ID: 1128074279

View in Genome Browser
Species Human (GRCh38)
Location 15:64816583-64816605
Sequence GCTCCTGCCCCGCCGCAGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 231}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128074274_1128074279 -5 Left 1128074274 15:64816565-64816587 CCCTCTTACCAGACTGAGGCTCC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1128074279 15:64816583-64816605 GCTCCTGCCCCGCCGCAGGGTGG 0: 1
1: 0
2: 1
3: 22
4: 231
1128074269_1128074279 18 Left 1128074269 15:64816542-64816564 CCACAGCCCACCACTGGATGACT 0: 1
1: 0
2: 0
3: 16
4: 208
Right 1128074279 15:64816583-64816605 GCTCCTGCCCCGCCGCAGGGTGG 0: 1
1: 0
2: 1
3: 22
4: 231
1128074271_1128074279 11 Left 1128074271 15:64816549-64816571 CCACCACTGGATGACTCCCTCTT 0: 1
1: 0
2: 0
3: 9
4: 156
Right 1128074279 15:64816583-64816605 GCTCCTGCCCCGCCGCAGGGTGG 0: 1
1: 0
2: 1
3: 22
4: 231
1128074275_1128074279 -6 Left 1128074275 15:64816566-64816588 CCTCTTACCAGACTGAGGCTCCT 0: 1
1: 0
2: 1
3: 20
4: 145
Right 1128074279 15:64816583-64816605 GCTCCTGCCCCGCCGCAGGGTGG 0: 1
1: 0
2: 1
3: 22
4: 231
1128074265_1128074279 29 Left 1128074265 15:64816531-64816553 CCTGCCCGTGGCCACAGCCCACC 0: 1
1: 0
2: 2
3: 35
4: 428
Right 1128074279 15:64816583-64816605 GCTCCTGCCCCGCCGCAGGGTGG 0: 1
1: 0
2: 1
3: 22
4: 231
1128074266_1128074279 25 Left 1128074266 15:64816535-64816557 CCCGTGGCCACAGCCCACCACTG 0: 1
1: 1
2: 2
3: 30
4: 350
Right 1128074279 15:64816583-64816605 GCTCCTGCCCCGCCGCAGGGTGG 0: 1
1: 0
2: 1
3: 22
4: 231
1128074264_1128074279 30 Left 1128074264 15:64816530-64816552 CCCTGCCCGTGGCCACAGCCCAC 0: 1
1: 0
2: 2
3: 40
4: 365
Right 1128074279 15:64816583-64816605 GCTCCTGCCCCGCCGCAGGGTGG 0: 1
1: 0
2: 1
3: 22
4: 231
1128074267_1128074279 24 Left 1128074267 15:64816536-64816558 CCGTGGCCACAGCCCACCACTGG 0: 2
1: 0
2: 6
3: 40
4: 467
Right 1128074279 15:64816583-64816605 GCTCCTGCCCCGCCGCAGGGTGG 0: 1
1: 0
2: 1
3: 22
4: 231
1128074272_1128074279 8 Left 1128074272 15:64816552-64816574 CCACTGGATGACTCCCTCTTACC 0: 1
1: 0
2: 1
3: 9
4: 130
Right 1128074279 15:64816583-64816605 GCTCCTGCCCCGCCGCAGGGTGG 0: 1
1: 0
2: 1
3: 22
4: 231
1128074270_1128074279 12 Left 1128074270 15:64816548-64816570 CCCACCACTGGATGACTCCCTCT 0: 1
1: 0
2: 0
3: 17
4: 154
Right 1128074279 15:64816583-64816605 GCTCCTGCCCCGCCGCAGGGTGG 0: 1
1: 0
2: 1
3: 22
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128074279 Original CRISPR GCTCCTGCCCCGCCGCAGGG TGG Exonic
900598435 1:3493033-3493055 GTTCCTGCCCCGCCCCAGGAGGG + Intronic
900781973 1:4624299-4624321 GCCCCTCCCCTGCAGCAGGGAGG - Intergenic
901210850 1:7525230-7525252 GCTCCCACCCTGCTGCAGGGCGG - Intronic
901781808 1:11599195-11599217 GCTGCTGCCACCCCTCAGGGTGG + Intergenic
902585783 1:17438102-17438124 GCGCCGGCCCGGCCGCCGGGAGG + Intronic
903420822 1:23217114-23217136 GGACCTGCCCGGCCGGAGGGAGG - Intergenic
905199626 1:36307054-36307076 CCTCCAGCCCCGCCCCAGGGCGG - Intronic
906125042 1:43422563-43422585 GCTCCAGTCCCGCAGCAGAGAGG - Exonic
907909484 1:58814321-58814343 GCTCCTGACCCGGGGCAGGAAGG - Intergenic
909566471 1:77058405-77058427 ACTCATGCCCCGCCCCAGGGAGG - Intronic
913519506 1:119631727-119631749 GCTCCTGGCCCGCCGCCCGCCGG - Intronic
913680575 1:121185154-121185176 GCTCCAGCCCGGCGGCCGGGAGG - Intronic
914032406 1:143972796-143972818 GCTCCAGCCCGGCGGCCGGGAGG - Intergenic
914157039 1:145095171-145095193 GCTCCAGCCCGGCGGCCGGGAGG + Intronic
914939145 1:152006841-152006863 GAAGCTGCCCCGCTGCAGGGGGG - Intergenic
915234286 1:154469047-154469069 GCTGGTGCCCAGCCGCACGGAGG - Exonic
915469147 1:156115333-156115355 GCCCCTGGCCGGCCGCAGGAAGG + Intronic
917797339 1:178541920-178541942 GCTTCTACACCCCCGCAGGGAGG + Intronic
919513582 1:198494807-198494829 GCTGCTGTCCCGCCGGTGGGTGG + Intergenic
920467884 1:206203680-206203702 GCTCCAGCCCGGCGGCCGGGAGG - Intronic
920547968 1:206834456-206834478 CCTCCTTCACTGCCGCAGGGAGG + Intronic
923141344 1:231163192-231163214 CCGCCTGCACCGCCGCAGGCCGG - Exonic
1062860216 10:804866-804888 GCTCCAGCCACGCCGCACGCCGG - Intergenic
1063166421 10:3467458-3467480 TGTCCTGCCCCGCCGCACGGGGG - Intergenic
1063458759 10:6202724-6202746 GCTCCAGGCCCGGGGCAGGGCGG + Intronic
1064138201 10:12768444-12768466 TCTCCTCCCCCGCCCCAGCGGGG - Intronic
1065099871 10:22321795-22321817 GCCCCGGCCGCGCCGCCGGGAGG + Intronic
1067711767 10:48656082-48656104 GCTCCTTCCTCGCCGCCCGGCGG + Intronic
1070752833 10:78974000-78974022 GCTACTGCCCGGTCGCCGGGAGG - Intergenic
1074860277 10:117504767-117504789 GCTCCCGCCCTGCCGATGGGAGG + Intergenic
1076117059 10:127907793-127907815 GATGCTGCCCCGCAGCCGGGCGG + Intronic
1076323071 10:129598150-129598172 TCTCATGCCCAGCCTCAGGGTGG + Intronic
1076722421 10:132398543-132398565 GCTCGTGCCCCTCTTCAGGGAGG - Intronic
1076794290 10:132791235-132791257 GCCCCTGCCCTGCCTCAGGGTGG - Intergenic
1077046963 11:551019-551041 GCCCCTGCCCTGCCCCACGGTGG + Intronic
1077058288 11:606448-606470 GCTCTGGCACCGCGGCAGGGAGG - Exonic
1077218529 11:1405094-1405116 CCTCCAGCCCCTCCCCAGGGAGG + Intronic
1078371630 11:10751281-10751303 GCTCCAGCGGCGCCGCGGGGCGG + Exonic
1078514370 11:12009406-12009428 GCTGCGGCCCCTCCGCGGGGCGG - Intronic
1078594484 11:12674673-12674695 GCTCCTGCCCCGGGGCCGGCTGG - Exonic
1081662949 11:44899567-44899589 CCTCCTGCCCCGCCACAAGGTGG - Intronic
1083618162 11:64036372-64036394 GCGCTGGCCCCGCCGCGGGGAGG + Intronic
1084448908 11:69220959-69220981 AATCCTGCCCGGCCACAGGGCGG - Intergenic
1084479268 11:69409239-69409261 TCTCCTGCCCCTCCACAAGGTGG - Intergenic
1084980091 11:72824370-72824392 GCTCCTGCCCTGCCTGAGGCTGG - Intronic
1089395793 11:118135866-118135888 GCTCCTCCCCAACCCCAGGGTGG + Exonic
1090202513 11:124866430-124866452 GCTCCGGCCTCTCCGCAGGCTGG - Intronic
1090347997 11:126086388-126086410 GCTCCCTCCCCGCCTCAGGTAGG - Intergenic
1092179391 12:6435039-6435061 CCTCCCTCCCCGCCACAGGGAGG + Intergenic
1092204444 12:6606824-6606846 GCCCCTCCCCGGGCGCAGGGAGG - Intronic
1095996027 12:48085372-48085394 GCCCCTGGCCCTCCGCAGGGTGG - Intronic
1096714669 12:53483829-53483851 GCTCCTACCCAGCCCCAGGGCGG - Intronic
1097187293 12:57202635-57202657 GCTCCTGCCCCCACCCTGGGAGG - Intronic
1098461437 12:70736990-70737012 TCTCCTGCCCCACTGCTGGGAGG + Intronic
1103856247 12:123972896-123972918 GCCCCTGCCCCGCCACAGCCGGG - Intronic
1104768517 12:131345893-131345915 CCTCCTGCCCTGCCCCAGGAGGG + Intergenic
1107862983 13:44678472-44678494 GCTCCTGCCTGGCTGCAGAGGGG - Intergenic
1108615627 13:52129096-52129118 GCTCCGCCCCGGCCGCAGGGAGG - Intergenic
1113656199 13:112068894-112068916 GCTCCCGCCCCGCCCCGGCGCGG + Exonic
1114674260 14:24430253-24430275 GCTCCTGGCCCGACGGAGAGGGG + Intronic
1121019853 14:90573273-90573295 CCTCCTTCCCCACTGCAGGGTGG + Intronic
1121671536 14:95714172-95714194 CCTCCCGCCCCGCCGCTTGGTGG - Exonic
1122133687 14:99620539-99620561 GCCCCTTCCTCCCCGCAGGGGGG + Intergenic
1122517674 14:102319992-102320014 GCCCCGGCCCCGCTGCAGGGCGG - Exonic
1122634352 14:103123239-103123261 GCCCCTGCCCGGCTGCTGGGAGG + Intergenic
1122770557 14:104095839-104095861 CCACCTGCCCCGCAGGAGGGGGG + Intronic
1122806558 14:104262899-104262921 GCTCCTCCTCTGCCCCAGGGTGG - Intergenic
1122837797 14:104438563-104438585 GGGCCTGCCCTGCTGCAGGGTGG - Intergenic
1122913166 14:104843611-104843633 TCGCCTGCCCCGCCGCCCGGCGG + Intergenic
1123017458 14:105382191-105382213 GCTCCTGCTACACAGCAGGGCGG + Intronic
1123500804 15:20878791-20878813 GCTCCTGCGGCGCCGCAGCCTGG - Intergenic
1125450057 15:39798679-39798701 GCTCCTGACCTCCCGCAGGAGGG + Intergenic
1125514223 15:40308896-40308918 GCCCCAGCCCCGCTGCAGGCTGG - Intergenic
1125673981 15:41493196-41493218 GCTCCTGCCACCCAGCAGCGGGG + Intergenic
1127359298 15:58230817-58230839 GCTCCAGCCCAGCCCCAGGCAGG + Intronic
1127359331 15:58230998-58231020 GCTCCAGCTCCGCCCCAGGCAGG + Intronic
1127477700 15:59350243-59350265 GCTCCTGCCTTTCCTCAGGGTGG + Intronic
1128074279 15:64816583-64816605 GCTCCTGCCCCGCCGCAGGGTGG + Exonic
1128449039 15:67791073-67791095 GCTCCTGCCCAGCTGCAGCTCGG - Intronic
1129823512 15:78620078-78620100 GGCCCTGGCCCGCCGCTGGGAGG - Intronic
1131694111 15:94856558-94856580 GCTCCGGCCCCGGCACCGGGAGG + Intergenic
1132701644 16:1224696-1224718 GCCCCTGCCAGGCCTCAGGGCGG + Intronic
1132846229 16:2002080-2002102 GCTCCAGCCTGGCCGGAGGGTGG + Intronic
1133235663 16:4386318-4386340 TCTCCTGCCCGGCCCCAGTGTGG - Intronic
1136293686 16:29290265-29290287 GCTCCTGCCCTGCCCTAGGCTGG + Intergenic
1136687334 16:32003044-32003066 GCAGCTGCCCCGCCCCAGGCAGG + Intergenic
1136691882 16:32038873-32038895 CCTCCTGTCCCCCTGCAGGGAGG - Intergenic
1136787944 16:32946595-32946617 GCAGCTGCCCCGCCCCAGGCAGG + Intergenic
1136792470 16:32982435-32982457 CCTCCTGTCCCCCTGCAGGGAGG - Intergenic
1136877347 16:33871472-33871494 CCTCCTGTCCCCCTGCAGGGAGG + Intergenic
1136881837 16:33907194-33907216 GCAGCTGCCCCGCCCCAGGCAGG - Intergenic
1137271252 16:46903689-46903711 GCTCCTGCCCCACCCCAGGCAGG - Intronic
1137780767 16:51096020-51096042 GCCCCCACCCCGCAGCAGGGGGG - Intergenic
1139459454 16:67110127-67110149 CCTTCTGCGCTGCCGCAGGGAGG + Exonic
1139534454 16:67562812-67562834 GCGCCAGCGCCGCCGCCGGGGGG + Intronic
1139570250 16:67807038-67807060 ACTCCGCCCCCGCCGCGGGGGGG + Intronic
1141542300 16:84735114-84735136 CCCCCCGCCCCGCCTCAGGGGGG + Intronic
1141644567 16:85360351-85360373 GCCCCTGCCCTGCGGCCGGGTGG + Intergenic
1142099569 16:88264271-88264293 GCTCCTGCCCTGCCCTAGGCTGG + Intergenic
1142251310 16:88993278-88993300 GCTCCTGCCCAGCTGCAGCCCGG - Intergenic
1203090174 16_KI270728v1_random:1208252-1208274 GCAGCTGCCCCGCCCCAGGCAGG + Intergenic
1203094676 16_KI270728v1_random:1243900-1243922 CCTCCTGTCCCCCTGCAGGGAGG - Intergenic
1142586919 17:979676-979698 CATCCTGGCCCACCGCAGGGCGG + Exonic
1143150968 17:4807469-4807491 GCTGCTGCGCCGCCCCAGGTCGG + Intronic
1144339744 17:14301676-14301698 GCTCCTGCGCCGCCGCGCCGGGG + Exonic
1147678140 17:42221253-42221275 AATCCTGCCCAGCCACAGGGAGG + Intronic
1147687809 17:42297685-42297707 TATCCTGCCCAGCCACAGGGAGG - Intronic
1147966076 17:44194889-44194911 GCTCCTGCCTTGCCGAGGGGAGG - Intronic
1148206561 17:45783747-45783769 CCTCCTAGCCAGCCGCAGGGCGG + Intergenic
1148778545 17:50109269-50109291 CTTCCTGCCCCGCTGCAGGCTGG + Exonic
1149982068 17:61318613-61318635 GCTGCTGCCTCACTGCAGGGTGG - Intronic
1151540913 17:74764109-74764131 GCTGCTGCACCGGGGCAGGGAGG + Intronic
1151625249 17:75271865-75271887 GCTCCTGCCGCGCGACCGGGAGG + Intergenic
1151816072 17:76472048-76472070 TCCCCTGCCCCGCCCCAGGTGGG - Exonic
1152081662 17:78191200-78191222 GCACCTGCCCCTGAGCAGGGAGG - Intronic
1152093100 17:78257740-78257762 TCTCCTGCCCCAACGCAGGCTGG + Intergenic
1152551551 17:81032902-81032924 CCACCTGCCCAGCCGCCGGGCGG + Intergenic
1152817120 17:82414627-82414649 GTCCCAGCCGCGCCGCAGGGAGG - Intronic
1152926508 17:83090138-83090160 ACCCCCGCCCCGCCCCAGGGTGG + Intronic
1152926523 17:83090170-83090192 ACCCCTGCCCCGCCCCAGGGTGG + Intronic
1152926537 17:83090202-83090224 ACCCCCGCCCCGCCCCAGGGTGG + Intronic
1152938452 17:83153716-83153738 CCTCCTGCCCCGCTGGGGGGAGG + Intergenic
1156518355 18:37699901-37699923 GCTCCAGCCCTGCAGCAGGCTGG + Intergenic
1159552034 18:69905197-69905219 GATCCTGCCCTGCTGCAGGGTGG - Intronic
1160166975 18:76522363-76522385 GCTCCTGCGCCGGCCTAGGGAGG + Intergenic
1160691385 19:461914-461936 GCACCTGCCCCGCCCCAAGCAGG + Intergenic
1160719444 19:590821-590843 CCACCCGCCGCGCCGCAGGGCGG - Intronic
1160865854 19:1255647-1255669 GCTCTGGCCCTGCAGCAGGGAGG - Exonic
1161514405 19:4688727-4688749 GCCCCTGCCCCGCCCCACGGAGG - Intronic
1161581213 19:5082084-5082106 GCCCCTGCCCTGCCCCAAGGCGG - Intronic
1163005922 19:14396631-14396653 GGTCCTGCCACACGGCAGGGAGG + Intronic
1163758206 19:19119530-19119552 GCACCTGCCCGGGTGCAGGGTGG - Intronic
1165096148 19:33410971-33410993 GCCGCTGCCCCGGGGCAGGGAGG - Intronic
1165097292 19:33416596-33416618 CCTCCTCCCCAGCAGCAGGGAGG + Intronic
1165476348 19:36032908-36032930 CCTCCTCCCCCGCCGCCGGTAGG - Intronic
1166100362 19:40567986-40568008 GCACCTGCTCCGCCGCCGCGGGG - Exonic
1166894713 19:46016230-46016252 GCCCCTGCCCTGCGGTAGGGAGG + Intronic
1166957046 19:46471565-46471587 GCTCCCGCACCGCCGCTCGGGGG + Intergenic
1167464314 19:49642202-49642224 GCTCCGGCCCCGGCGCGGGGCGG - Exonic
925730661 2:6917748-6917770 GGTCCTGCCCCGGCGCCCGGTGG + Intronic
925927198 2:8678971-8678993 GCTCCGGCCCCGCCGCGGCCTGG + Exonic
927640263 2:24841411-24841433 GCTCCAGCCCCTCCTCAGTGAGG + Intronic
929511431 2:42568625-42568647 GCTGCTGCCTCGCCACGGGGGGG - Intronic
934534564 2:95122063-95122085 GCTCCTGCAGCGCCGGAGAGAGG + Intronic
935349693 2:102142707-102142729 GCTCTAGCCCCGCCGCTGCGGGG - Intronic
935591847 2:104852341-104852363 TCTCCTGCCCAGCCGCAGCCAGG - Intergenic
936428411 2:112437533-112437555 GCTCCTCCCCCGCCCACGGGGGG + Intergenic
938480520 2:131658342-131658364 ACTCCTGCCCCGCCGCACCCTGG - Intergenic
938496938 2:131802639-131802661 GCGCCTGCGCCGGCGCTGGGGGG + Intergenic
947623440 2:231604957-231604979 GCTCCTGGCCCGGGGCAGGCGGG + Intergenic
948460352 2:238127351-238127373 GCTCCTCCCCTGCTGCAGGAGGG + Intronic
948818454 2:240525938-240525960 GTTCCTGCCCTGCCATAGGGTGG - Intronic
949065518 2:241987970-241987992 GCGCCTGCCCCTCCTCTGGGTGG - Intergenic
1170578384 20:17681288-17681310 GCCCCGGCCCCGCCGCCAGGGGG + Intronic
1171379577 20:24724236-24724258 GCTCCTGCCCCGAGGCAAGAGGG + Intergenic
1175428885 20:58889279-58889301 GCCCCTGTCCCGGCGCGGGGCGG + Intronic
1175979178 20:62728367-62728389 GCTCCACCCCCTCCTCAGGGTGG - Intronic
1176412189 21:6455065-6455087 TCTGCTGCTCCGCCGCAGGGTGG - Intergenic
1178910469 21:36669383-36669405 CCTCCCGCCCCTCCGCAGAGAGG - Intergenic
1178924253 21:36761831-36761853 GCCCCTGCCTCGCCGGCGGGAGG + Intronic
1179687683 21:43063387-43063409 TCTGCTGCTCCGCCGCAGGGTGG - Intronic
1179810653 21:43866961-43866983 GGTGCTGCCCCGCCCCAGGCTGG + Intronic
1181053510 22:20248686-20248708 GCACCTGCCATGCAGCAGGGTGG - Intronic
1182771805 22:32801768-32801790 GCTCCTGCTCCTTCGCCGGGAGG + Exonic
1183064613 22:35354391-35354413 GCACCTGCCCCGCAGGAGGTGGG + Intergenic
1183655812 22:39184164-39184186 GATTCTGCCCCGCCCCAGGTGGG - Intergenic
1183723652 22:39576663-39576685 TCTCCTGCCTCCCCGCAGGCTGG - Intronic
1184095641 22:42314863-42314885 CCTCCAGCCCCGACCCAGGGAGG + Intronic
1184668422 22:46000617-46000639 GCTCCTGCCTCCCTGCAGGTAGG + Intergenic
1184685484 22:46094908-46094930 GCAGCTGCCCTGGCGCAGGGGGG + Intronic
1185226527 22:49656747-49656769 ATTCCTGCCCCGCCACAGGCAGG + Exonic
950177019 3:10882013-10882035 GCTCCTGCCCCTCCACATGTGGG + Intronic
951217728 3:20040502-20040524 GCTCCTGCCCCGCAGCCGCCCGG - Exonic
954202103 3:49029503-49029525 GCTCCGCCCCCGCCGCAGCGAGG - Intergenic
954806246 3:53222543-53222565 GCTCCTTCCCCTGCTCAGGGAGG - Intergenic
954898059 3:53994403-53994425 GCTCCTGCCCTTCAGCATGGAGG + Intergenic
955216566 3:56989138-56989160 GCTCCAGCTCCGCTGCCGGGTGG + Intronic
956716543 3:72085112-72085134 GCTCCTCCCCAGCCCCAGGAAGG - Intergenic
960951204 3:122999654-122999676 TCTCCTTCCCCTCCCCAGGGAGG + Intronic
961013320 3:123449540-123449562 GGTTCTGCCCCGACGCAGGCAGG + Exonic
961446403 3:126983559-126983581 GTCCCAGCCCCGCCGCACGGGGG - Intergenic
961499813 3:127324167-127324189 GCTCCTGCCCACCATCAGGGAGG + Intergenic
963044619 3:141093627-141093649 CCTTCTGCAGCGCCGCAGGGTGG - Intronic
963598419 3:147356804-147356826 CCACCTGCCCCGGCGCTGGGCGG + Intergenic
964569447 3:158095546-158095568 GCACCTGCCCCGCTCCAGAGAGG + Intergenic
967055431 3:185825427-185825449 GCTCCGGCCCCGCGCCAGGCGGG + Intergenic
968093043 3:195909770-195909792 GCGCCTGCGCCGCCCCGGGGTGG + Intronic
968196587 3:196712279-196712301 GCTCCTCGCCCGCCCCCGGGTGG + Exonic
968544821 4:1193429-1193451 CCTCCTCCCCAGCCCCAGGGTGG - Intronic
968646826 4:1745300-1745322 GTCCCTGCCCCTCGGCAGGGTGG - Intergenic
968693513 4:2008755-2008777 GCACCTCCCGCGCCGCACGGTGG - Exonic
968967555 4:3776802-3776824 GTCCCTGCCCCTCAGCAGGGAGG + Intergenic
969253846 4:5989571-5989593 CCTGCTGCCCGGCTGCAGGGTGG + Exonic
985096763 4:186420542-186420564 GCCCCTGCCCAGCAGCAGGAGGG + Intergenic
985789033 5:1915554-1915576 GCTGCTCCCCAGACGCAGGGCGG - Intergenic
986625608 5:9721004-9721026 GCTACTGCCCTGCAGCAGGCAGG - Intergenic
988869234 5:35370497-35370519 GCACGTGCCCCTCAGCAGGGAGG - Intergenic
989638089 5:43557101-43557123 GCCCCTGCCGCGCCGAAGGCGGG - Intronic
996056541 5:118988657-118988679 GTTCCTTCCCAGCGGCAGGGTGG - Intergenic
997647232 5:135489497-135489519 GCCCCTGTCCGGCCGGAGGGAGG + Intergenic
999508614 5:152224239-152224261 GCTCTTGCCCAGCCCCATGGAGG - Intergenic
999655969 5:153811082-153811104 GCTCCTGCCCCGCTGTTGCGGGG - Exonic
1002437024 5:179237993-179238015 CCCCCTGCCCCGCCCCACGGAGG + Intronic
1005859105 6:29887876-29887898 GGTCCTGCGCCCCCGCCGGGCGG - Intergenic
1006188007 6:32191446-32191468 GCTCTTGCCCCCCTGGAGGGAGG + Exonic
1006717603 6:36130460-36130482 GCTCCTCCCCCGCGCGAGGGCGG - Exonic
1007373778 6:41443117-41443139 CCTCCTGACCCACCCCAGGGCGG + Intergenic
1010147971 6:72694292-72694314 CTTCCTGCCCAGCCACAGGGGGG - Intronic
1011696514 6:89918089-89918111 GCTCCTGCCTAGCCCCAGTGTGG + Intergenic
1013099704 6:106975651-106975673 CCTCCTCGCCCGCCGCAGGCAGG - Intergenic
1013117891 6:107115856-107115878 GCTCCTGCGGCCCCGCGGGGCGG + Intergenic
1015244567 6:131062687-131062709 GCTCCATCCCCCCCGCGGGGAGG - Intronic
1015820660 6:137257210-137257232 GTTCCTGCCCTGCTGCAGTGTGG + Intergenic
1019142684 6:169957938-169957960 GCCACTGCCCCTCCCCAGGGAGG + Intergenic
1019409616 7:900819-900841 GCACCTGCCCTCCCGCAGAGGGG - Intronic
1023117530 7:36876772-36876794 ACTCCTGCCCCAAAGCAGGGAGG + Intronic
1025035055 7:55588759-55588781 GCTCCTTCCTCACCCCAGGGAGG + Intergenic
1025102036 7:56143617-56143639 GCTCCTGCACAGCCTCAGGATGG + Intergenic
1026833339 7:73623186-73623208 GCTCCTGCTCCCCCGCAGGGCGG + Intronic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1028675368 7:93454159-93454181 ACTCCTGCCCAGCCCAAGGGAGG - Intronic
1032125370 7:129189163-129189185 GCTCCGGCCCCCGCGCTGGGCGG - Exonic
1033339155 7:140478806-140478828 GCTCCTCCCCTGCCGCTGGAAGG - Intronic
1034255004 7:149720081-149720103 GCTCCTGCCCCTCATCAGCGTGG - Exonic
1034306658 7:150049107-150049129 CCTCCTGCCCAGCCGCAGGAAGG + Intergenic
1034496677 7:151427453-151427475 GCCCCTGCCCCTACCCAGGGAGG + Intergenic
1034800187 7:154051536-154051558 CCTCCTGCCCAGCCGCAGGAAGG - Intronic
1034951374 7:155298673-155298695 GCTGCTGTCCCGCAGCAGGGAGG - Exonic
1035732393 8:1862219-1862241 GCGGCCGCCCCGCCCCAGGGAGG - Intronic
1038319361 8:26513704-26513726 GCCTCTGCCCCGCCGCATGGCGG - Intronic
1039561241 8:38514055-38514077 GCTGCTGCCCCAGCCCAGGGAGG - Intronic
1047685783 8:127303507-127303529 CCTCCTTCCTCGCAGCAGGGAGG - Intergenic
1049004748 8:139847613-139847635 GCTCGTGCCCATCCGCAGGCTGG - Intronic
1049206804 8:141367342-141367364 GCTCCTTCCCCGCCCCCAGGAGG + Intergenic
1049214622 8:141402031-141402053 CCTCCAGCCCCGACCCAGGGTGG - Intronic
1049534397 8:143171526-143171548 GGTCCTGCCTCGCCTCTGGGAGG - Intergenic
1049784162 8:144442650-144442672 GGCCCTGCCCCGCCCCAGGAGGG - Intronic
1054775531 9:69121227-69121249 GCCCCTGCCCCACCGCTGAGTGG + Intergenic
1054835667 9:69672608-69672630 GCCCCTGCCCCGGCGCCGGTGGG + Intergenic
1056235009 9:84585951-84585973 CCTCCCGCCCCGCCCCAGTGTGG - Intergenic
1059123274 9:111661537-111661559 GCTGCTTCCCCGCCCCGGGGCGG + Exonic
1060827640 9:126695840-126695862 GGTCCTGTCCAGCCGCATGGAGG + Exonic
1061181676 9:129028236-129028258 GCTGGTGCCCCGCAGCAGGTGGG - Exonic
1061449732 9:130661513-130661535 GCTCCGGCCCGGCCGAGGGGAGG + Intergenic
1061480083 9:130893517-130893539 TCTTCTCCCCCGCAGCAGGGAGG + Exonic
1062248704 9:135583651-135583673 CCTCCTGCTCCCCCGCTGGGAGG - Intergenic
1186472962 X:9835649-9835671 GCACCTGCCCTGCCCTAGGGGGG + Intronic
1189005110 X:36986375-36986397 CCTCCTGCGCCGCCGCAGCTTGG + Intergenic
1189043911 X:37571567-37571589 CCTCCTGCGCCGCCGCAGCTTGG - Intronic
1194044257 X:88982434-88982456 GCTCCTGCCTCGCGGCTGGTCGG - Intergenic
1197639153 X:128948954-128948976 GCTCCTGCACCAGAGCAGGGGGG + Intergenic
1197962626 X:132023169-132023191 GCCCCCGCCCCGCAGCCGGGCGG - Intergenic
1198767165 X:140091580-140091602 GCGCCCGCCCGCCCGCAGGGCGG + Intergenic
1200092963 X:153644328-153644350 GCTCGCTGCCCGCCGCAGGGTGG - Intronic
1201895969 Y:18993100-18993122 CCTCCTCGCCCGCCGCAGGCAGG - Intergenic