ID: 1128079047

View in Genome Browser
Species Human (GRCh38)
Location 15:64845418-64845440
Sequence TGTGAACCCTGCCAAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128079038_1128079047 12 Left 1128079038 15:64845383-64845405 CCGAGAAACTGGGCTGAGCAGGA 0: 1
1: 0
2: 1
3: 25
4: 244
Right 1128079047 15:64845418-64845440 TGTGAACCCTGCCAAGGGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128079047 Original CRISPR TGTGAACCCTGCCAAGGGGA GGG Intronic
900701037 1:4048724-4048746 TCAGATCCCTGCCATGGGGAGGG - Intergenic
900771998 1:4552692-4552714 TGAGAAGGCTGCCAAGGGGCAGG - Intergenic
901187812 1:7386439-7386461 TGTCAACCTTGCCAAGGGGCTGG + Intronic
902555475 1:17244281-17244303 AGGGAACCCTGCCAGGGTGAAGG + Exonic
903374368 1:22856504-22856526 TGTCAGGCCTGCCGAGGGGACGG - Intronic
904045667 1:27606904-27606926 TGTGAAAACTGGCAAGGGCATGG + Intergenic
904062140 1:27720029-27720051 TGTAAACCCTGCCATGGATATGG - Intergenic
905648937 1:39643760-39643782 TGAGAACAGTACCAAGGGGATGG - Intergenic
907502131 1:54888279-54888301 GGTGAACTCTGAGAAGGGGATGG - Intergenic
907716769 1:56933352-56933374 TGTGCTCCCTGCCAAGGAAATGG - Exonic
910875249 1:91872598-91872620 TGTGTAACCAGACAAGGGGATGG + Intronic
912554633 1:110507356-110507378 TGTGAACCCTGCCAGAGCCATGG - Intergenic
915922855 1:159990198-159990220 ATTGAACCCTGGCAAGGGGTGGG - Intergenic
918215165 1:182387070-182387092 TGTGAATGCTGTGAAGGGGAGGG - Intronic
918419458 1:184349502-184349524 TGTGAGCCCTGGCAGGTGGAGGG - Intergenic
918494219 1:185115312-185115334 AGTGCACCCTGCCAAGGGATGGG + Intergenic
919283087 1:195517713-195517735 TGAGAACAGTACCAAGGGGATGG - Intergenic
919794863 1:201315504-201315526 TGTGAAGCCTTCCTAGGGAAGGG - Intronic
920607561 1:207404211-207404233 TGAGAACACTACCAAGTGGATGG - Intergenic
922800333 1:228362097-228362119 TGTGGACCCTTCCCCGGGGATGG - Intronic
923543423 1:234906479-234906501 TGTGAACCCTGGGAAGGAGATGG + Intergenic
923747550 1:236716561-236716583 TGTGATCCCTTCCAAAGGCAGGG + Intronic
1064509469 10:16074123-16074145 TGTGACCTCTGCCAAATGGAGGG - Intergenic
1065915640 10:30352532-30352554 TGTGGACAGTGCCAAGGGGATGG - Intronic
1067757263 10:49014694-49014716 TGTGAACTCTGCAGAGGGCAGGG - Exonic
1068747358 10:60548331-60548353 TGTGATCCCAGCCACTGGGAAGG - Intronic
1069547275 10:69337823-69337845 TGTGCACCCTTCCACGGGGTGGG + Intronic
1069639479 10:69945494-69945516 TGCGAACACTGCCTTGGGGAGGG - Intronic
1071652061 10:87401114-87401136 TGTGGACCATCCCTAGGGGAAGG + Intergenic
1076931964 10:133537341-133537363 AGTGACCCCTGCCAAAGGGAAGG - Intronic
1077174367 11:1181923-1181945 TGTGGACCCTGCTCAGGGCATGG + Intronic
1078352983 11:10610210-10610232 TGAGAAGCCTGCCAAGGAGCAGG - Intronic
1078414863 11:11156741-11156763 CGTGGACCCAGCCCAGGGGAGGG - Intergenic
1078576541 11:12507616-12507638 AGAGAAACCTTCCAAGGGGAGGG - Intronic
1079237926 11:18702746-18702768 GGTGAACCATGCCAAAGGAAGGG + Exonic
1081759104 11:45564670-45564692 TGTGCACCCAGCCGAGGGAATGG + Intergenic
1083264870 11:61542086-61542108 TTGGCACCCTGCCAAGGGGATGG + Intronic
1086172160 11:83848907-83848929 TGGGAACACTGCCCAGGAGATGG - Intronic
1087346602 11:96979415-96979437 TGTGAGCCATCCCAAGGGAAGGG - Intergenic
1088161783 11:106880340-106880362 CGTGAAGGTTGCCAAGGGGAGGG + Intronic
1089613000 11:119679974-119679996 TGTGAACTCCTCCAAGGGCAGGG + Intronic
1092517256 12:9227504-9227526 TGAGAACACCACCAAGGGGATGG + Intergenic
1096838900 12:54369428-54369450 GGCGAATCCTGCGAAGGGGAAGG + Exonic
1097035630 12:56121767-56121789 TGTGATTCCTGCCAAGGGTTGGG - Exonic
1098191770 12:67956759-67956781 TTGGAAACCTGCCAAGGGGAAGG + Intergenic
1100385715 12:94102915-94102937 TGTGTACACTGCGAGGGGGATGG - Intergenic
1101058119 12:100940756-100940778 TATAAACCCAGCCAAGTGGATGG - Intronic
1101931858 12:109021130-109021152 TGTGAACTCTTCCAAGCAGAAGG - Intronic
1103896835 12:124278621-124278643 TGTGCACGGTGCCAAAGGGAGGG + Intronic
1104401110 12:128477131-128477153 TGTGAAGGCTGCCTGGGGGAGGG + Intronic
1110411032 13:75204172-75204194 TGAGAACACCACCAAGGGGATGG + Intergenic
1110747067 13:79066533-79066555 TTTGAACACTGCCCAGGGAAAGG + Intergenic
1113413634 13:110111108-110111130 TGGGAGAGCTGCCAAGGGGATGG - Intergenic
1113455515 13:110446058-110446080 TGTGCTCCCTGCCAGGGAGAAGG + Intronic
1119102169 14:71889821-71889843 TGAGAATAGTGCCAAGGGGATGG - Intergenic
1120951504 14:90046058-90046080 TGTGCCCCTTGCCAAGGTGAGGG + Intergenic
1121341714 14:93109084-93109106 TGTACACCCAGGCAAGGGGACGG + Intronic
1121466258 14:94117125-94117147 TGCGCACCCTGCCCTGGGGAGGG + Intergenic
1121492712 14:94371643-94371665 TGGGAGCCCTCCCAAGGGGCGGG - Intergenic
1123112606 14:105880273-105880295 TGGGAATCCTGCCAAGGGCTTGG + Intergenic
1123402664 15:20003340-20003362 AGTGAACCCTGGCAAGGAGGGGG + Intergenic
1123512003 15:21009994-21010016 AGTGAACCCTGGCAAGGAGGGGG + Intergenic
1124010812 15:25837210-25837232 TGTGAACCCTGTTGAGGGGCAGG - Intronic
1128079047 15:64845418-64845440 TGTGAACCCTGCCAAGGGGAGGG + Intronic
1131829524 15:96345170-96345192 TCTGAGCCCTTCCAAGGGGCTGG - Intergenic
1132698819 16:1213618-1213640 TGTGAGCCCTGCCATGAGGCAGG + Intronic
1132784267 16:1646158-1646180 TGTTATCCCTTCCAAGTGGAGGG + Intronic
1133378182 16:5306955-5306977 TGAGATGCCTGCCATGGGGAAGG - Intergenic
1134092102 16:11396954-11396976 TGTGAGCCCTGCAGAGGGAAGGG - Intronic
1134121058 16:11585759-11585781 AGTGCACCAGGCCAAGGGGAGGG + Intronic
1134208034 16:12253578-12253600 TGTGAACACAGGCAGGGGGATGG + Intronic
1135151858 16:20014501-20014523 TGGGAGCTCTGCCAAGGGAATGG - Intergenic
1136628514 16:31476298-31476320 CGTGGACATTGCCAAGGGGAAGG - Intronic
1138923178 16:61557351-61557373 TGAGAACAGTGCCAAGAGGACGG - Intergenic
1139608568 16:68038312-68038334 TGTGAACCCTGCCAAGGTCCAGG + Intronic
1141463273 16:84191044-84191066 AGTGCACCCTGCCAATGGGAAGG - Intergenic
1141765343 16:86054610-86054632 TGTGACCACTGCCAAGGAAAAGG - Intergenic
1142114634 16:88350288-88350310 CGTGGATCATGCCAAGGGGAGGG - Intergenic
1143401838 17:6651397-6651419 TATTAACCCTGCCAAGAGTAAGG + Intronic
1143447140 17:7016359-7016381 TGAGAACCCTACCAATGGGTTGG + Intronic
1143700825 17:8658854-8658876 TGTGAACCCTGCAAAGTGCCTGG + Intergenic
1145941476 17:28745350-28745372 TGTGTACACTGCCGAGGGGGAGG - Intronic
1147263062 17:39219932-39219954 TGGCCACCCTGCCAAGGGGATGG + Intronic
1147767854 17:42849071-42849093 TTTCAGCCCTGCCAGGGGGAGGG - Exonic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1147966481 17:44197019-44197041 TGGCAATCCTGCCAAGGGGAGGG + Exonic
1148843379 17:50513702-50513724 TGTCAACCCAGCCAAGGTTATGG + Intronic
1149444864 17:56705576-56705598 TGTTAACACATCCAAGGGGAGGG + Intergenic
1149456219 17:56790795-56790817 TGAGAACAGTACCAAGGGGATGG - Intergenic
1152257168 17:79246842-79246864 TGTGAGCAGTGCCAATGGGATGG + Intronic
1155940272 18:31795621-31795643 TGTCAACACTGCAAAAGGGAAGG + Intergenic
1158787672 18:60735226-60735248 TGTTAACCCTTTGAAGGGGAAGG + Intergenic
1159159985 18:64631625-64631647 TGAGAACCGCACCAAGGGGATGG - Intergenic
1159387938 18:67750559-67750581 TGTGAACCCTGCTAAGGTTTAGG - Intergenic
1159785955 18:72714446-72714468 AGTGACACCTGCCAAGGAGATGG + Intergenic
1161451100 19:4345852-4345874 GGTGAACCCTGCCAAGAAGTCGG + Exonic
1161496612 19:4589967-4589989 TCTGAACTCTGCCAAGATGAGGG - Intergenic
1161924987 19:7293681-7293703 TGAGAACCCTCCCCAGGGGCGGG - Intronic
1162297221 19:9821628-9821650 TGTGAACTCTGGCAGGGGAAGGG + Intronic
1162326185 19:10001265-10001287 TGTGATCCCAGCCACTGGGAAGG - Intronic
1165950330 19:39470690-39470712 TGTGAAAACAGGCAAGGGGAGGG - Intronic
926746911 2:16166458-16166480 TGCGAACACTGCCAAAGGGCTGG + Intergenic
926813373 2:16776084-16776106 TTTAAACCCTGCCAGGGGTAGGG + Intergenic
931343546 2:61425826-61425848 TGTGCAGCCTGTCGAGGGGAAGG - Intronic
934524544 2:95043529-95043551 GGAGTCCCCTGCCAAGGGGAGGG + Intronic
934662573 2:96150958-96150980 TGTGGACCCTGGCCAGGGGCAGG - Intergenic
934945457 2:98537953-98537975 TGTGGACACTGTCAATGGGAGGG + Exonic
940318063 2:152345838-152345860 TGTAAACACTGGCAAGAGGAAGG - Intronic
944526051 2:200620712-200620734 TGTGAAGCATGCCACGGGGGAGG + Exonic
945033321 2:205684696-205684718 TGCAAATCCTGCCAAAGGGATGG + Intronic
945259191 2:207828602-207828624 GGACAACCCTGCCAATGGGAAGG + Intronic
1168807842 20:683127-683149 TGTCAGCCCTGGCAGGGGGAAGG - Intergenic
1169287352 20:4320792-4320814 TGTGAACCAAGCCCAGGGGTTGG + Intergenic
1175530955 20:59674070-59674092 TCTGTACCCTGACAAGGGGCAGG + Intronic
1176127688 20:63483276-63483298 TGGGCTCCCTGCCAAGGGGCTGG - Intergenic
1178351458 21:31874843-31874865 TGTGAACCCTTGCCAGGCGAGGG + Intronic
1178663102 21:34522984-34523006 TGGGAACCCTGCCAACCAGAGGG + Intronic
1178833011 21:36071872-36071894 TGTGAACCATGCTAAGGGCTTGG - Intronic
1179591029 21:42408109-42408131 GGTGAACCCTGGAAAGGGGGAGG + Intronic
1179815109 21:43900655-43900677 TGTGAATGCTGCCCAGGTGAGGG + Intronic
1180074406 21:45455427-45455449 TGGGAAGCCTGCACAGGGGAGGG + Intronic
1181271649 22:21662121-21662143 TCTGAACCCAGCCTGGGGGATGG + Intronic
1181752810 22:25001494-25001516 TGTGGACCAGGCCAAGGGGGAGG + Intronic
1183724401 22:39580503-39580525 GGTGAAGCCTGCCTAGGGGAGGG + Intronic
1184348949 22:43930709-43930731 TCTGAGCCATGCCAGGGGGATGG + Intronic
1184806554 22:46798383-46798405 TGTGAGCCCTGCAAGGGGGCAGG + Intronic
1185020772 22:48373642-48373664 TGGGAACCCAGCCACGGGGCTGG + Intergenic
949980839 3:9500866-9500888 CCTGCTCCCTGCCAAGGGGAAGG + Exonic
950044819 3:9942970-9942992 TCTGAAGCCTGAGAAGGGGAAGG - Intronic
950799814 3:15541275-15541297 TGTGAACAGCACCAAGGGGATGG + Intergenic
954749776 3:52806886-52806908 TGTGAGGCCTGCCAGAGGGATGG - Exonic
960427259 3:117524072-117524094 TCTGAACCTAGGCAAGGGGAAGG - Intergenic
968970942 4:3793514-3793536 AGTGATGCCTGCCAAGGGCAGGG + Intergenic
969048893 4:4358567-4358589 TGTGCCCCCTGCAAGGGGGAAGG + Intronic
969628745 4:8322967-8322989 TGTGAACGTTGCCAGGTGGAGGG + Intergenic
969675329 4:8611318-8611340 TGTGGACTCTGCCTGGGGGATGG + Intronic
969956241 4:10893897-10893919 TCTGAGCCCTGCAAAGGAGAAGG - Intergenic
970945147 4:21682245-21682267 TGAGAACAGTACCAAGGGGATGG + Intronic
972417609 4:38857910-38857932 TGTGAAACAAGCCAAGGGAAAGG + Intergenic
975675380 4:76822555-76822577 TGTGAGCCCAGCCAAGGAAAAGG + Intergenic
978305030 4:107318357-107318379 AGTGAGCCATGCCAAAGGGAAGG - Intergenic
978971992 4:114819709-114819731 TGTAAACCCTGCCAAGAAAAAGG - Intergenic
979390067 4:120117706-120117728 TGTGAACACAGCCAAGAGGAAGG - Intergenic
981004074 4:139857245-139857267 TGTGCACCCAGCCAAGCGGAAGG + Intronic
981315768 4:143337838-143337860 TGTGAACCCTGCTAAGCAAACGG - Intronic
982214536 4:153069257-153069279 TGAGAACAGTACCAAGGGGATGG - Intergenic
985635367 5:1033214-1033236 TGGGACCCCTGCGGAGGGGAGGG - Intronic
987003784 5:13688598-13688620 TGTGAAACCTGCCAAGGCTTGGG - Intergenic
988921642 5:35947746-35947768 TGTCAGCCCTGGCAAGGGGTGGG + Intergenic
991949221 5:71931740-71931762 TGGGAACCCAGGCTAGGGGAGGG + Intergenic
993100946 5:83538996-83539018 TGTAAACTCTTCCCAGGGGAAGG - Exonic
999974164 5:156894224-156894246 TGTGACCCCTGCAAAGGGGAGGG + Intergenic
1002156042 5:177280570-177280592 TCTGTACCCTGCCAATAGGACGG - Exonic
1002538750 5:179892630-179892652 TCTGAAGCCAGCCAAGGAGATGG - Intronic
1004099389 6:12593236-12593258 TGTCACCTCTGTCAAGGGGAAGG + Intergenic
1004346121 6:14850776-14850798 TGTGAACCCAGCAAAGAGAAAGG - Intergenic
1006577332 6:35056194-35056216 CATTAACCCTTCCAAGGGGAGGG - Intronic
1011128916 6:84034341-84034363 TGAGAACCCTGCCCAGTGCATGG - Intronic
1012691335 6:102316049-102316071 TGTGAACCCTTCACAGGTGATGG + Intergenic
1013964846 6:115942754-115942776 TGTGTAACCTGAGAAGGGGATGG - Intronic
1014874786 6:126643984-126644006 TGTGAACTCTGACAAGTGGCTGG + Intergenic
1016661277 6:146583640-146583662 TGTGAAACCTGCATATGGGAAGG - Intergenic
1017053242 6:150413857-150413879 TGGGCACCCTGCCAATGGGGTGG - Intergenic
1018340436 6:162846057-162846079 TCTGACCCCAGCGAAGGGGAGGG + Intronic
1018872555 6:167794636-167794658 TAACAGCCCTGCCAAGGGGAGGG + Intronic
1019647450 7:2138707-2138729 TGTGCAGCCTGCCTGGGGGAAGG - Intronic
1020124735 7:5527063-5527085 GGTGAACCCTGCAAAAGGGTGGG - Intergenic
1020664479 7:11023215-11023237 TGTGAACACTGCCAGGGAAATGG - Intronic
1023109663 7:36796553-36796575 AGTGCACCCTGCAATGGGGATGG + Intergenic
1024861908 7:53853900-53853922 GGAGAACCCTGCCAGGTGGAAGG + Intergenic
1025259365 7:57407329-57407351 CCTAAGCCCTGCCAAGGGGAAGG - Intergenic
1025609491 7:63065835-63065857 CCTAAGCCCTGCCAAGGGGAAGG + Intergenic
1026124838 7:67570433-67570455 TGTGTACCATGCTAAGGAGATGG + Intergenic
1026541112 7:71280807-71280829 TCTGAACCCATCCCAGGGGATGG + Intronic
1028718982 7:94007507-94007529 TGTGAACTCACTCAAGGGGATGG - Intergenic
1029465820 7:100723938-100723960 TGCCAACCCTGCCCAGGGCAAGG + Intergenic
1029734331 7:102457251-102457273 TGTGAGCCCTGCCCAGGAGCAGG - Exonic
1030447775 7:109669003-109669025 TGTGAATCTGGCCAAGAGGAAGG - Intergenic
1031878059 7:127164064-127164086 TGAGGACAGTGCCAAGGGGATGG - Intronic
1032403727 7:131641099-131641121 TGTGAACGCTGCAAAAGGCAGGG - Intergenic
1032464359 7:132134570-132134592 TGTGCTCCCTGGCAAGGGAAGGG + Intronic
1033356937 7:140607677-140607699 TGTGGGCCCAGCCAAGTGGAGGG - Intronic
1033543766 7:142381340-142381362 TGAGAACTCTGCCAAGGACATGG - Intergenic
1033550717 7:142445226-142445248 TGGGAACCCTGGGGAGGGGAGGG + Intergenic
1034547166 7:151796711-151796733 TGTCAGCTCTGCGAAGGGGAAGG - Intronic
1036392501 8:8336383-8336405 CATGAAGGCTGCCAAGGGGAAGG - Intronic
1036662318 8:10716253-10716275 TGAGAGCCCTGCCCAGGGAAGGG - Intergenic
1040563728 8:48547251-48547273 TGGGAACCCTGCCATGCTGAAGG + Intergenic
1041201602 8:55455125-55455147 TGTGATCCGCGCCATGGGGAGGG + Intronic
1047248635 8:123165537-123165559 TGTGACCCCTGCCAAGCAGATGG - Intergenic
1047778428 8:128092340-128092362 TGAGGCCCCTGCCCAGGGGAGGG - Intergenic
1048015271 8:130491352-130491374 TCTGAACTCTGCCAAGAGAAGGG + Intergenic
1048323202 8:133417928-133417950 TGGGTACCTGGCCAAGGGGAGGG - Intergenic
1048773880 8:137923929-137923951 TGTGGCCCCTGTCAATGGGAAGG - Intergenic
1048976000 8:139673492-139673514 GGTGACACCTGTCAAGGGGACGG - Intronic
1050062759 9:1727586-1727608 TTTGAATCCTGCAAGGGGGAGGG - Intergenic
1050077770 9:1882668-1882690 GGTTATCCCTGCCAAGGAGAAGG + Intergenic
1052458944 9:28737856-28737878 TTTGAACCCTGGCAATGAGAAGG + Intergenic
1052745347 9:32434895-32434917 TGTGAATCCTAACAAGGGGAAGG + Intronic
1053056010 9:34993478-34993500 TGGGACCCCTACCAAGCGGAGGG - Intronic
1056463925 9:86835705-86835727 TGTGAACCCTGCCAAAGTTGAGG + Intergenic
1056501973 9:87218481-87218503 TGAGAGCACTGCCACGGGGAAGG - Intergenic
1056765426 9:89441946-89441968 TGTAAACACAGCCATGGGGATGG - Intronic
1056775942 9:89512632-89512654 TATGCACCCGGCCCAGGGGAAGG - Intergenic
1057961494 9:99461749-99461771 TGAGAACACCACCAAGGGGACGG - Intergenic
1059655992 9:116357994-116358016 TGTGAGCCCTGCCATGGACAAGG + Intronic
1060395640 9:123314459-123314481 TCTCAGCCCTGCCCAGGGGATGG + Intergenic
1061092503 9:128434428-128434450 GGTGAACCCTGAGAAGGAGACGG + Exonic
1061367968 9:130182340-130182362 GGAGTTCCCTGCCAAGGGGAGGG + Intronic
1061722414 9:132560795-132560817 AGTGAACCGTGCCCAGGGAATGG - Intronic
1061969349 9:134035555-134035577 TGTGACCCCAGTCAAAGGGAGGG + Intronic
1190356868 X:49613983-49614005 TGTGAACCCTTCCACTGGGGAGG - Intergenic
1192446492 X:71215185-71215207 TGTCAGCCCAGCCCAGGGGAGGG - Intronic
1193070325 X:77299533-77299555 TTTGAACAGTACCAAGGGGAGGG - Intergenic
1193198067 X:78657411-78657433 CATCAACTCTGCCAAGGGGAGGG - Exonic
1193467272 X:81865397-81865419 TGTGAAAGCTGCCAGGAGGAGGG - Intergenic
1194339821 X:92694235-92694257 TGTGAAAGCTGCCAAGGGTTGGG + Intergenic
1194720281 X:97332935-97332957 TGTGAATTTTGCCAAAGGGAAGG - Intronic
1194987970 X:100511885-100511907 TGTGTACCCAGCCAAGGGTTAGG + Intergenic
1198456291 X:136821180-136821202 TGAGAACAGTACCAAGGGGATGG + Intergenic
1199235507 X:145487940-145487962 TGTGAATGTTGCCAAGGGTATGG + Intergenic
1200178809 X:154137715-154137737 AGAGAAGCCTGCCATGGGGAGGG + Intergenic
1200648204 Y:5811018-5811040 TGTGAAAGCTGCCAAGGGTTGGG + Intergenic