ID: 1128072366

View in Genome Browser
Species Human (GRCh38)
Location 15:64805944-64805966
Sequence CCTTAGCCAGGGCAGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128072360_1128072366 7 Left 1128072360 15:64805914-64805936 CCATGGGAGCCTCAGCAGGCTGT No data
Right 1128072366 15:64805944-64805966 CCTTAGCCAGGGCAGGAGCCTGG No data
1128072358_1128072366 22 Left 1128072358 15:64805899-64805921 CCATTCTGAGAGAGGCCATGGGA No data
Right 1128072366 15:64805944-64805966 CCTTAGCCAGGGCAGGAGCCTGG No data
1128072361_1128072366 -2 Left 1128072361 15:64805923-64805945 CCTCAGCAGGCTGTGAGACAACC No data
Right 1128072366 15:64805944-64805966 CCTTAGCCAGGGCAGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128072366 Original CRISPR CCTTAGCCAGGGCAGGAGCC TGG Intergenic
No off target data available for this crispr