ID: 1128065889

View in Genome Browser
Species Human (GRCh38)
Location 15:64764182-64764204
Sequence CACAGCACCAAGAAGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 348}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128065889_1128065896 24 Left 1128065889 15:64764182-64764204 CCTGCAGCCTTCTTGGTGCTGTG 0: 1
1: 0
2: 0
3: 30
4: 348
Right 1128065896 15:64764229-64764251 CCTGCCTGTGTGCCTGGCAAGGG 0: 1
1: 0
2: 4
3: 44
4: 351
1128065889_1128065893 18 Left 1128065889 15:64764182-64764204 CCTGCAGCCTTCTTGGTGCTGTG 0: 1
1: 0
2: 0
3: 30
4: 348
Right 1128065893 15:64764223-64764245 CTACTGCCTGCCTGTGTGCCTGG 0: 1
1: 0
2: 2
3: 42
4: 364
1128065889_1128065894 23 Left 1128065889 15:64764182-64764204 CCTGCAGCCTTCTTGGTGCTGTG 0: 1
1: 0
2: 0
3: 30
4: 348
Right 1128065894 15:64764228-64764250 GCCTGCCTGTGTGCCTGGCAAGG 0: 1
1: 0
2: 7
3: 67
4: 527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128065889 Original CRISPR CACAGCACCAAGAAGGCTGC AGG (reversed) Intronic
900103018 1:970887-970909 CAGAGCACCAGGAGGGGTGCGGG - Exonic
900488251 1:2933637-2933659 GACAGCTCCAAAGAGGCTGCTGG + Intergenic
900966276 1:5960916-5960938 CACAGCAGCCAGAAGGCGGAAGG + Intronic
901632239 1:10653585-10653607 CACGGCACCCAGGAGGCTGGGGG + Exonic
901634692 1:10665082-10665104 CCCAGCACCAGGCAGGCTTCAGG - Exonic
903807965 1:26018824-26018846 CACAGCACGACTCAGGCTGCAGG - Intergenic
905010653 1:34744939-34744961 CACAGGCCCAAGAAGCCTGAGGG - Intronic
905901550 1:41584754-41584776 AAGGGCACCAAGAAGGCTGAGGG - Exonic
908029065 1:59980908-59980930 CACAGCACCAAGCAGAGTGACGG + Intergenic
908363194 1:63390274-63390296 CACAGCACCAGGCAGACTCCTGG - Intronic
908679692 1:66646872-66646894 CAGAGCACCAAAAAGGCAGAAGG + Intronic
909209698 1:72807950-72807972 CAGAGCACCAAGCAGGCTATTGG - Intergenic
909667698 1:78154010-78154032 TAGAGCACCAAGAAGGCTCTTGG - Intergenic
912431762 1:109631753-109631775 GACAGGACGGAGAAGGCTGCTGG - Exonic
912495855 1:110090743-110090765 CACAGCTCCCTGCAGGCTGCAGG - Intergenic
913241567 1:116834701-116834723 CATAGCACCAAGAAGGATCCAGG - Intergenic
914679364 1:149928212-149928234 CAAATCTGCAAGAAGGCTGCAGG - Exonic
918381309 1:183958351-183958373 CTCAGCACCAAGAGGACTACTGG + Intronic
919272068 1:195360624-195360646 CAGAGCACCAAGCAGGCTCCTGG + Intergenic
919880415 1:201897220-201897242 CACAGGCCCAGGAAGGCGGCAGG - Exonic
919919328 1:202159032-202159054 TCCAGCACCAAGAAGGCTGTGGG + Intronic
920306253 1:205020062-205020084 CAGAGCACAAAGGAGGGTGCTGG - Exonic
921313104 1:213864872-213864894 GACAGCACCAAGAAGGAGTCTGG + Intergenic
921769762 1:219022317-219022339 CAGAGCACCAAGTGGGCTCCTGG + Intergenic
1063968051 10:11362223-11362245 CACAGCACCAGGAAGGGGCCTGG + Intergenic
1066554800 10:36600245-36600267 CTGAGCACCATGAAGGCTTCAGG + Intergenic
1066649712 10:37642829-37642851 CAGAGCACCGAGCAGGCTCCTGG - Intergenic
1067032599 10:42888375-42888397 CAGAGCACCAAGCAGGCTCCTGG - Intergenic
1067189809 10:44059677-44059699 CGGAGAGCCAAGAAGGCTGCTGG + Intergenic
1067259619 10:44677257-44677279 CATTGCACCAAGATGGCTTCTGG - Intergenic
1067650642 10:48152435-48152457 CACAGCACCAGGTATGCTCCTGG + Intergenic
1067977331 10:51041289-51041311 TAGAGCACCAAGCAGGCTCCTGG - Intronic
1070588888 10:77787579-77787601 CTCAGCACCAAGATCCCTGCGGG + Intergenic
1071883464 10:89924505-89924527 AACAGCAGCAAGAAGGGTGAAGG + Intergenic
1072877682 10:99190801-99190823 CAGAGCACCAGGCAGGCTCCTGG + Intronic
1072966645 10:99979492-99979514 CACAACACCAGGAAGGTTCCTGG - Intronic
1073043759 10:100624141-100624163 CACAGCACCTGGCATGCTGCAGG - Intergenic
1073072274 10:100802257-100802279 CCCTGCACCAAGAGGGCTGGAGG - Intronic
1073290897 10:102412790-102412812 CACAGCAGCAAGACGGATGTGGG - Intronic
1073431968 10:103493001-103493023 CACTGCACCAAGAAGCCTTCAGG - Intergenic
1074735454 10:116426798-116426820 AACAGCACCAAGCAGTGTGCTGG - Intergenic
1074803529 10:117026094-117026116 TAGAGCACCAAGTAGGCTCCTGG + Intronic
1075008194 10:118845531-118845553 CAGGGGACCAAGCAGGCTGCCGG + Intergenic
1075472046 10:122698446-122698468 CATAGCAGCAAGAAGGCTTTTGG - Exonic
1075562956 10:123481670-123481692 CACAGCACCAACATGGCGGGTGG + Intergenic
1076437255 10:130454726-130454748 CACAGCATCCAGAAGGCCCCAGG - Intergenic
1076445854 10:130513324-130513346 CACAGCACCCACGAGGCTGCTGG + Intergenic
1076768482 10:132650642-132650664 CAGACCACCAAGCAGGCTGCGGG - Intronic
1076815602 10:132913310-132913332 CCAGGCACCAGGAAGGCTGCGGG + Intronic
1077472961 11:2772868-2772890 CACCGCACCCAGATGGCTGGAGG + Intronic
1077475726 11:2789591-2789613 CACAGCACCCAGGACGCAGCTGG + Intronic
1078809412 11:14743339-14743361 CACAGCATAAATAAAGCTGCTGG - Intronic
1079183516 11:18215182-18215204 TAGAGCACCAAGCAGGCTGTTGG + Intronic
1080653692 11:34242272-34242294 CACTGAACCAAGAAGGCAGGAGG + Intronic
1083755307 11:64788967-64788989 CAGTGCCCCTAGAAGGCTGCTGG + Intronic
1084422136 11:69065784-69065806 GACAGCACCATCACGGCTGCTGG - Intronic
1084763839 11:71294641-71294663 TATAGCACCAAGTGGGCTGCTGG - Intergenic
1085130900 11:74037578-74037600 CACAGCACCAGGAGAGCTGTAGG - Exonic
1085532852 11:77202109-77202131 CTCAGCACAAAGGAGGCAGCAGG + Intronic
1085960675 11:81457953-81457975 GGCAGCAGCAAGAAGGCAGCAGG - Intergenic
1087350099 11:97020398-97020420 CACAGCACCAAGGAGGATCTTGG + Intergenic
1088944452 11:114495480-114495502 CAGAGCACCAAGTGGGCTCCTGG - Intergenic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089334043 11:117710379-117710401 CCCAGCCCAAGGAAGGCTGCCGG - Intronic
1089931798 11:122320353-122320375 CCCAGCAGCAGCAAGGCTGCCGG + Intergenic
1090463257 11:126910680-126910702 CACATAACCAATAAGGCAGCTGG + Intronic
1090902260 11:131043455-131043477 GACAGGAGCAAGATGGCTGCAGG - Intergenic
1091635998 12:2197096-2197118 CACAGCACCTGGAAGGAGGCAGG - Intronic
1091836330 12:3588664-3588686 CACTGCACTAGGAATGCTGCAGG + Intronic
1091980875 12:4862769-4862791 CACAGCACCAAGCAGGAGTCAGG + Intergenic
1093588607 12:20872397-20872419 CAGAGCAACAAGAAGGCTTTTGG - Intronic
1094063576 12:26340572-26340594 GAAAGCACCGTGAAGGCTGCAGG + Intronic
1095097008 12:38154279-38154301 CAAAGCGGCAAGAAGGCTTCTGG + Intergenic
1095097203 12:38155082-38155104 CAAAGCAGCAAGAAGGCCTCCGG + Intergenic
1095097473 12:38156116-38156138 CAAAGCGGCAAGAAGGCTTCTGG + Intergenic
1095097762 12:38157310-38157332 CAAAGCGCCAAGAAGGCCTCCGG + Intergenic
1095098419 12:38159899-38159921 CAAAGCAGCAAGAAGGTTCCCGG + Intergenic
1095583582 12:43827197-43827219 CAGAGCATCAAGAAGGATGTGGG - Intergenic
1096503107 12:52077315-52077337 CACAAAACCAAGAAGCCAGCGGG - Exonic
1096747446 12:53738132-53738154 TAGAGCAGCAAGAAGGCTGAAGG + Intergenic
1097013662 12:55970612-55970634 CACAGCACCTAGCATGGTGCTGG - Intronic
1097195479 12:57240373-57240395 CTCAGCACCCAGAGGGCCGCTGG + Intronic
1097677647 12:62620205-62620227 CACAACACCTACACGGCTGCTGG + Intergenic
1099949572 12:89286309-89286331 GACAGCACCAAGGAAGTTGCTGG + Intergenic
1100148121 12:91702127-91702149 CACAGAAGCAAGAAGGTTGATGG - Intergenic
1102158684 12:110751090-110751112 CCCTGCTCCAAGAAGGCTCCTGG - Intergenic
1102295570 12:111733876-111733898 GACAGCACTAAGAAAACTGCCGG - Intronic
1103923296 12:124410593-124410615 CCCAGCCCCAAGCAGGCAGCAGG + Intronic
1104111435 12:125708683-125708705 CACAGCCCTTAGAAGACTGCCGG - Intergenic
1104372145 12:128232905-128232927 CACAGCACCCAGAACCCTGAAGG + Intergenic
1104980381 12:132570823-132570845 CTCAGGACCCAGCAGGCTGCGGG - Intronic
1106262053 13:28076526-28076548 GAGAGCCCCCAGAAGGCTGCTGG + Intronic
1106766995 13:32923154-32923176 ATCAGCACCAAGAAAGCAGCTGG + Intergenic
1107015679 13:35706392-35706414 CACAGCTCCCAGCAGGCTGCAGG + Intergenic
1107105513 13:36638301-36638323 GACAGCACCAAGGAGGATGGTGG + Intergenic
1107808225 13:44174697-44174719 CAGATCACCAAGCAGGCTCCTGG - Intergenic
1107832955 13:44390583-44390605 CAGGGCACAAAGGAGGCTGCAGG - Intronic
1108126884 13:47254413-47254435 CACAGCTCCAAGAATGGTGCTGG - Intergenic
1110613875 13:77519906-77519928 CAAAGAAACAAGAAGGCTGGAGG + Intergenic
1111291945 13:86182754-86182776 TAGAGCACCAAGAAGGCTCTTGG + Intergenic
1111466763 13:88623303-88623325 CACACCAGCAATAAGGCTGGGGG + Intergenic
1112138110 13:96606418-96606440 CACAGCAACAGGAATGCAGCTGG + Intronic
1112783511 13:102927478-102927500 CAGAGCCCCAAGCAGGATGCTGG - Intergenic
1113266677 13:108625978-108626000 CACAGCTCCAAAAAGGCCCCAGG - Intronic
1113344793 13:109466825-109466847 CACAGCTCCCACAAGGCTGCTGG + Intergenic
1114069678 14:19097381-19097403 CTCAGCACCACGCAGGCCGCGGG - Intergenic
1114092582 14:19302622-19302644 CTCAGCACCACGCAGGCCGCGGG + Intergenic
1116930733 14:50688312-50688334 CAGAGCACCAAGTAGGCTCTTGG - Intergenic
1118096924 14:62547184-62547206 AAGAGCACCAAATAGGCTGCTGG + Intergenic
1118465011 14:66022962-66022984 CACAGCCTCCAGAATGCTGCAGG - Intergenic
1118728750 14:68651896-68651918 CACAGCACCAAGACGGTTCCGGG - Intronic
1119094413 14:71815602-71815624 CAAGGCACCAAGAAGGGTGGCGG - Intergenic
1120476267 14:84991617-84991639 CCAAGCACCAAGAACGCAGCTGG - Intergenic
1122327549 14:100891535-100891557 CACAGCAGCAGGAGCGCTGCTGG - Intergenic
1123062575 14:105600890-105600912 GACAGCACCAAGAAGTGTGCAGG - Intergenic
1124096849 15:26656552-26656574 CACAGCAGCAGGAGAGCTGCAGG + Intronic
1125513787 15:40306938-40306960 CACAGCAGAGAGAGGGCTGCAGG + Intronic
1125928034 15:43579187-43579209 CACAAAAACAAGCAGGCTGCAGG + Intronic
1125941178 15:43678758-43678780 CACAAAAACAAGCAGGCTGCAGG + Intergenic
1126417587 15:48433906-48433928 CAGATCACCTAGAGGGCTGCTGG + Intronic
1126660710 15:51030651-51030673 TACAGCACTAAGCAGGCTCCTGG - Intergenic
1126831914 15:52616421-52616443 CACAACTTAAAGAAGGCTGCCGG - Intronic
1127272836 15:57416544-57416566 AACAGAAGCAAGATGGCTGCAGG - Intronic
1128065889 15:64764182-64764204 CACAGCACCAAGAAGGCTGCAGG - Intronic
1129139265 15:73582412-73582434 GACAGAAGCAAGAAGGATGCAGG + Intronic
1130091375 15:80823985-80824007 CACAGCATCAAGAAGGGGCCTGG + Intronic
1130233314 15:82113075-82113097 CAGAGCACCAGGAAGCCTGTGGG + Intergenic
1130347985 15:83066754-83066776 AGCAGCGCCAGGAAGGCTGCGGG + Exonic
1130564197 15:84980850-84980872 TACAGCACCGGGCAGGCTGCAGG - Intronic
1130864729 15:87922936-87922958 CAAAGCACCAAGATGGCAGGTGG + Intronic
1132019295 15:98346464-98346486 CACATCACCAAGAAGGAAGTTGG - Intergenic
1133074219 16:3267564-3267586 CAAAGCACCAAGAACAATGCTGG + Intronic
1133322136 16:4920997-4921019 CACAGCGTCAACAAGGCTGAGGG - Intronic
1135968406 16:27054301-27054323 CACATGACCAAGGAGGCTTCTGG - Intergenic
1135970328 16:27067428-27067450 CACAGCACCAAGCAGACTGGAGG + Intergenic
1136234276 16:28904671-28904693 CACAGCAGCCAGAAAGCCGCAGG + Exonic
1139596727 16:67962400-67962422 CACAGCCTCGAGAAGGCTGCAGG - Intronic
1141698335 16:85631196-85631218 CACCACACCGAGTAGGCTGCGGG - Intronic
1141915714 16:87095232-87095254 CAAAGCACCCCGAGGGCTGCTGG + Intronic
1142034073 16:87853049-87853071 CACCGCACCACTAAGACTGCAGG + Intronic
1142137340 16:88457549-88457571 CTAAGCATCAAGCAGGCTGCAGG - Intronic
1142919261 17:3170156-3170178 TAGAGCACCAAGCAGGCTGTTGG + Intergenic
1143658508 17:8311188-8311210 TACAATCCCAAGAAGGCTGCAGG - Intronic
1144443749 17:15307719-15307741 CACTGCACCAGAAAGGCTTCTGG + Intronic
1148139093 17:45316223-45316245 CCCAGCACTAAGGAGGCTCCCGG + Intronic
1148494038 17:48041841-48041863 GACAGCACCAAAAAGCCTCCAGG + Intergenic
1148676118 17:49445962-49445984 CACAGCACCCACAGTGCTGCGGG + Intronic
1148683276 17:49486708-49486730 CACAGCACACAGGAGGCAGCAGG - Intergenic
1150192571 17:63258803-63258825 TAAAGCACCAAGAGGGCTTCTGG - Intronic
1150541508 17:66104657-66104679 AAGAGCACCAAGCAGGCTCCTGG + Intronic
1151666389 17:75547493-75547515 CAAAGAACCTAGAAGGCTGGAGG - Intronic
1151855080 17:76715290-76715312 CACAGAACCAAGGGGGCTGTGGG + Exonic
1151986471 17:77547187-77547209 GACGGCACCAAGAAACCTGCCGG + Intergenic
1153429509 18:5000334-5000356 CAAAGCAACAAGAAGGCTCTTGG + Intergenic
1154143633 18:11848107-11848129 CCCAGCACCAAGGAGACAGCTGG + Intronic
1154930923 18:20995466-20995488 TACAGCACCAAGCAGGCTCTTGG + Intronic
1157288971 18:46396743-46396765 GCCAGCACCATGAAGGCTGCTGG - Intronic
1157447353 18:47755348-47755370 CACAGGACCAACAACTCTGCGGG - Intergenic
1157549607 18:48572368-48572390 CACAGATCCAAGAAGGATGAGGG + Intronic
1158522634 18:58184335-58184357 AACCACACCAAGCAGGCTGCTGG - Intronic
1158645004 18:59238031-59238053 CACAGTCACAAGATGGCTGCTGG + Intergenic
1161459597 19:4388986-4389008 CACAGCACCAGGGAGGCAGGTGG - Intronic
1161591294 19:5130292-5130314 CACAGCCCCCAGAAGCGTGCGGG - Intronic
1161968124 19:7560405-7560427 CACAGCCCCATGCAGGGTGCTGG - Intronic
1163184070 19:15624022-15624044 CAGAATACCAAGAACGCTGCCGG + Exonic
1165438744 19:35811999-35812021 CTCAGCTCCAAGGAGGCTCCTGG + Exonic
1165721796 19:38084166-38084188 CTCCACACCAAGATGGCTGCTGG + Intronic
1167045396 19:47046237-47046259 CCCAGCAGGAAGAAGCCTGCGGG + Exonic
1167352428 19:48983908-48983930 TACAGCTCCCAGAAGGCTGTGGG - Intronic
925739381 2:6992452-6992474 CACAGCACCAGGACTGATGCTGG + Intronic
925878532 2:8331836-8331858 TACAGCACCAAGGTGGCTGGGGG - Intergenic
926144333 2:10387434-10387456 CAGAGCACCAGGAACGCTGTGGG - Intronic
927943942 2:27123601-27123623 CCCCGCACCAAGATGGCAGCTGG + Intergenic
929695958 2:44115479-44115501 CACAGCACAAAGAAAGGTGTTGG - Intergenic
929785815 2:44990318-44990340 CACAGAACCAAGAAGGTAGCAGG + Intergenic
930265197 2:49191496-49191518 GACAGGACCAAGAAGGATGCTGG - Intergenic
933843947 2:86309985-86310007 TGCAGCACAAACAAGGCTGCCGG + Intronic
935812957 2:106817749-106817771 TAGAGCACCAAGCAGGCTCCTGG + Intronic
936091440 2:109504093-109504115 TACATCATCATGAAGGCTGCAGG - Intronic
936357918 2:111767342-111767364 CACGGCTCTAAGGAGGCTGCAGG + Intronic
937036890 2:118789451-118789473 CACAGCACCCCGAGTGCTGCAGG - Intergenic
938199004 2:129357583-129357605 CACAGAAGCAGAAAGGCTGCAGG - Intergenic
938618375 2:133022830-133022852 CAAAGAACCAAGAAGGATGAAGG + Intronic
939486548 2:142819608-142819630 CATATCAGCAAGAAGGCTGTTGG + Intergenic
942116183 2:172731353-172731375 CAGACCACCATGAAAGCTGCTGG - Intergenic
943626608 2:190208358-190208380 CACAGCAGCAGGATGGCAGCAGG + Intronic
944285858 2:197949088-197949110 CACAGCACCAAGCTGGCTTATGG - Intronic
945616377 2:212073619-212073641 CACTGCATCAAGAAGACTCCTGG - Intronic
945659218 2:212664897-212664919 CAAAGCTCCAAGAATGATGCTGG + Intergenic
947816087 2:233038127-233038149 CACAGCAAGAGGGAGGCTGCTGG + Intergenic
948388717 2:237597473-237597495 CACTTCACCCAGAAGGCTCCTGG + Intronic
948424355 2:237877935-237877957 CCCAGCACCCAGGAGGCTGAGGG - Intronic
948838636 2:240638122-240638144 CCCAGCACCATGGAGGCGGCTGG + Intergenic
1170566067 20:17606665-17606687 AACAGCACCAGGGAGGCTTCTGG - Intronic
1171113028 20:22501603-22501625 CAGAGCACCTTGAGGGCTGCTGG - Intergenic
1171416046 20:24981132-24981154 AAAATCACCAGGAAGGCTGCAGG + Intronic
1172112618 20:32556207-32556229 AACAGCACCACCAAGGCTTCTGG + Intronic
1172299605 20:33839725-33839747 CCCCGCACCAAGCAGGCAGCTGG - Intronic
1172773322 20:37393811-37393833 CACAGCACCTAGGAGGATGGTGG + Intronic
1172804590 20:37602676-37602698 CACAGGGCCAAGAAGGTTGACGG - Intergenic
1173004151 20:39126872-39126894 TAGAGCACCAAGCAGGCTGTTGG - Intergenic
1173576821 20:44117417-44117439 CACATCACAAAGTAGGCTGTGGG - Intronic
1173724862 20:45290390-45290412 CAGGGAACCAAGAAGGCTGAGGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173916740 20:46713659-46713681 CACAGCAGCCAGAAGGATTCTGG - Intronic
1176309630 21:5142748-5142770 CACAGGACTGAGAAAGCTGCCGG + Intronic
1176869224 21:14072982-14073004 CAAAGCGCCAAGAAGGCCTCCGG - Intergenic
1177132968 21:17279781-17279803 TAGAGCACCAAGCAGGCTCCTGG + Intergenic
1178755625 21:35346867-35346889 GACAGCGCCAAGAAGAATGCAGG - Intronic
1179847428 21:44119285-44119307 CACAGGACTGAGAAAGCTGCCGG - Intronic
1179924685 21:44528034-44528056 CACCCTACCAAGGAGGCTGCAGG + Intronic
1180112335 21:45666671-45666693 CACAGAAACTAGAAGGCTGTAGG - Intronic
1180488147 22:15819944-15819966 CTCAGCACCACGCAGGCCGCGGG - Intergenic
1180920693 22:19520081-19520103 ATCACCACCAAGCAGGCTGCAGG - Intronic
1180957745 22:19748552-19748574 CACAACACCTACAAGGCTCCGGG + Intergenic
1181671924 22:24429601-24429623 CACAGCAGCAGGAAGGCTCCTGG - Intronic
1181698782 22:24608381-24608403 CAAAGGCCCAAGTAGGCTGCTGG - Intronic
1181763592 22:25075295-25075317 GACAGCACCAAGAATGATCCTGG + Intronic
1183147599 22:36008903-36008925 CAAAACACCAAGAAAGCTGAAGG + Intronic
1183497207 22:38153778-38153800 CAGAGCACCAAGAGGGCTCTTGG + Intronic
1183547621 22:38463280-38463302 CACAGCACCAGAAAGGCCCCTGG + Intergenic
1184384277 22:44165487-44165509 CACAGCAACAAAAGGGCTGCAGG - Intronic
1184640798 22:45868972-45868994 CACTGCAGGAAGGAGGCTGCAGG - Intergenic
1185271419 22:49930935-49930957 CACGGCACCTGGAAGGCTTCTGG - Intergenic
951741688 3:25931831-25931853 CACAGCATAAACAAAGCTGCAGG + Intergenic
951819349 3:26791092-26791114 CAGAGCACCAAGGGGGCTGTTGG - Intergenic
952144014 3:30511851-30511873 GACAGCACCAAGAAAGATCCAGG + Intergenic
953384810 3:42500495-42500517 CACAGCACCTAGCCAGCTGCAGG - Intronic
953668920 3:44946416-44946438 CTCAGCACCAAGCAGGCTCTTGG - Intronic
955611312 3:60760252-60760274 CACGGCACCATGAAGGCCGAGGG + Intronic
959868526 3:111300011-111300033 TAGAGCACCAAGCAGGCTCCTGG - Intronic
961000878 3:123373127-123373149 CACAGCACCTAGCATGCAGCAGG + Intronic
962151950 3:132902756-132902778 CAGAGCACCAAGCAGGCTCTTGG + Intergenic
962328827 3:134459624-134459646 CATAGTTCCAAGATGGCTGCTGG + Intergenic
964758912 3:160115086-160115108 GAGAGCACCAAGGAGGCTCCTGG + Intergenic
965209588 3:165767998-165768020 TAAAGCACCAAGAAGGCTCTTGG - Intergenic
966672625 3:182544932-182544954 CACAGAAACAAAAAGGCTCCCGG + Intergenic
966828455 3:183985440-183985462 GACAGCACCAAGCAAGCTGCAGG + Intronic
967610460 3:191499844-191499866 AGCAGCTCCAAGGAGGCTGCAGG - Intergenic
968073744 3:195804484-195804506 CACAGCACTTAGAAAGCCGCAGG - Intronic
969978674 4:11131694-11131716 CACTCCTCCAAGAAGTCTGCAGG + Intergenic
970465463 4:16318175-16318197 CACTGCAGCTAGAAGGCAGCGGG - Intergenic
971215742 4:24660875-24660897 CAGAACACCCAGAGGGCTGCTGG + Intergenic
972186448 4:36533864-36533886 CACAGAACCAAGGAAGCTGTTGG + Intergenic
972908619 4:43785050-43785072 CATAGCAGCAAGAAGACAGCAGG - Intergenic
974016533 4:56654115-56654137 GACAGCAGCCAGAAGGCAGCAGG - Intronic
974695247 4:65359802-65359824 AACAGGACCAGAAAGGCTGCTGG - Intronic
976865144 4:89716536-89716558 CACAGCAATAAGAAAGGTGCAGG + Intergenic
977873679 4:102123868-102123890 TACAGCACCAAGTAGGCTCTTGG - Intergenic
978258304 4:106718992-106719014 TACAACACCAAGCAGGCTCCTGG + Intergenic
978347230 4:107784445-107784467 CACAGCAGGAGGTAGGCTGCAGG + Intergenic
978648530 4:110971775-110971797 TCCCGCACCAGGAAGGCTGCTGG + Intergenic
979291153 4:118980449-118980471 CACAGCTCCCAGGAGGATGCAGG - Intronic
979613263 4:122712068-122712090 CTCAGCACCTAGGAGACTGCTGG - Intergenic
980101754 4:128548331-128548353 CACTGCACTATGCAGGCTGCAGG + Intergenic
983221846 4:165051346-165051368 CAGAGCACCCCGAGGGCTGCTGG - Intergenic
986737616 5:10679801-10679823 AACAGCACCAGAAAGGCTGGTGG + Exonic
987067691 5:14305538-14305560 CACAGCACCTGGAAGAGTGCTGG + Intronic
988177844 5:27750122-27750144 CACAGCGGCAAGGATGCTGCTGG + Intergenic
990439505 5:55830639-55830661 CACAGCAGCAGCAAGGCTACTGG - Intergenic
990644646 5:57830539-57830561 CACTGCAACAAGAAGGCAGGAGG + Intergenic
994028569 5:95114329-95114351 CAGAGCACCAAGCAGGCTATTGG + Intronic
994091636 5:95814790-95814812 CACAGGGCCAAGAAGGTTGACGG - Exonic
994477665 5:100290993-100291015 CAGAGCACCAAGAGGGCTCTTGG - Intergenic
995019584 5:107352011-107352033 TAGAGCACCAAGCAGGTTGCAGG - Intergenic
995697789 5:114899550-114899572 TAGAGCACCAAGTAGGCTTCTGG - Intergenic
995896843 5:117022877-117022899 CAGAGCGCCTGGAAGGCTGCAGG - Intergenic
996823574 5:127656773-127656795 TACAGCACCATGAAAGATGCAGG + Intronic
997378017 5:133411326-133411348 CACAGCACAAAGAAGGCTTTTGG + Intronic
998527709 5:142857699-142857721 CACACCTCCAAGAAAGCAGCAGG - Intronic
998895326 5:146792769-146792791 AGCAGCAGCAAGAAGGCTACGGG + Intronic
1000062569 5:157670149-157670171 CACAGCAACTAAAAGTCTGCAGG + Intronic
1000479248 5:161751273-161751295 CACAGGGCCAAGAAGGTTGATGG - Intergenic
1001635333 5:173206052-173206074 CACAGGCCCCAGAAGGCTGCAGG + Intergenic
1001682650 5:173570238-173570260 ACCAGCACCAAGAACACTGCTGG - Intergenic
1002389526 5:178898847-178898869 AACAGCACCAAGAACACAGCAGG - Intronic
1002908770 6:1472069-1472091 CACAGCCCCAAGGAGCCGGCAGG - Intergenic
1003121249 6:3320470-3320492 CAAAGCACCAAGTACGCTGCTGG + Intronic
1003121441 6:3322016-3322038 CAAAGCGCCAAGTAGGCTGCCGG - Intronic
1004181111 6:13381308-13381330 GACATCACCAAGCAGGCTGTGGG - Intronic
1008177609 6:48288076-48288098 CAGAGCACCAAGCAGGCTCTTGG - Intergenic
1008536855 6:52512713-52512735 CACACCAAAAGGAAGGCTGCTGG - Intronic
1008559526 6:52710130-52710152 CAGAGCACCCTGAGGGCTGCTGG - Intergenic
1010062161 6:71635623-71635645 AAGAGCACCAAGCAGGCTCCTGG - Intergenic
1011117625 6:83911364-83911386 TACAGAACCAAGAAGTCTTCTGG + Intronic
1011209181 6:84936418-84936440 CACAGCATAAACAAAGCTGCCGG + Intergenic
1012731733 6:102891836-102891858 TACAGCAGCAAGAAGGATTCTGG + Intergenic
1012979626 6:105815992-105816014 CACAGAACCAACAAGACAGCAGG + Intergenic
1014141780 6:117952005-117952027 CACAGCATGAGGCAGGCTGCCGG - Intronic
1014328466 6:120029041-120029063 CAGAGCAACAAGAAGGCTTCTGG + Intergenic
1015218937 6:130782141-130782163 CTCAGGGCCAAGATGGCTGCTGG + Intergenic
1015806881 6:137118793-137118815 TACAGCACAAATAAGACTGCAGG - Intergenic
1015907307 6:138130105-138130127 TAGAGCACCAAGCAGGCTCCTGG + Intergenic
1017664242 6:156703787-156703809 CACAGCACAGGGAATGCTGCTGG + Intergenic
1018193993 6:161338826-161338848 CACACCCCCAACAAGGCTTCGGG - Intergenic
1018365679 6:163117377-163117399 CCCAGCACTAAGGAGGCTGGTGG + Intronic
1018884677 6:167924483-167924505 CACAGCACCAGGGCCGCTGCAGG - Intronic
1019136483 6:169911798-169911820 CATATCACCAAGACGGTTGCAGG - Intergenic
1019217277 6:170452104-170452126 CAACCCCCCAAGAAGGCTGCCGG + Intergenic
1019578089 7:1747106-1747128 CACTGGACCAAAAAGGATGCAGG + Exonic
1020073628 7:5243390-5243412 GTCAGCACCAAGGAGGCTGCAGG - Intergenic
1020354721 7:7263868-7263890 CAAAGCACAAAGAAATCTGCTGG - Intergenic
1021138651 7:16996102-16996124 CACAGCAACATGAATGCAGCTGG - Intergenic
1021670434 7:23030218-23030240 CACAACACCAGGAAGGCTGATGG + Intergenic
1021888702 7:25166054-25166076 CAAACCACCAATAAGGTTGCAGG + Intronic
1022515090 7:30970205-30970227 CACAGAACCAAGACAGCAGCCGG - Intronic
1022581672 7:31561364-31561386 CACAGCTTCAGGAAGGCTGGGGG - Intronic
1023882613 7:44328952-44328974 AACTGCACAAAGAAGGCTGGTGG - Intronic
1024538253 7:50456396-50456418 CCCATCACCAAGGAGCCTGCAGG - Intronic
1024759377 7:52576187-52576209 CAGAGAACCAGGAAGGCTGCTGG - Intergenic
1027187591 7:75981356-75981378 CAGAGCATCAGGAAGGCTCCAGG - Intronic
1028001377 7:85502141-85502163 TAGAGCACCAAGGAGGCTCCTGG + Intergenic
1028160938 7:87483954-87483976 CAAAGCACCAAGCAGGCTCTTGG + Intergenic
1030587968 7:111445202-111445224 CACATCCCCAAGAACACTGCAGG + Intronic
1031439986 7:121782307-121782329 CACAGGACTAAGAAAGCTGAAGG + Intergenic
1035084511 7:156246879-156246901 TACAGCACCAAGTAGGCTCTTGG - Intergenic
1035254761 7:157619148-157619170 GACAGAGCCCAGAAGGCTGCAGG + Intronic
1035627970 8:1088126-1088148 CACGTCACCAAGGCGGCTGCTGG + Intergenic
1037034132 8:14144658-14144680 TAGAGCACCAAGCAGGCTCCTGG + Intronic
1037354139 8:17999117-17999139 TAGAGCACCAAGCAGGCTCCTGG - Intronic
1038319236 8:26513177-26513199 CACTGCGCCAAGAAGGGCGCAGG - Intronic
1039925890 8:41932248-41932270 CACAGCTACATGAACGCTGCTGG - Exonic
1040095709 8:43440490-43440512 TAGAGCACCAAGAAGGCTCATGG + Intergenic
1040276872 8:46018320-46018342 CAAAGCAGCAAGAAGGCCCCAGG - Intergenic
1040278607 8:46026339-46026361 CAAAGCAGCAAGAAGGCCCCTGG - Intergenic
1040627325 8:49163833-49163855 CACAGCACCAGGAAGCCAGATGG - Intergenic
1041416025 8:57609582-57609604 TAGAGCACCAAGCAGGCTCCTGG + Intergenic
1041419070 8:57646772-57646794 CACAGTACTAAGGAAGCTGCCGG - Intergenic
1041817436 8:61990780-61990802 CACTCCACCAAAAAGGATGCAGG + Intergenic
1041869249 8:62614966-62614988 CAGAGCACCAAGCAGGCTCTTGG - Intronic
1044318733 8:90778413-90778435 TGCAGCAACATGAAGGCTGCTGG - Intronic
1044582804 8:93839035-93839057 CAGAACACCAAGAAGACTGGGGG - Intergenic
1044635422 8:94319385-94319407 TAGAGCACCAAGTAGGCTCCTGG - Intergenic
1044717656 8:95115237-95115259 GTCAGCACCAAGAAGGCTGAAGG + Intronic
1046580437 8:116086109-116086131 CACAGAACCTAGCAGGCTGATGG + Intergenic
1047359184 8:124152286-124152308 CCCAACACCAAGAATGCAGCCGG + Intergenic
1047583124 8:126238574-126238596 GACAGCCCCAAGCATGCTGCAGG - Intergenic
1049411187 8:142474700-142474722 CACAGGTCCATGAAGGCCGCGGG + Intronic
1049479710 8:142816094-142816116 CTCAGCTCCCAGCAGGCTGCAGG + Intergenic
1049554480 8:143275203-143275225 CACAGCTCCAACCAGGCTGAGGG - Intronic
1049710701 8:144062045-144062067 CAGAGCACCCCGAGGGCTGCTGG - Intronic
1049724475 8:144139197-144139219 CACAGCACCAGGTCGGCAGCAGG + Exonic
1049782322 8:144434677-144434699 CACAGCACCCACCAGGCTGGGGG + Intronic
1050941052 9:11458479-11458501 CACAGAAACAAGAAAGCTGCAGG + Intergenic
1051555484 9:18377973-18377995 CTCAGCACCCTGAAAGCTGCTGG + Intergenic
1051605115 9:18910842-18910864 CACAAGACAATGAAGGCTGCTGG + Exonic
1051748202 9:20315716-20315738 CACAGGACCAGGATGGTTGCTGG - Intergenic
1055360617 9:75486166-75486188 CACAGTGCCAAAAATGCTGCTGG + Intergenic
1055648175 9:78380422-78380444 CACAGCCAAAAGGAGGCTGCTGG - Intergenic
1055783193 9:79842653-79842675 CACAGGACAAGGAAGGCTGTGGG + Intergenic
1055827569 9:80345390-80345412 CACAGCTCAAGGAAGCCTGCCGG + Intergenic
1056211963 9:84373230-84373252 GAGAGGACCAAGAAGGCTGTGGG - Intergenic
1058001459 9:99870162-99870184 CACAGCTCCATGAATGCAGCTGG - Intergenic
1058522799 9:105828606-105828628 TACAGTACCAAGCAGGCTCCTGG - Intergenic
1058550761 9:106112399-106112421 CACAGCATCCATAAGGCTCCAGG + Intergenic
1059162948 9:112052179-112052201 TACCCCACCAAGAAGGCTCCAGG - Intronic
1059419829 9:114183975-114183997 CAGAGCACCAAGAGGATTGCCGG + Intronic
1060186089 9:121564989-121565011 CAGAGCGTTAAGAAGGCTGCGGG + Intergenic
1060747076 9:126144636-126144658 CACAAAAAAAAGAAGGCTGCAGG + Intergenic
1061568528 9:131460883-131460905 CCCAGCAGCAAGGAGCCTGCTGG - Intronic
1061996906 9:134190773-134190795 CTCAGCCCCCAGAAGGCTCCCGG - Intergenic
1203686514 Un_KI270757v1:69028-69050 CACATCACAAAGAAGGTTCCTGG + Intergenic
1189375389 X:40462531-40462553 CACAACCCCAAAAAGGCTGAGGG + Intergenic
1189539385 X:41970643-41970665 CACTGCACAAAGAAGACTGGAGG + Intergenic
1190641475 X:52484785-52484807 CACAGCACCAAGAAAAATCCTGG + Intergenic
1190646197 X:52528080-52528102 CACAGCACCAAGAAAAATCCTGG - Intergenic
1191700252 X:64034114-64034136 TACAGCAGCAAGAAGGATCCAGG - Intergenic
1193289310 X:79753198-79753220 TAGAGCACCAAGAAGGCTCTTGG - Intergenic
1193802463 X:85952743-85952765 CAGAGCACCAAGCAGGCTCTTGG + Intronic
1194447155 X:94002293-94002315 CAGAGCAGCAAGAATGCTCCTGG - Intergenic
1194626335 X:96230344-96230366 TAGAGCACCAAGGAGGCTTCTGG + Intergenic
1194877549 X:99208190-99208212 TAGAGCACCAAGCAGGCTCCTGG - Intergenic
1195324434 X:103746897-103746919 CACTTCACCCAGAAGGCAGCTGG - Intergenic
1195751250 X:108163393-108163415 CACAGTGCCAAGGAGGCTGAGGG + Intronic
1196810645 X:119626428-119626450 CACAGGACTATGAAGGCAGCAGG + Intronic
1199303570 X:146240898-146240920 TGCAGCAACAAGAAGGCAGCTGG - Intergenic
1199405373 X:147452268-147452290 CAAAGCAGGAAGAAGGCAGCCGG + Intergenic
1199845253 X:151688238-151688260 CACAGTACCATGCTGGCTGCAGG + Intergenic
1200301298 X:154979431-154979453 CACACCACCAAGGAGCCTGAGGG - Intronic