ID: 1128081142

View in Genome Browser
Species Human (GRCh38)
Location 15:64857615-64857637
Sequence CTCCTAAGGAACCCTGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128081142_1128081150 21 Left 1128081142 15:64857615-64857637 CCAGATACAGGGTTCCTTAGGAG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1128081150 15:64857659-64857681 ACCTTGTCTTCCTTCTCCTGTGG 0: 1
1: 0
2: 3
3: 39
4: 409
1128081142_1128081152 22 Left 1128081142 15:64857615-64857637 CCAGATACAGGGTTCCTTAGGAG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1128081152 15:64857660-64857682 CCTTGTCTTCCTTCTCCTGTGGG 0: 1
1: 1
2: 0
3: 40
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128081142 Original CRISPR CTCCTAAGGAACCCTGTATC TGG (reversed) Intronic
901093162 1:6657049-6657071 CTCCTAAGGAACCATGCCTGCGG + Intronic
903825914 1:26145741-26145763 TTCCTAGGGCAGCCTGTATCTGG - Intergenic
904907043 1:33905361-33905383 CTCCTATGAAACCATGTAGCTGG - Intronic
907005707 1:50911030-50911052 CTCCTAAGGTAACCACTATCCGG + Intronic
911505712 1:98748097-98748119 CTCCTAAGTAACCAAGTAGCTGG + Intronic
912865357 1:113251433-113251455 CCCCTAAGGATCCCTGTCCCTGG + Intergenic
920385425 1:205568012-205568034 CTCCTAAGGGAGCCAGGATCTGG - Intergenic
922569230 1:226623711-226623733 CTAGTAAGGACCCTTGTATCTGG - Intergenic
1065045887 10:21747445-21747467 CTCCTTAGGAACTCTGAGTCGGG - Intergenic
1067739608 10:48884768-48884790 CTCCTCAGGAACCGTTTCTCTGG + Intronic
1068647149 10:59480505-59480527 TTCCCAAGGAGCCCTGTATTTGG + Intergenic
1071739430 10:88340219-88340241 TTCCTAAGGCACCCTGCAGCAGG - Intronic
1083877467 11:65531841-65531863 CTGCCAAGGAGCCCTGTATGTGG - Intronic
1084956096 11:72692532-72692554 CTGATAAGGAACCCTATATTGGG + Intronic
1085953714 11:81365213-81365235 CTAATAAGAAACCCTGTATATGG + Intergenic
1086196322 11:84144368-84144390 GAAGTAAGGAACCCTGTATCTGG - Intronic
1086582898 11:88420034-88420056 CTCCTCAGGAAACCAGTTTCAGG + Intergenic
1087618010 11:100510615-100510637 CTTCTAAGGAACCCTGCAAATGG - Intergenic
1093528469 12:20133252-20133274 TTCCTATGGAACCCTGTCACTGG - Intergenic
1095149743 12:38778311-38778333 CACCTAAGGAAGCATGTCTCGGG + Intronic
1097739004 12:63216532-63216554 GTCCTTAGGAAACCTGAATCAGG + Intergenic
1098487598 12:71039750-71039772 CTCAAAAGGAGCCCTGTGTCTGG - Intergenic
1102010829 12:109617381-109617403 CTCCCAAGGAGCTCTGTTTCAGG - Intergenic
1105856059 13:24373237-24373259 CTCCTCAGGTACACTTTATCAGG - Intergenic
1106901740 13:34360811-34360833 CTACAAAGGAACCCTGTCTATGG - Intergenic
1106984992 13:35336009-35336031 TTCCTAAGGAACTCTGTGTAAGG - Intronic
1113840547 13:113357468-113357490 CTCTTAAGAAACCCTCTTTCTGG + Intronic
1125622997 15:41081447-41081469 CTCCTAATGATTCCTGTATCTGG - Intronic
1127435824 15:58957314-58957336 CTCTCAAGGACCCCTGTAGCTGG + Intronic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128873777 15:71185195-71185217 CTTATAAGGAATCCTGTATCTGG - Intronic
1130968173 15:88712254-88712276 CTCCTGAGGAAGGCTGTGTCTGG - Intergenic
1131952920 15:97701319-97701341 CTCCCAGGGAACCCTATATGTGG + Intergenic
1136331324 16:29579320-29579342 CTCTTAAGGAACTTAGTATCTGG - Intergenic
1136445962 16:30319072-30319094 CTCTTAAGGAACTTAGTATCTGG - Intergenic
1140800659 16:78485367-78485389 TCCCTAAGGAACCCTGTTTTGGG + Intronic
1142819411 17:2453288-2453310 ATCCTAAGGGGCCTTGTATCGGG - Intronic
1150735640 17:67735150-67735172 CTCACAAGGAACCCTGCCTCAGG - Intronic
1167441041 19:49509048-49509070 CTCCTGAGGGACACTGTAACAGG + Intronic
926962357 2:18372337-18372359 CTCCTAAAGAACCCAGTGTTAGG + Intergenic
930093764 2:47551233-47551255 CTCCTAAGGGACCCTGGCACTGG + Intronic
937912898 2:127084805-127084827 CTCCTAAGGAACACTGCAATGGG - Intronic
938569496 2:132549373-132549395 CTCTGAAGGAAACCTGTATATGG - Intronic
939825061 2:147004295-147004317 CACCTATGGAATCCTTTATCAGG + Intergenic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1174194020 20:48760214-48760236 TTCCTAAGGAAACCTGGATTTGG + Intronic
1175285239 20:57833387-57833409 TTCCTAAGGAGGCCTGTTTCTGG + Intergenic
1175856317 20:62122675-62122697 CTCCTCAGGCACCCCGTATCTGG + Exonic
1182681178 22:32081135-32081157 CTCCTAATGAACCTTCTACCTGG - Intronic
1185160019 22:49218793-49218815 CTCCAAAGGGACCCAGTACCAGG + Intergenic
950390632 3:12693894-12693916 CACCTTAGGAATCCTGCATCAGG - Intergenic
954178449 3:48862641-48862663 CTCCTGAAGAAGCCTGAATCTGG + Exonic
960351682 3:116601314-116601336 CTCATAAGAAACCCTGTAAGTGG - Intronic
962662081 3:137612459-137612481 GTCCTAAAGAACACTGGATCCGG - Intergenic
968551071 4:1223591-1223613 CTCCTGAGGAACCCGCGATCTGG + Intronic
979768928 4:124498414-124498436 GTGCTAAGGAACCCAGAATCTGG + Intergenic
983836702 4:172395868-172395890 CTCCTCAGGGAGGCTGTATCAGG - Intronic
998594619 5:143515933-143515955 CTCCTTAGGAACCAGGCATCAGG + Intergenic
1000100804 5:158014401-158014423 CTCCCAAGGAAGCCTATTTCAGG + Intergenic
1001891957 5:175347025-175347047 TTCCTAAGGAATCATGTCTCTGG + Intergenic
1009413420 6:63392398-63392420 CTCCAAAGGGACCCTGTCTCAGG + Intergenic
1015339824 6:132085523-132085545 ATCCTAAGGAACACAGTATTAGG - Intergenic
1017043001 6:150322847-150322869 CTCCTTAGTCACCCTGTATTGGG + Intergenic
1019019454 6:168905622-168905644 CTCCTAAAGCAGCCTGTGTCAGG + Intergenic
1020719270 7:11721167-11721189 GTCCTAAGGAATCCTGAATTGGG + Intronic
1021915914 7:25432106-25432128 CTCCTTAGGAACCCTACCTCAGG - Intergenic
1024992957 7:55250786-55250808 CTCCTAAGAATCTCTGTGTCTGG - Intronic
1030786985 7:113674562-113674584 TTTCTAAGTTACCCTGTATCAGG + Intergenic
1038891220 8:31726722-31726744 ATCCTAAGGAGCCCTGGAGCTGG + Intronic
1041011174 8:53545251-53545273 CACCTAAGGAACCTGGTAACAGG + Intergenic
1045506994 8:102785779-102785801 CTCCTAAGGAGCCCTGTTCAAGG + Intergenic
1045877312 8:106997004-106997026 CTCCTTAGCAACTCTGTATTTGG - Intergenic
1047015998 8:120724171-120724193 CTGCAAAGGAGCCCTGTTTCAGG + Intronic
1052172141 9:25412797-25412819 TCCCTAAGGAAGCCTGTCTCTGG + Intergenic
1057744085 9:97737749-97737771 CTCCTCAGGAAGTCTGTATGTGG + Intergenic
1058696045 9:107559778-107559800 TGCCTAAGTGACCCTGTATCAGG - Intergenic
1060179304 9:121521821-121521843 CAGCTTAGGAACCCTGTATGGGG + Intergenic
1187919891 X:24191404-24191426 CTCCTCAGGAACCCTCTTTGTGG - Intronic
1189760639 X:44318403-44318425 CTTCAAAGGAAACCTGTACCCGG - Intronic
1189876153 X:45438316-45438338 CTGCCAAGAAACCTTGTATCAGG + Intergenic
1197000641 X:121435118-121435140 CTCCAAAGGGACTCTGTTTCTGG - Intergenic
1199514037 X:148655694-148655716 CTCCCAGGGAACCCTGAATGTGG - Intronic