ID: 1128075122

View in Genome Browser
Species Human (GRCh38)
Location 15:64821077-64821099
Sequence GCCCCCACCAGTCCAAGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128075122_1128075130 -9 Left 1128075122 15:64821077-64821099 CCAGCTCTTGGACTGGTGGGGGC 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1128075130 15:64821091-64821113 GGTGGGGGCAGGGTGGGGGTGGG 0: 2
1: 9
2: 83
3: 667
4: 4321
1128075122_1128075132 17 Left 1128075122 15:64821077-64821099 CCAGCTCTTGGACTGGTGGGGGC 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1128075132 15:64821117-64821139 AGGAGCAGAGCAGACCCCCAAGG 0: 1
1: 0
2: 2
3: 28
4: 269
1128075122_1128075131 -3 Left 1128075122 15:64821077-64821099 CCAGCTCTTGGACTGGTGGGGGC 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1128075131 15:64821097-64821119 GGCAGGGTGGGGGTGGGTCAAGG 0: 1
1: 2
2: 19
3: 194
4: 1384
1128075122_1128075129 -10 Left 1128075122 15:64821077-64821099 CCAGCTCTTGGACTGGTGGGGGC 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1128075129 15:64821090-64821112 TGGTGGGGGCAGGGTGGGGGTGG 0: 1
1: 8
2: 85
3: 611
4: 4143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128075122 Original CRISPR GCCCCCACCAGTCCAAGAGC TGG (reversed) Exonic
902809142 1:18878438-18878460 ACTCCCACCAGTCCAGGAACAGG + Intronic
902876405 1:19343336-19343358 GCCCACCCCAGTCCACGAGCTGG + Intronic
903538995 1:24086270-24086292 ACCCCCACCAGACAAGGAGCAGG + Intronic
903778688 1:25808672-25808694 TCCCCCGCCAGGCCAGGAGCTGG + Exonic
904200402 1:28815722-28815744 GCCACAACCAGTACATGAGCCGG + Intronic
905346477 1:37314471-37314493 GCCCCCACAATTCCATGAGACGG + Intergenic
907399870 1:54218420-54218442 GCCCACACAAGTCCAAGCCCTGG + Intronic
907750541 1:57258880-57258902 GCACCCACCTCCCCAAGAGCTGG + Intronic
910896480 1:92075332-92075354 GTCTCCTCCAGTCCCAGAGCAGG + Exonic
916398174 1:164414463-164414485 GTGCCTGCCAGTCCAAGAGCAGG + Intergenic
922465950 1:225845720-225845742 GCCCCCACCCCTCCCAGCGCAGG + Exonic
922785934 1:228282268-228282290 GTCCCCAGGAGTCCAGGAGCTGG + Intronic
1068788510 10:61001867-61001889 GCCCCCGCAAGTCCCAGAGGTGG - Intergenic
1069636645 10:69929257-69929279 GCCCCAACCAGACCCACAGCGGG + Intronic
1069872198 10:71540047-71540069 GCCCCCACCAGCACACTAGCGGG - Intronic
1070306035 10:75239711-75239733 GCCCCCACCAGGCAGAGAGGGGG + Intergenic
1070409477 10:76126161-76126183 GGCCACACAAGTCCTAGAGCAGG - Intronic
1074406330 10:113183144-113183166 GCTCCCACAAGCCCAAGAGTTGG - Intergenic
1074878344 10:117631994-117632016 GGCCCCACCAGTCCCTCAGCTGG + Intergenic
1075641156 10:124065511-124065533 ACCCCCAGCAGTCCCACAGCAGG - Intronic
1078191585 11:9095815-9095837 GCCTCCACCAGTGCCAAAGCTGG - Intronic
1080062495 11:27971739-27971761 GCCCACTCTAGTCCAAGAGCTGG - Intergenic
1083228955 11:61303012-61303034 CTCCCCACCACTCCCAGAGCTGG + Intronic
1083274315 11:61588122-61588144 GGCCCCAGCACTCCGAGAGCTGG + Intergenic
1084024367 11:66438637-66438659 GCCCCCACTAGGCCCAGTGCTGG - Exonic
1090042318 11:123301865-123301887 GTCCCCACCTGCCCAAGCGCCGG + Intergenic
1092047516 12:5442474-5442496 ACCCCCACCATGCCACGAGCAGG - Intronic
1097040488 12:56153313-56153335 GCCCCCACCCAGCCAAGAACTGG - Intronic
1100508923 12:95249360-95249382 GCCCCCACTGGGGCAAGAGCAGG + Intronic
1103850625 12:123930639-123930661 GCCCCCACCAGGAGAGGAGCCGG - Intronic
1103922120 12:124404479-124404501 GCCCCCACCAGCCTAGGTGCAGG - Intronic
1104445944 12:128833635-128833657 GACCCCTCCAGTCCAAGAGTGGG + Intergenic
1107553007 13:41494494-41494516 GCCCCCACCCAGCCAAGATCAGG + Intergenic
1113466711 13:110518365-110518387 GCCACCTTCAGACCAAGAGCAGG + Intergenic
1119628991 14:76209559-76209581 CCCCTTACCAGTCCAAGACCCGG - Exonic
1121225658 14:92320098-92320120 GGCCCCACCAATCCATGAGGAGG - Intergenic
1122264863 14:100541797-100541819 GCTCCCAGCTGTCCCAGAGCTGG - Intronic
1122995610 14:105262213-105262235 GCCCTCAGCACCCCAAGAGCAGG + Intronic
1125724189 15:41859922-41859944 GCCCCCACCAGTCTGGGATCTGG + Intronic
1128075122 15:64821077-64821099 GCCCCCACCAGTCCAAGAGCTGG - Exonic
1128347748 15:66865176-66865198 GGCTCCACGAGGCCAAGAGCTGG + Intergenic
1133223235 16:4328119-4328141 GCCCCCACCTGACCGAGAGCCGG + Intronic
1133998706 16:10766372-10766394 GCTCCCACCTCTCCAAGAACGGG - Intronic
1137750725 16:50859493-50859515 TCCCACACCAGGCCAAGGGCAGG + Intergenic
1139548328 16:67660135-67660157 ACACCCTCCAGTCCACGAGCCGG - Exonic
1140390127 16:74579292-74579314 GCCTCCACCACCCCAGGAGCTGG - Intronic
1143775418 17:9195794-9195816 CCCCCCTCCAGCCCCAGAGCAGG + Intronic
1144939379 17:18927063-18927085 GCCCTCACCAGACCAAATGCTGG - Intronic
1148572125 17:48678551-48678573 GCCCCCAGCACTCCCGGAGCTGG + Intergenic
1149334360 17:55620199-55620221 ACCCCCACCCCTCCAATAGCAGG - Intergenic
1150599138 17:66635293-66635315 GCCCCCACTGGCCCAAGAGTAGG - Intronic
1151470317 17:74313959-74313981 GCCCTCACCAGCCGCAGAGCTGG + Intronic
1151679343 17:75615387-75615409 CCCTCCTCCAGTCCCAGAGCTGG - Intergenic
1151752490 17:76048027-76048049 GACCCCACCATTCCATGAGGTGG - Intronic
1151824726 17:76517906-76517928 CACACCAGCAGTCCAAGAGCAGG - Intergenic
1152690334 17:81715173-81715195 GGACCCACCAGGCCGAGAGCTGG + Intronic
1153013595 18:563339-563361 GCCACCTCCAATCCAAGAGGAGG + Intergenic
1156463055 18:37332450-37332472 GCCCCCGCCAGCCCACCAGCAGG - Intronic
1157548253 18:48563075-48563097 GCTCCCACCTGCCCAAGAGGCGG - Intronic
1162001296 19:7746641-7746663 GCCCCCTCCACTCCAACACCTGG + Intronic
1162003880 19:7765054-7765076 GCCCCCTCCACTCCAACACCTGG - Intronic
1162787660 19:13045769-13045791 TCCTCCTCCAGTGCAAGAGCTGG + Intronic
1163407107 19:17129591-17129613 CCTCCCTCAAGTCCAAGAGCAGG - Intronic
1164671743 19:30076378-30076400 GCCCCCTCCAGGCCAGGAGCGGG + Intergenic
1165331348 19:35142653-35142675 GGCCCCACCTGCCCAGGAGCTGG + Intronic
1165957031 19:39507428-39507450 GCCACGAGCAGTCCCAGAGCCGG - Exonic
1166047094 19:40236059-40236081 GCCCCCACCAGTCCACGGCCCGG + Exonic
1166732000 19:45064420-45064442 GCCCCCACCACGGCGAGAGCGGG - Exonic
1167587706 19:50384271-50384293 GCCCCCGCCTGCCCAAGTGCGGG - Intronic
925329349 2:3046647-3046669 GCCCCCACCAGGCGCTGAGCAGG - Intergenic
929603924 2:43222302-43222324 TCCCCCACCATGCCAAGACCTGG + Intergenic
933073533 2:77892911-77892933 GACTCTACCAGTCCTAGAGCTGG + Intergenic
936273146 2:111067982-111068004 TCTCCCAACAGTCCAAGAGAGGG - Intronic
940666839 2:156619133-156619155 GCCCTCAACAGACCAAGTGCTGG + Intergenic
946154112 2:217796040-217796062 CTCCCCACCAGTCCAAGCACAGG + Intergenic
948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG + Intronic
948682359 2:239644231-239644253 GCCACCCTCAGTCCAAGTGCAGG - Intergenic
948859950 2:240747978-240748000 GACACCACCAGTGCAAGGGCCGG + Intronic
1171150381 20:22822275-22822297 GGCCCCACCATTCCAACAGGCGG + Intergenic
1172208019 20:33178252-33178274 GCCCCCACCAGGCCTGGATCTGG - Intronic
1172855263 20:37996835-37996857 GCCCCCATCAGTGCCAGGGCTGG - Exonic
1173224278 20:41152843-41152865 GCCCCCACCAGGCCCAGGCCAGG - Intronic
1173620042 20:44429759-44429781 GCCAGGACCAGTCCCAGAGCAGG + Exonic
1175268204 20:57715128-57715150 GCCCACGCCAGACCCAGAGCAGG - Intergenic
1176124457 20:63469288-63469310 GCCCCGACCAGGCAGAGAGCAGG + Intronic
1176148918 20:63579029-63579051 GCTCCCACAAGGCCAAGAGGAGG - Intergenic
1176177264 20:63734632-63734654 GACCCCACCACTGCAAGAGATGG - Exonic
1176177275 20:63734692-63734714 GACCCCACCACTGCAAGAGACGG - Exonic
1176454454 21:6897257-6897279 GCCTCCGCCAGGCCATGAGCCGG - Intergenic
1176832627 21:13762305-13762327 GCCTCCGCCAGGCCATGAGCCGG - Intergenic
1178592218 21:33920959-33920981 GCACCCAGAAATCCAAGAGCAGG - Intergenic
1179202363 21:39236452-39236474 GCCCAGACCAGCCCCAGAGCAGG + Intronic
1180005155 21:45017400-45017422 GCCCCAACCAAGCCAAGAGTTGG - Intergenic
1180188872 21:46153406-46153428 GCCCCGGCCAGGCCAAGAGGGGG + Intronic
1180746155 22:18090450-18090472 GGGCTCACCAGGCCAAGAGCAGG - Exonic
1181083270 22:20427654-20427676 GCCCCCTGCAGTCCAAGAATAGG - Intronic
1181443842 22:22953262-22953284 GCCCTCATCACTCCAAGACCAGG - Intergenic
1181668326 22:24413446-24413468 GCCCCAAACAGTCCTAGATCTGG + Intronic
1182468353 22:30532041-30532063 GCCCCCACCCATCCAAGATGGGG + Intronic
1183695204 22:39417854-39417876 GCCCCCTCCTGTCCCAGGGCAGG + Intronic
1183935594 22:41260352-41260374 GCCCCCACCAGCTCCAGAGGAGG + Intronic
1184514868 22:44955762-44955784 GCCTCCACCATTGCAGGAGCTGG + Intronic
951710487 3:25581427-25581449 GCCCCCACCAGGGAAAGAGAGGG + Intronic
956659393 3:71583326-71583348 GCCCCCACCCATCCCAGAGCTGG + Intronic
961351991 3:126310040-126310062 GCCCTCACCAGGCCAAATGCCGG - Intergenic
962920853 3:139949307-139949329 TCCCCCACAAGGCAAAGAGCTGG - Intronic
963599812 3:147369025-147369047 GCCCCCGCCAGACCCAAAGCAGG + Intergenic
966005685 3:175008634-175008656 GCCACCACCACTGCAAGATCTGG - Intronic
967975323 3:195031186-195031208 GCCCAGACAAGTCCAAGAGGAGG + Intergenic
968501405 4:951857-951879 GCCCCCAACAGCCCAACAGCTGG - Intronic
968887114 4:3341026-3341048 GCCCCCACCAGGCCGAGAGAAGG - Intronic
969909788 4:10433244-10433266 GCCCCCAACATTCCATTAGCTGG - Intergenic
973843679 4:54889194-54889216 GACCACACCAGACCAACAGCAGG + Intergenic
976080369 4:81348032-81348054 GATCCCAGCAGCCCAAGAGCAGG + Intergenic
980699133 4:136400993-136401015 GCCCCCACCAGTCCATTAGGTGG - Intergenic
990327629 5:54694039-54694061 GCCCCCAGCAGGCAAGGAGCTGG + Intergenic
993601597 5:89932789-89932811 GCCCCCAGCCTTTCAAGAGCAGG + Intergenic
998128130 5:139637815-139637837 GCCCCCACCAGGGCAAGCGCAGG - Intergenic
998426969 5:142037008-142037030 GCCCCCACTAGGCCCAGTGCTGG - Intergenic
998428391 5:142049209-142049231 GCCCCCACCTGTGCAACAGTGGG - Intergenic
1007432421 6:41784346-41784368 GCCCCAACCAGTGCCATAGCTGG - Intronic
1008459162 6:51747900-51747922 GCTCCCTCCAATCCAAGAGGAGG - Exonic
1018633827 6:165843475-165843497 GAGTCCACAAGTCCAAGAGCAGG + Intronic
1018864611 6:167737071-167737093 GCTGGCACCAGACCAAGAGCGGG - Intergenic
1019341785 7:511931-511953 GTCCCCACCAGTTCAGCAGCCGG + Intronic
1021307034 7:19045279-19045301 GCCCTCTCCACTCCAAGACCAGG + Intronic
1021716570 7:23468106-23468128 TCCCCCACCCCTCCAGGAGCAGG - Intronic
1021955390 7:25819325-25819347 GCCCCCACAAGGTCAGGAGCAGG + Intergenic
1022557141 7:31309670-31309692 GCCTCCCCCAGTCACAGAGCTGG - Intergenic
1023818173 7:43965878-43965900 AGCCCGACCAGTCCAAGAGCCGG - Intergenic
1025980113 7:66398447-66398469 GCCCCCACCTCCCAAAGAGCTGG + Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1029381789 7:100219947-100219969 GCCCCCTCCAGTCCAGGTTCTGG - Exonic
1029742800 7:102500710-102500732 AGCCCGACCAGTCCAAGAGCCGG - Exonic
1029760790 7:102599871-102599893 AGCCCGACCAGTCCAAGAGCCGG - Exonic
1032405431 7:131652384-131652406 GCCCCCCCAAGGCCAGGAGCAGG + Intergenic
1035361743 7:158318062-158318084 GCCGCCTCCTGTCCGAGAGCCGG + Intronic
1038495015 8:27995289-27995311 GCCTCCACCAGCCAAAGTGCTGG + Intergenic
1038690010 8:29752794-29752816 GCACCCACCTGTCAAAGAGCTGG - Intergenic
1040853891 8:51928976-51928998 GCCCCCACCAGACCACCAGGTGG - Intergenic
1048327424 8:133450311-133450333 GGCCCCAGCAGTCAAAGACCGGG - Intergenic
1049217093 8:141413199-141413221 GCCCCCAGCAGGCCCAGAGGAGG - Intronic
1055824901 9:80311996-80312018 GCCCTCACCAGACCAAATGCTGG + Intergenic
1056271836 9:84954745-84954767 GTCCCCACCAGCACCAGAGCTGG - Intronic
1056841845 9:90004163-90004185 GCCCCCAGCAGTCCGGGAGCTGG - Intergenic
1059833821 9:118128365-118128387 GCAGCCACCAGTGCAGGAGCTGG + Intergenic
1061590296 9:131593666-131593688 GCAGCCCCCAGTGCAAGAGCAGG - Intronic
1061626139 9:131841832-131841854 GACCCCAACAGCCCCAGAGCCGG + Intergenic
1061727966 9:132591423-132591445 CCCCCCACCAGAGCCAGAGCTGG - Intergenic
1062326006 9:136012832-136012854 GCCCCCACACGCCCAAGAGCGGG + Intronic
1186516759 X:10172022-10172044 GTTCCCACCATTCCCAGAGCTGG - Intronic
1190736249 X:53257258-53257280 GACCCTACCAGTGCAGGAGCTGG + Intronic
1190739641 X:53280656-53280678 GCCCCCACCACCCCTAGTGCAGG + Intronic
1191937572 X:66441673-66441695 TCCCCCTCCATTCCAAGAGGTGG + Intergenic
1193436350 X:81478845-81478867 GCCCCCACAAGACCAAGTACAGG + Intergenic
1195057632 X:101161890-101161912 GCCTCAACCACTCCAAGTGCTGG - Intronic
1198110911 X:133501938-133501960 GACCCCACCAGACCAAGTCCAGG - Intergenic
1199848062 X:151706014-151706036 GCCCAAAACAGTCCAGGAGCAGG + Intergenic