481832 9:105403702-105403724 GGTGGGAGGGCCAGGGAGGTGGG + Intronic
1059838472 9:118184452-118184474 GGTGAGCAGCTCAGTGATGTGGG - Intergenic
1060040253 9:120294272-120294294 GGTGAGAAACCCCGTGGGGAGGG + Intergenic
1060937946 9:127526847-127526869 GGCAGGAAGCCCAGTGAGGAAGG + Intronic
1060964728 9:127706232-127706254 GGTCAGAAACACAGGGAGGTGGG - Intronic
1061205223 9:129159148-129159170 GATGGTAAGCCCAGTGAGGGAGG + Intergenic
1061761397 9:132854410-132854432 GGTGAGCAGTCCACTGAGGCCGG - Intronic
1062652532 9:137585598-137585620 CCTGAGAGGCCCAGTGAGGAAGG + Intronic
1188552225 X:31376820-31376842 GGGGAGAAGCCCAGTGCTCTTGG - Intronic
1189250316 X:39595913-39595935 GGACAGAAGCCCAGTGAGCTGGG - Intergenic
1189272546 X:39761418-39761440 TCTGAGAAGCTCAGTGGGGTTGG - Intergenic
1190916923 X:54817794-54817816 GATTAGAAGCCCAGTGATGTTGG - Intergenic
1192538541 X:71949299-71949321 GGTGAGAAGGCATTTGAGGTGGG + Intergenic
1193814186 X:86085478-86085500 TGTGAGAAGTCCATTGAAGTGGG - Intergenic
1194631323 X:96288597-96288619 GGTGAGATGTCCTTTGAGGTTGG - Intergenic
1196130485 X:112150076-112150098 AGTGAGGAGGCCAGTGTGGTGGG + Intergenic
1198176286 X:134158925-134158947 GGTGAGTAGCCCACTGAAGAAGG + Intergenic
1198380500 X:136078723-136078745 GGGGAGAATTTCAGTGAGGTGGG - Intergenic
1198393096 X:136196169-136196191 AGTGAGGAGGCCAGTGAGGTGGG + Intronic
1199082501 X:143592329-143592351 GGTGTGGAGGCCAGTGAGTTTGG - Intergenic