ID: 1128064498

View in Genome Browser
Species Human (GRCh38)
Location 15:64755900-64755922
Sequence CTTTAGTTAAGGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128064498_1128064503 2 Left 1128064498 15:64755900-64755922 CCTTCCTCACTCCTTAACTAAAG 0: 1
1: 0
2: 2
3: 17
4: 206
Right 1128064503 15:64755925-64755947 ATCCAGCCTTCAGGTCTTTCCGG 0: 1
1: 0
2: 1
3: 13
4: 194
1128064498_1128064502 -7 Left 1128064498 15:64755900-64755922 CCTTCCTCACTCCTTAACTAAAG 0: 1
1: 0
2: 2
3: 17
4: 206
Right 1128064502 15:64755916-64755938 ACTAAAGGTATCCAGCCTTCAGG 0: 1
1: 0
2: 1
3: 3
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128064498 Original CRISPR CTTTAGTTAAGGAGTGAGGA AGG (reversed) Intronic
900628996 1:3624039-3624061 CTTCAGTCAGGGAGTGGGGATGG - Intergenic
905008910 1:34733631-34733653 CTTGAGGTCAGGAGTGAGGTGGG - Intronic
907630760 1:56079646-56079668 CTTAAAATAAGGAGTGAGGAGGG - Intergenic
907697570 1:56748417-56748439 TTTTATGTAAGGTGTGAGGAAGG + Intronic
907899752 1:58727378-58727400 CCTTTGTGAAGGAGTGTGGAGGG + Intergenic
910195483 1:84635602-84635624 CTTGAGTTAAGTATTGAAGAGGG - Intergenic
911346819 1:96706742-96706764 CTGGAGTGGAGGAGTGAGGAGGG + Intergenic
912985332 1:114422570-114422592 CTTTTGTCAAGGATGGAGGAAGG - Intronic
913558800 1:119997316-119997338 CTTTAGGTAAGGAGTGCCAATGG - Exonic
913639054 1:120793155-120793177 CTTTAGGTAAGGAGTGCCAATGG + Intergenic
914279403 1:146156799-146156821 CTTTAGGTAAGGAGTGCCAATGG - Exonic
914540446 1:148607729-148607751 CTTTAGGTAAGGAGTGCCAATGG - Intronic
914626198 1:149463485-149463507 CTTTAGGTAAGGAGTGCCAATGG + Intergenic
914921547 1:151850940-151850962 CTTTCTCTAAGGGGTGAGGAAGG - Intronic
915625076 1:157109452-157109474 CTTCAGTGAAGAAGAGAGGATGG - Intergenic
915684431 1:157617213-157617235 CTGTAGCAAAGGAGTGAGCAGGG + Intergenic
916976124 1:170081557-170081579 CATCAGTGAAGGAGTGTGGATGG - Intronic
917120243 1:171639151-171639173 TTTTAGATAAGGACTGGGGATGG + Intronic
917687364 1:177431054-177431076 CTTGAAGTAAGGAGAGAGGATGG + Intergenic
918678366 1:187319381-187319403 CTTTCTTTATGGAGTGAGGAGGG + Intergenic
919560331 1:199110234-199110256 CATTATTTAAAGAATGAGGATGG + Intergenic
921488512 1:215745178-215745200 CTTGAGTTTTGGAGTGAAGAAGG - Intronic
922063658 1:222115458-222115480 CATTAGAAAAGGAGGGAGGAAGG - Intergenic
1063723961 10:8616092-8616114 TTTTAGCTAAGGAATGAGAAGGG + Intergenic
1064534792 10:16347632-16347654 CTGTAGTTAAGGTGTCAGCAAGG - Intergenic
1067270953 10:44790895-44790917 GTTTAGATAAGGAGGGAGAAAGG - Intergenic
1067942735 10:50669906-50669928 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1068066802 10:52142140-52142162 CTTTAGTTTAAAAATGAGGAAGG + Intronic
1068561925 10:58524520-58524542 CTTGAATTAAGGTGTAAGGAAGG - Intronic
1070024983 10:72623832-72623854 CTTTTGTTGAGGGGTGGGGACGG - Intronic
1070724634 10:78779697-78779719 CTATAGTTGAGGAATGAAGAGGG - Intergenic
1070863977 10:79694869-79694891 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1071630876 10:87217095-87217117 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1073334351 10:102694505-102694527 TTTAAGTTAAGGGGTAAGGATGG + Intronic
1074022856 10:109602300-109602322 CTTTATTTAAGGGGAGAGAAAGG + Intergenic
1078835199 11:15021262-15021284 TTTTGTTTAAGGAGTAAGGAAGG - Intronic
1079789256 11:24714946-24714968 CTTTAGTTAAAGTGTGCAGAGGG - Intronic
1080699702 11:34634307-34634329 CTTTGATTAAGGACTGAGAATGG + Intronic
1080955056 11:37083691-37083713 CTTGAGTAAAGGTGTGGGGAGGG + Intergenic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085419728 11:76345573-76345595 ATTAAGTTAATGAGTGATGATGG - Intergenic
1085593443 11:77787097-77787119 CTTTAGCAAAGGACTGAGCAGGG + Intronic
1085724995 11:78947411-78947433 CTTGAGGTAGGGAGTGAGGTGGG + Intronic
1085744693 11:79104757-79104779 CTTTGGCTAAGTAGTGAGAATGG + Intronic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1086735212 11:90297850-90297872 TTTTGTTTAAGGTGTGAGGAAGG + Intergenic
1087063837 11:94009452-94009474 CTTTAGTTATGGAAAGAGGCAGG + Intergenic
1090702346 11:129308158-129308180 CTTAACTTAAAGAGTCAGGAGGG - Intergenic
1091044110 11:132310588-132310610 CTTGCGTAAAGGAGTTAGGAAGG + Intronic
1092857199 12:12685241-12685263 CCATATTTAAAGAGTGAGGATGG - Intronic
1093123675 12:15302894-15302916 CATTTCTTAAGGAGTGGGGAGGG + Intronic
1094043744 12:26145203-26145225 CTTCAGTTAAGTCTTGAGGAAGG - Intronic
1094152964 12:27306363-27306385 CTTTAAGGAAGTAGTGAGGAGGG - Intronic
1096317804 12:50583910-50583932 TTTCAGTGAAGCAGTGAGGATGG - Intronic
1098073894 12:66705876-66705898 TTTTATATAAGGTGTGAGGAAGG - Intronic
1102027016 12:109719427-109719449 CTTTAGGTAAAGACTGAGCAAGG + Intronic
1105824522 13:24110267-24110289 CATTGGTCAAGGAGTGAGGAAGG + Intronic
1107597916 13:41982607-41982629 CTTTAGTTATGGAGATATGACGG - Intergenic
1107684497 13:42883415-42883437 CCTTAGTCAAGGACTGAGAAAGG - Intergenic
1112681641 13:101773633-101773655 ATTTAGTTATGGAATGAAGAAGG + Intronic
1115088523 14:29546554-29546576 CTTTACTTATGCAGTGAAGATGG - Intergenic
1115290746 14:31769356-31769378 CTCTAGGTAAGGAGCTAGGAGGG - Intronic
1117228947 14:53695323-53695345 ATTTAGTTAAGGAGTGAATGAGG - Intergenic
1120885620 14:89449781-89449803 CTTCAGTTGAGGAGGGAGGGAGG - Intronic
1122462560 14:101907625-101907647 CCTTAGTTTATGGGTGAGGAAGG + Intronic
1123991061 15:25683681-25683703 CTTTCTTAAGGGAGTGAGGAGGG - Intronic
1125797280 15:42411962-42411984 CTTTAGTAAAGCAATGAGGTAGG + Exonic
1126667152 15:51085779-51085801 CTTTATTTAGGGAGAGAGGAGGG - Intronic
1127711994 15:61608162-61608184 TTTAAGTAAAGGAGGGAGGAAGG + Intergenic
1128064498 15:64755900-64755922 CTTTAGTTAAGGAGTGAGGAAGG - Intronic
1129469860 15:75746559-75746581 ATTTATTTATGGTGTGAGGATGG + Intergenic
1131779739 15:95843478-95843500 CTTTAGTTGGGGAGTAAGGGTGG - Intergenic
1131994919 15:98124531-98124553 ATTTAGAAACGGAGTGAGGAAGG - Intergenic
1133232836 16:4374513-4374535 ATTTAATTAAGGAGGGAGGAGGG + Intronic
1136000314 16:27287494-27287516 CTTTACTTCAGGTGAGAGGAGGG + Intronic
1137068400 16:35875091-35875113 TTTTTGTTAAGGTGTAAGGAAGG + Intergenic
1137351831 16:47719916-47719938 CTTGGGTGAAGGAGTGGGGACGG + Intergenic
1137659260 16:50189828-50189850 CTTGAGGTCAGGAGTGAGGCAGG + Intronic
1139171020 16:64629042-64629064 CTTTACTTAAGTAATGGGGAGGG - Intergenic
1139293979 16:65883983-65884005 CTCTAGGCAAGGAGAGAGGAAGG + Intergenic
1145166089 17:20614322-20614344 CTCTGGTTCAGGAGTGTGGAGGG - Intergenic
1146735068 17:35231958-35231980 CCTGAGTGAAGGAGAGAGGAAGG + Intergenic
1146983943 17:37194728-37194750 CTTTAGTTAAGGTGAGAGTGAGG - Intronic
1146989656 17:37257630-37257652 CTTAAGTGAAGGTGTGAGCATGG - Intronic
1152013349 17:77734501-77734523 AGTTAATTAAGGAGGGAGGAAGG - Intergenic
1153769675 18:8405304-8405326 TTTTAATTAACGGGTGAGGATGG + Intronic
1154048466 18:10930330-10930352 CTTTAGTTAAGGTAAGAGGGTGG - Intronic
1155291380 18:24345764-24345786 CTTTAGACAGTGAGTGAGGAAGG - Intronic
1155531026 18:26766616-26766638 CTTAAATTAGGGAGCGAGGAAGG + Intergenic
1158304587 18:56090773-56090795 CTTCAGATAAGAAATGAGGAAGG + Intergenic
1160101864 18:75928165-75928187 CTTTAATAAAGGTGTGTGGAGGG - Intergenic
1160561318 18:79758308-79758330 CTTTAGTTAAGTCTTGAGGTCGG + Intergenic
1161845347 19:6709035-6709057 CTTGGGATCAGGAGTGAGGATGG - Intronic
1164482552 19:28624441-28624463 ATTCAGTTAGGAAGTGAGGAAGG - Intergenic
1165586783 19:36923848-36923870 CTTAAGTGAAGGTGGGAGGAGGG - Intronic
1166775776 19:45311665-45311687 TTTTGGTGGAGGAGTGAGGAGGG + Intronic
1166866457 19:45840966-45840988 ATTTATCTAAGGAGTGAGGTAGG - Intronic
1168365123 19:55780211-55780233 CTACAGTGAAGGAGTGAGGAAGG + Intergenic
924983627 2:247104-247126 CTTTACTTAAAGAATGTGGAGGG + Intronic
925731761 2:6924159-6924181 CTTGGGTTTAAGAGTGAGGATGG + Intronic
926523417 2:13946201-13946223 TTTTAGTTAAGGTGTGAGATAGG + Intergenic
926855563 2:17252194-17252216 CTTGAGTGAAGGAGTGAATATGG - Intergenic
930758219 2:55001559-55001581 ATTTAGGTAATGAGTGAGGCTGG - Intronic
934513865 2:94971865-94971887 CTTGAGTGAAGGAGAGAGGGAGG - Intergenic
936728719 2:115355726-115355748 TTTTGTTTAAGGTGTGAGGAAGG + Intronic
938052182 2:128184514-128184536 CTTTTGTTAGGGAGGAAGGATGG - Intronic
939759396 2:146155478-146155500 CTGGAGTTAAGCAGTGAGAATGG + Intergenic
941647437 2:168056466-168056488 CATTAGTTAAGGACTGAGGAAGG + Intronic
943289245 2:186047438-186047460 CTTTATTGAAGAAGTGATGATGG + Intergenic
944765228 2:202857446-202857468 TTTTATATAAGGTGTGAGGAAGG - Intronic
946464817 2:219902643-219902665 CATTTGTAAAGGAGTGAGCATGG + Intergenic
948264105 2:236625020-236625042 CTGTATTTAGGCAGTGAGGAGGG + Intergenic
1169709812 20:8548937-8548959 TTTCAGTGAAGCAGTGAGGATGG + Intronic
1169953173 20:11070936-11070958 CTTAAATTAAGGAATGAGGAAGG - Intergenic
1171274824 20:23847672-23847694 ATTTTGCTAAGGAGTAAGGAGGG - Intergenic
1172356155 20:34281412-34281434 CTTGAGTTGAAGAATGAGGAAGG - Intronic
1173895396 20:46546804-46546826 CTATAATTTAGGGGTGAGGAGGG + Intronic
1175018690 20:55820897-55820919 CTTTAGTGATGGACTGAGGTAGG - Intergenic
1177367786 21:20159860-20159882 CTTTATTTAATAAGTGATGATGG + Intergenic
1179517742 21:41920377-41920399 CTTTTGTTTAGGAGTGGGGAAGG - Intronic
1180692969 22:17732848-17732870 CCTTAATTAAGGAATGAGGTAGG - Intergenic
1181744512 22:24946527-24946549 CCTGAGGTGAGGAGTGAGGAGGG - Intronic
949091416 3:33895-33917 CTTTTTTTCAGGAGTGGGGACGG + Intergenic
951251040 3:20394622-20394644 CTTTTGTGAAGGATTGAGCAGGG + Intergenic
951436925 3:22676126-22676148 CTCTACTTAAGGAGAGGGGAAGG - Intergenic
952132862 3:30384808-30384830 CTTGAGATGAGGAGGGAGGAGGG - Intergenic
956356467 3:68398391-68398413 TTTTTGTTAAGGTGTAAGGAAGG - Intronic
956787416 3:72654068-72654090 CTTTAGTTAAGCATTTATGATGG - Intergenic
957844673 3:85716667-85716689 TTTTTGTTAAGGTGTAAGGAAGG + Intronic
958157089 3:89769293-89769315 CTTTATATAAGGTGTAAGGAAGG + Intergenic
959694972 3:109239595-109239617 TTTTATTTAAGGTGTAAGGAAGG - Intergenic
960026997 3:113020778-113020800 ATCAAGTTATGGAGTGAGGACGG - Intergenic
960584865 3:119311328-119311350 CATGAGTCAAGGAATGAGGAAGG - Intronic
960758060 3:121040543-121040565 CTTTAGCTAAGTACTAAGGAAGG - Intronic
960899047 3:122535780-122535802 TTTTAATTAAGGGATGAGGACGG + Intronic
962717584 3:138140123-138140145 TTGTAATTTAGGAGTGAGGAAGG - Intergenic
964939784 3:162143802-162143824 CTTTATTTAAAGAGGGAGGAAGG - Intergenic
965982838 3:174713971-174713993 TTTTATATAAGGTGTGAGGAAGG + Intronic
968471776 4:785883-785905 CTTTAGTTTAGAAGTGAACACGG + Exonic
970785267 4:19789467-19789489 GTTTAATCAAGGAGTGGGGAAGG - Intergenic
971351570 4:25860839-25860861 AGATAGTGAAGGAGTGAGGAAGG - Intronic
973570196 4:52231065-52231087 TTTTAATAAAGGGGTGAGGACGG + Intergenic
973663827 4:53137291-53137313 CTTTGGGAAAGAAGTGAGGAAGG - Intronic
974759378 4:66255440-66255462 TTTTATTTAAGGTGTAAGGAAGG + Intergenic
974836187 4:67253799-67253821 TTTTAGATAAGGTGTAAGGAAGG + Intergenic
975418236 4:74131553-74131575 TTTTGTTTAAGGTGTGAGGAAGG - Intronic
976050435 4:81005836-81005858 CTTTTTTTAAGGAGTGATGAAGG - Intergenic
976284623 4:83359544-83359566 CTTTAGATAAGCAGTGAGGAGGG + Intergenic
977185209 4:93928089-93928111 ATTTATATAAGGAGTAAGGAAGG + Intergenic
977274468 4:94958871-94958893 CTTTAACTAGGGAATGAGGATGG + Intronic
978082897 4:104616368-104616390 CTCTGCTTAAGGAGAGAGGAGGG - Intergenic
978462180 4:108968353-108968375 CTTTTGTTAAGTAGTGAGAGTGG - Intronic
979032177 4:115663932-115663954 CTCAAGTTATGGAGTGGGGATGG + Intergenic
979215607 4:118160485-118160507 CTTTATTTAAAAAGTGAGCAAGG + Intronic
979943844 4:126799754-126799776 CTTATGTGAAAGAGTGAGGATGG - Intergenic
981563206 4:146069279-146069301 GCTTAGTTACGGGGTGAGGATGG - Intergenic
981675044 4:147333387-147333409 CTTTCGTCAAAGAGTGAGGGTGG + Intergenic
982376183 4:154693339-154693361 CTTTAGGTTAGGAATCAGGATGG + Intronic
982685791 4:158487190-158487212 CTTCAGTGAAGGAGTGTGGGGGG - Intronic
984283610 4:177702249-177702271 CTTGAGTTAAGGTGTAAGGAAGG - Intergenic
989631396 5:43485702-43485724 CTTTAGTCAGGTAGTAAGGAAGG + Intergenic
991042349 5:62189062-62189084 ATGTAGTTATGGTGTGAGGAAGG - Intergenic
991509511 5:67361230-67361252 CTCAAGAGAAGGAGTGAGGATGG - Intergenic
992975656 5:82116547-82116569 TTTTATTTCAGGAGTGAGGGAGG + Intronic
993410118 5:87563525-87563547 GTTTTGTTAAGGTGTAAGGATGG + Intergenic
993596465 5:89862794-89862816 CTCTAGTTAAAGAGTTTGGAGGG - Intergenic
993892785 5:93493813-93493835 CTTTTAATAAGGAGTGAGGTAGG - Intergenic
993903677 5:93601322-93601344 CTTTTGTCAAGGAGAGTGGAGGG - Intergenic
994672239 5:102776506-102776528 TTTTATATAAGGTGTGAGGAAGG + Intronic
998001880 5:138631945-138631967 AATTAGTTAGGGAGTGAGGATGG - Intronic
998498732 5:142613892-142613914 CTGTAGTCAAGGTGGGAGGAAGG - Intronic
998622937 5:143814419-143814441 TTTGAGTTAAGGAATAAGGATGG + Intronic
999446672 5:151645918-151645940 CTTTGACTAAGGAGAGAGGAAGG + Intergenic
999531751 5:152470671-152470693 CTTTGGTTAAAGATGGAGGAAGG + Intergenic
999616485 5:153430242-153430264 TTTTGGTTTAGGAGTGGGGAAGG + Intergenic
1002619097 5:180474396-180474418 CTATAGTAAAGGAGTGGGGATGG + Intergenic
1005997469 6:30940116-30940138 CTTTAGGCAGGAAGTGAGGAAGG + Intergenic
1007422915 6:41730293-41730315 TTATAGGGAAGGAGTGAGGAAGG + Intronic
1008076127 6:47148066-47148088 CTTTAGTTTGGCAATGAGGAGGG - Intergenic
1008846462 6:55970353-55970375 TTTTAGTCAAGGACTGAGGTTGG - Intergenic
1008869259 6:56252692-56252714 CTTTAGATTAGGAGAGAGTAGGG + Intronic
1010887228 6:81258915-81258937 CTTGAGTTAAGGTGTAAGGAAGG - Intergenic
1011167273 6:84463199-84463221 CTTTAGTAAAGTAGTGGGAATGG - Intergenic
1013919672 6:115388811-115388833 TTTTAGATAAGGTGTAAGGAAGG + Intergenic
1017442811 6:154479421-154479443 CTCTAGTTTAGGCTTGAGGAGGG - Intronic
1019261532 7:84546-84568 CTCTGGGTGAGGAGTGAGGAAGG - Intergenic
1022351234 7:29567157-29567179 CTTAAGTGAAGGAGTGGGGGAGG + Exonic
1026252049 7:68679621-68679643 TTTTGGCTAAGGAGTGAGCAGGG - Intergenic
1028967046 7:96813846-96813868 TTTTAGATAAGGTGTGAGGAAGG - Intergenic
1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG + Intergenic
1029888537 7:103900812-103900834 TTTTATATAAGGTGTGAGGAAGG - Intronic
1031614353 7:123863868-123863890 CTTTGGGGAAGGAGTGAGAAGGG + Intronic
1031754839 7:125625659-125625681 CTTTTATTAAGTAGTGAGGGAGG + Intergenic
1032354774 7:131200300-131200322 AGTTTGTTTAGGAGTGAGGAAGG - Intronic
1035110102 7:156474669-156474691 CTTTAGGTAATGAGAGAGGAAGG - Intergenic
1035225034 7:157428156-157428178 CTGCAGTTGAGGAGGGAGGAGGG + Intergenic
1037185544 8:16058260-16058282 CTAAATTTAAGGAGTGACGATGG - Intergenic
1040033905 8:42850407-42850429 CTTTAGGTGAGAAGTGAGGGTGG + Intronic
1040587536 8:48757548-48757570 CTGTAGGTAAGGAGTGGGGTAGG + Intergenic
1040799252 8:51322949-51322971 CTTTAGGTGAGCAGTGAGAATGG + Intronic
1041704449 8:60831087-60831109 ATTTAGTTAAGAAAAGAGGAGGG - Intronic
1042678480 8:71350738-71350760 CTTGGAGTAAGGAGTGAGGAAGG - Intronic
1042820371 8:72923603-72923625 CCTTAGTCAAGGAGTGGGGGTGG + Intronic
1043070986 8:75635606-75635628 TTTTATTTAAGGTGTAAGGAAGG + Intergenic
1047854083 8:128891026-128891048 CTTTTGTTAAGGGCTGAGTAGGG - Intergenic
1048227312 8:132600744-132600766 TTTTTGTTAAGGTGTAAGGAAGG - Intronic
1048231782 8:132649338-132649360 TTTTTGTTAAGGTGTAAGGAAGG - Intronic
1048968883 8:139633291-139633313 AGTTAGATAAGGAGTGAGGAGGG - Intronic
1051223853 9:14878325-14878347 CTTTAGTGGGGGAGAGAGGAGGG - Intronic
1052583136 9:30387813-30387835 CTTTAGTTATTGAGTAGGGATGG - Intergenic
1054734475 9:68736632-68736654 CATGAGTCAAGGAGTGAGGGTGG - Intronic
1054751613 9:68912849-68912871 CTTTAGTCATGAAGAGAGGATGG + Intronic
1055381337 9:75710190-75710212 CTTGAGTTGAGGAGTGGAGATGG - Intergenic
1056427804 9:86494707-86494729 ATTTAGTTAGGGAGTTAGGGAGG + Intergenic
1056728974 9:89147583-89147605 TTTTACTCGAGGAGTGAGGAGGG - Intronic
1057111086 9:92471942-92471964 CTACACTTCAGGAGTGAGGACGG - Intronic
1186688952 X:11954568-11954590 CTTTAGGTAGGAAGTAAGGAGGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1188346555 X:29073666-29073688 CTCTAGTTATGGAGTGAGTCAGG - Intronic
1188763758 X:34064164-34064186 GTGTAGTCAAGGAGTGATGAGGG - Intergenic
1189330854 X:40144223-40144245 CTTTCTCCAAGGAGTGAGGAGGG - Intronic
1192349139 X:70341402-70341424 CTTTAATTAGGGATTGAGGGTGG + Intronic
1193011888 X:76685841-76685863 CTGTAGTAGATGAGTGAGGAAGG + Intergenic
1193259157 X:79385047-79385069 TTTTATTTAAGGTGTAAGGAAGG - Intergenic
1193634151 X:83927532-83927554 TTTTGTTTAAGGTGTGAGGAAGG + Intergenic