ID: 1128081150

View in Genome Browser
Species Human (GRCh38)
Location 15:64857659-64857681
Sequence ACCTTGTCTTCCTTCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 409}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128081142_1128081150 21 Left 1128081142 15:64857615-64857637 CCAGATACAGGGTTCCTTAGGAG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1128081150 15:64857659-64857681 ACCTTGTCTTCCTTCTCCTGTGG 0: 1
1: 0
2: 3
3: 39
4: 409
1128081148_1128081150 7 Left 1128081148 15:64857629-64857651 CCTTAGGAGGGTGGAGCTGGGTC 0: 1
1: 0
2: 0
3: 14
4: 212
Right 1128081150 15:64857659-64857681 ACCTTGTCTTCCTTCTCCTGTGG 0: 1
1: 0
2: 3
3: 39
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128081150 Original CRISPR ACCTTGTCTTCCTTCTCCTG TGG Intronic
900241963 1:1621442-1621464 ACCGGGGCTTCCTTTTCCTGTGG - Intronic
900510194 1:3055389-3055411 AGTTTGTCTCTCTTCTCCTGGGG - Intergenic
901629745 1:10642281-10642303 TCCTCCTCTTCCTCCTCCTGCGG - Intronic
902031456 1:13425782-13425804 ACTTTGTCTCCATTATCCTGTGG + Intergenic
903264014 1:22145732-22145754 ACCTGGCTTGCCTTCTCCTGGGG + Intergenic
903656943 1:24955282-24955304 ATCTTCTCTTCCTTGGCCTGAGG - Intronic
904833595 1:33320886-33320908 GGATTGTCTTTCTTCTCCTGGGG + Intronic
905182301 1:36174998-36175020 GCCTTCTCTTACTTCTACTGGGG - Exonic
906839281 1:49119306-49119328 ATCTTTTCTGCCTTCTCTTGTGG + Intronic
908809059 1:67960299-67960321 ACCTGCTCTTCCCTCTGCTGGGG + Intergenic
909090394 1:71218200-71218222 ATCTTTTCTGCCTTCTCTTGTGG - Intergenic
909415958 1:75405739-75405761 ATCTTTCCTTCTTTCTCCTGTGG - Intronic
909700940 1:78522172-78522194 AGCTTGCATTCCTTCTCCTGTGG + Intronic
910301009 1:85707860-85707882 ACCTTCTCTTCCTTTACCTCTGG + Exonic
910941856 1:92544785-92544807 TCCCTCTCTTCCTCCTCCTGAGG + Intronic
911098562 1:94076095-94076117 ACCTTGTGTTTCTTCTTTTGGGG + Intronic
911274026 1:95839849-95839871 AGCTTGTCTTCAGGCTCCTGTGG + Intergenic
911806460 1:102214665-102214687 TCACTCTCTTCCTTCTCCTGTGG + Intergenic
913526088 1:119694512-119694534 ATCTTTTCTTCTTTCTCTTGTGG + Intronic
914803661 1:150977295-150977317 ACCTTCTCTTTTGTCTCCTGGGG - Intergenic
915230042 1:154438733-154438755 CCCTTGTCTTTCCTGTCCTGGGG + Intronic
915553771 1:156649952-156649974 ATCTTGTCTTCCCTTTGCTGGGG - Intronic
916418406 1:164613725-164613747 TCCTTGTCTTCCTTCTCTTCTGG + Intronic
916972427 1:170038063-170038085 ACCTTTTCTTTCTTCTACTCTGG - Intronic
918166975 1:181959211-181959233 ATCTTTTCTGCTTTCTCCTGTGG + Intergenic
918702129 1:187618213-187618235 AGCTTGACTTCCTCCTTCTGTGG + Intergenic
919850322 1:201668047-201668069 CCCATGTCTTCCTCCTGCTGAGG + Intronic
920203158 1:204273111-204273133 CTCTAGACTTCCTTCTCCTGGGG + Intronic
920250646 1:204620152-204620174 GCCTTCTCTTCCTTGTCCTCTGG + Exonic
920625307 1:207591484-207591506 ATCTTTTCTGCTTTCTCCTGTGG - Intronic
921312196 1:213855554-213855576 CCCTTGTCTCTCTTCTCCAGGGG + Intergenic
922614668 1:226954808-226954830 TCCTTGTAGTCCTTGTCCTGTGG + Intronic
922884475 1:229007438-229007460 GCCTGGACTTCCTTGTCCTGGGG + Intergenic
923250744 1:232177602-232177624 AACCTGTCTCCCTTCTCCTTTGG + Intergenic
924493707 1:244565944-244565966 ACCTTTCCTGCTTTCTCCTGTGG + Intronic
1064750172 10:18520465-18520487 ACCTTGTCTCCTTGCTTCTGTGG + Intronic
1065020609 10:21499526-21499548 ACCTGGTCATACTTCTCCTCTGG - Intergenic
1065660928 10:28003705-28003727 TCCTTGCCTTCACTCTCCTGAGG - Intergenic
1066140198 10:32497500-32497522 ATCTTGCCTTCTTTCTCTTGTGG + Intronic
1066172028 10:32859451-32859473 ATCTTCTCTGCCTTCTCTTGTGG - Intronic
1066430624 10:35347925-35347947 ACCATGACTTCTTTCTCCTCCGG - Intronic
1066803283 10:39214322-39214344 ACCTTGTCTTTGTTATCCTGGGG + Intergenic
1067688989 10:48489011-48489033 ACCTTGTTTCCCATCTCTTGGGG + Intronic
1068939086 10:62663293-62663315 ACCTTATCTTCCTTCCAGTGAGG - Intronic
1069373035 10:67767150-67767172 CCCTTCTCCTCCTTCTCCTTTGG + Intergenic
1069503883 10:68979340-68979362 ACCTGGTGTTCTTTCTTCTGAGG + Intronic
1069734284 10:70642587-70642609 ACCTTTTCTGCTTTCTCTTGTGG + Intergenic
1071293405 10:84202939-84202961 AACTTGTCTTCACTCTCCTGTGG + Intronic
1071512834 10:86275287-86275309 ATATTGTCTTCCTTCCCCAGAGG - Intronic
1071984427 10:91036392-91036414 ACCTTGGGTTCATTCTCCTCTGG - Intergenic
1072234459 10:93441149-93441171 AGGTGGTCTTTCTTCTCCTGGGG - Intronic
1072373574 10:94791474-94791496 ACCTTTCCTGCTTTCTCCTGTGG + Intronic
1073140302 10:101242741-101242763 ACTGTGTCCTCATTCTCCTGTGG + Intergenic
1074265247 10:111895498-111895520 AGGTTGTCTTTCTTCTACTGAGG - Intergenic
1076127631 10:127987916-127987938 AGCTTGTCTTCAGGCTCCTGAGG + Intronic
1076500154 10:130930549-130930571 ACCTCCTCCTCCTTCTCCTGTGG + Intergenic
1076500161 10:130930585-130930607 ACCTCCTCCTCCTTCTCCTGTGG + Intergenic
1076500168 10:130930621-130930643 ACCTCCTCCTCCTTCCCCTGTGG + Intergenic
1076500177 10:130930657-130930679 ACCTCCTCCTCCTTCTCCTGTGG + Intergenic
1076500184 10:130930693-130930715 ACCTCCTCCTCCTTCTCCTGTGG + Intergenic
1076500191 10:130930729-130930751 ACCTCCTCCTCCTTCTCCTGTGG + Intergenic
1076500198 10:130930765-130930787 ACCTGCTCCTCCTCCTCCTGTGG + Intergenic
1076500205 10:130930801-130930823 ACCTCCTCCTCCTCCTCCTGTGG + Intergenic
1076500213 10:130930837-130930859 ACCTCCTCCTCCTTCTCCTGTGG + Intergenic
1076500220 10:130930873-130930895 ACCTCCTTCTCCTTCTCCTGTGG + Intergenic
1076903704 10:133352032-133352054 AGCTGGTCGTCCTTCTCCGGAGG - Exonic
1077081679 11:727216-727238 CCCTTGTCCACCTTCTCTTGAGG + Exonic
1077379410 11:2222152-2222174 ACTTTGTTTTTCTTCTCTTGGGG - Intergenic
1077696725 11:4399887-4399909 ATCTTTTCTGCTTTCTCCTGTGG - Intergenic
1077834876 11:5917362-5917384 ATCTTTTCTGCTTTCTCCTGTGG - Intronic
1078550016 11:12273767-12273789 ACCTTCTCTCCCTGCCCCTGTGG - Intergenic
1078583510 11:12558846-12558868 ACCTTGCCTACCTTGGCCTGTGG - Intergenic
1079718540 11:23780870-23780892 ACCTTGTTTTGCTTCTTCAGTGG - Intergenic
1080199998 11:29657823-29657845 ACCTTATCAACCTTCTCCTTTGG + Intergenic
1081099456 11:38984129-38984151 ACCTTTGTTTCCTTCTTCTGTGG - Intergenic
1082757157 11:57088874-57088896 CCCTTCCCTTCCTTCTCCTCCGG - Intergenic
1083902535 11:65650563-65650585 GCCCTGTCCGCCTTCTCCTGGGG - Exonic
1086120959 11:83304137-83304159 ACCATGTCTGCCTTCCTCTGTGG - Intergenic
1086339686 11:85836032-85836054 AACTTGTCTTCTGTCACCTGCGG + Intergenic
1089588821 11:119527112-119527134 AACTTGTTTCCCTTCTCTTGGGG - Intergenic
1091005172 11:131946581-131946603 ACTTTATCTTTCTTCTCCAGAGG + Intronic
1091670952 12:2451890-2451912 ACCTAGTCTCTCTTCTCCTAAGG + Intronic
1091882186 12:3988988-3989010 ACCCTGCCTTCCATCTTCTGGGG + Intergenic
1093124481 12:15312327-15312349 ACATTCTTTTCCTTCTCATGTGG - Intronic
1093269618 12:17044124-17044146 CCCTTTTCTTCTTTTTCCTGAGG - Intergenic
1093802637 12:23392010-23392032 ACCTTTCCTGCCTTCTCTTGTGG - Intergenic
1094781776 12:33799944-33799966 ATCTTTTCTCCTTTCTCCTGTGG + Intergenic
1095426359 12:42078419-42078441 ACATTGTCTTATGTCTCCTGGGG + Intergenic
1095600577 12:44008637-44008659 AACATGCCTTCCTTCTTCTGTGG + Intronic
1096770223 12:53930949-53930971 TCCTTCTCTTCCTTTTCCTGTGG - Intergenic
1097915167 12:65013506-65013528 ACCATGTCTTCATCCTCTTGTGG - Intergenic
1099385038 12:82003812-82003834 ACCTTCTCTTCCCTCTCTTGGGG + Intergenic
1100087261 12:90926844-90926866 AGCTTTTCTACTTTCTCCTGTGG - Intronic
1100219465 12:92488893-92488915 GGCTTGTCTTCCTCCTTCTGGGG - Intergenic
1100445023 12:94651786-94651808 ATCATGTCTTCCTGTTCCTGAGG - Intergenic
1100996426 12:100305537-100305559 ATCTTTTCTGCTTTCTCCTGTGG - Intronic
1101184030 12:102254248-102254270 ATCTTTTCTGCTTTCTCCTGTGG + Intergenic
1101924649 12:108961047-108961069 TCCGTGTCTTCCTTCTCTTCAGG - Exonic
1102055029 12:109890103-109890125 ACCTTGTCCTCCATCTACAGGGG + Intergenic
1102531939 12:113553146-113553168 TGCTTGTCTTCCTCCTCCTTCGG - Intergenic
1102923630 12:116810751-116810773 ACTTTGGCTCCCTGCTCCTGAGG + Intronic
1103516211 12:121509937-121509959 TCCTTCTCCTCCTCCTCCTGAGG + Exonic
1103618734 12:122172725-122172747 CCCTTCTCTTCCTCCACCTGTGG + Exonic
1103764161 12:123269948-123269970 AGCTTTTCTTCTTTGTCCTGTGG - Intronic
1104064058 12:125292122-125292144 ACCTTTGTTTCATTCTCCTGTGG + Intronic
1104643379 12:130481194-130481216 AGCCTGTCTGCCTCCTCCTGCGG - Intronic
1104663048 12:130626200-130626222 ACCTTTTCTGCCTTCTTCTATGG + Intronic
1105020473 12:132813377-132813399 ACCTGCTCCTCCTTCTCCAGGGG + Exonic
1105434718 13:20366429-20366451 ACCTTCTCTTCCTTTTCCCAGGG - Intergenic
1105748970 13:23403853-23403875 ATCTTTCCTGCCTTCTCCTGTGG + Intronic
1106831563 13:33589407-33589429 ATCTTTTCTGCTTTCTCCTGTGG + Intergenic
1108237134 13:48419419-48419441 ATCTTTTCTGCTTTCTCCTGTGG - Intronic
1108605189 13:52030443-52030465 TCCTTCTCTTTCTTCTCCTTAGG - Exonic
1109269263 13:60236301-60236323 TCCATGGCTTCCCTCTCCTGTGG + Intergenic
1110396157 13:75031799-75031821 TCCCTTTCTTCCTTCTCCTCTGG + Intergenic
1111842461 13:93467482-93467504 ATCTTGTCTTCTTGCACCTGAGG + Intronic
1112008529 13:95274733-95274755 ACCTCCTCTGCCTCCTCCTGTGG + Intronic
1112566376 13:100554217-100554239 ACCTTGGCTTTCATCCCCTGGGG - Intronic
1113131376 13:107041163-107041185 ATCTTTTCTGCTTTCTCCTGTGG + Intergenic
1114482431 14:23044115-23044137 CTCTTGTCTTCATTCTCCAGAGG - Exonic
1114563358 14:23609606-23609628 ACCATGTCATTCTACTCCTGCGG + Intergenic
1114784675 14:25583176-25583198 ATCTTTTCTGCTTTCTCCTGTGG + Intergenic
1115664691 14:35534320-35534342 AGCGTGTCTTCCCTCTGCTGGGG + Exonic
1116064726 14:39968718-39968740 TCCTTGGCTTCCTTGTCTTGTGG - Intergenic
1119019283 14:71093450-71093472 TCCTTGTCTTCCTCATCATGTGG - Intronic
1123012473 14:105356096-105356118 ACTTTGTCCCCCTGCTCCTGGGG + Intronic
1124661295 15:31552926-31552948 CCCTTGCCTTCCATCTCGTGAGG - Intronic
1124687193 15:31792580-31792602 ACCTTGACTTTCTTCTCCTCTGG + Intronic
1126474158 15:49048521-49048543 TGCTTTTCTTCCTTCTTCTGAGG + Intergenic
1127374014 15:58365927-58365949 ATCTTTTCTGCTTTCTCCTGTGG - Intronic
1128028425 15:64459606-64459628 ACCTTTTTTCCCTTATCCTGGGG - Intergenic
1128081150 15:64857659-64857681 ACCTTGTCTTCCTTCTCCTGTGG + Intronic
1128510965 15:68313737-68313759 CCCATGCCTTCCCTCTCCTGGGG + Intronic
1128613016 15:69088808-69088830 ACAGTGTTTTTCTTCTCCTGCGG + Intergenic
1128873802 15:71185423-71185445 ACCTTGTTTTCGTTATGCTGAGG + Intronic
1129165305 15:73773873-73773895 TCCTTGCCCTCCTTGTCCTGAGG + Intergenic
1129398947 15:75268791-75268813 ATGTTGTCCTCCATCTCCTGTGG - Exonic
1129402555 15:75293067-75293089 ATGTTGTCCTCCATCTCCTGTGG - Exonic
1129476086 15:75785493-75785515 ATGTTGTCCTCCATCTCCTGTGG - Intergenic
1129706009 15:77794996-77795018 GCCTGGACTCCCTTCTCCTGAGG - Intronic
1130082946 15:80750478-80750500 ACCGTGTCTTCTTTCTGCTGAGG - Intronic
1130170387 15:81506391-81506413 ACCTCTTCTTCCTACTCCAGGGG - Intergenic
1130363308 15:83209689-83209711 CCCTTGTCTTATCTCTCCTGGGG - Intergenic
1130381269 15:83374341-83374363 ACGCTGTCTTCCTTCTATTGGGG + Intergenic
1130788615 15:87127442-87127464 TCCTTCTCTTCCTTCTAGTGTGG + Intergenic
1131200544 15:90392130-90392152 TCCCATTCTTCCTTCTCCTGGGG + Intronic
1131612184 15:93976843-93976865 ACATTTTCTTCCTACTGCTGTGG - Intergenic
1131971914 15:97902086-97902108 ACAATGCCTTCATTCTCCTGGGG - Intergenic
1134213424 16:12297108-12297130 ACCCTGTCTTCTTTCTGCAGCGG - Intronic
1134252959 16:12587674-12587696 ACCTTCCCTTCCCTCTGCTGTGG + Intergenic
1135058981 16:19254967-19254989 ACCTTGACTTTCATCTCTTGAGG + Intronic
1135221823 16:20620932-20620954 CCCTTGTCTTCCTCCTGCTCTGG - Intronic
1136025601 16:27466471-27466493 CCATTTTCTTCCCTCTCCTGGGG + Intronic
1136454898 16:30374840-30374862 ACCATGTCTTCAGTCTCCGGGGG - Exonic
1137504108 16:49036051-49036073 TCCTTGTCTTCCTGCTGCAGTGG - Intergenic
1138629087 16:58279333-58279355 ACTTTGTCCTGCCTCTCCTGCGG + Intronic
1138887200 16:61093736-61093758 ATCTTTTCTGCTTTCTCCTGTGG - Intergenic
1139206157 16:65030928-65030950 GCCTATTCTACCTTCTCCTGGGG - Intronic
1139791888 16:69444308-69444330 AGCTGGTCTGGCTTCTCCTGGGG + Intronic
1140479592 16:75255345-75255367 ACCGTTTCTTCCTGTTCCTGGGG - Intronic
1141799576 16:86297731-86297753 TCCCTCCCTTCCTTCTCCTGTGG + Intergenic
1142254572 16:89007447-89007469 AACCTGACTTCCTACTCCTGTGG + Intergenic
1143125623 17:4639615-4639637 ACCTTGAGTTCTGTCTCCTGCGG + Exonic
1143402854 17:6657208-6657230 ACCTTGAGTTCTGTCTCCTGCGG - Intergenic
1144656233 17:17038922-17038944 ACCTTGGCTTCCCTTTCCAGGGG - Intergenic
1144793703 17:17877021-17877043 ACCCTTCCTTCCTTCTCCTCAGG + Intronic
1144886635 17:18467457-18467479 GCCTTTTCTGCCTTCTCCTCAGG + Intergenic
1145145577 17:20476851-20476873 GCCTTTTCTGCCTTCTCCTCAGG - Intergenic
1146532547 17:33621669-33621691 GACCTGTCTTCTTTCTCCTGCGG + Intronic
1147325122 17:39666348-39666370 ACCTTTTGTCCCTTCTCCTGGGG - Exonic
1147548080 17:41418712-41418734 CTCTTATTTTCCTTCTCCTGAGG - Intergenic
1148402903 17:47383388-47383410 ATCTTTCCTGCCTTCTCCTGTGG + Intronic
1151020284 17:70608338-70608360 TCTTTGTCACCCTTCTCCTGAGG + Intergenic
1151802815 17:76387688-76387710 ACCTTCTCACCCTTCTCCAGAGG - Exonic
1151842779 17:76629499-76629521 ACCTTGTCCTGCTCCTCCGGCGG + Exonic
1152300527 17:79492905-79492927 GCCTTGTCTTCCTCCTTTTGAGG - Intronic
1152315069 17:79575364-79575386 ACCTTGTCTTCCCTGGCCTCAGG - Intergenic
1203167942 17_GL000205v2_random:115468-115490 ACCTTTTCTGCTTTCTCTTGTGG - Intergenic
1153064650 18:1032416-1032438 ATCTTGCCTGCCTTCTCTTGTGG + Intergenic
1153908388 18:9684602-9684624 CCCTTTTCTTCCTTCAGCTGGGG - Intergenic
1154292201 18:13118510-13118532 ACCACCTCTTCCTTCTCCTATGG + Intronic
1155351518 18:24911972-24911994 TCCTGGTCTTCCTTCCCCTCAGG + Intergenic
1155651539 18:28149699-28149721 TCCTAGTTTTCCTTCCCCTGGGG - Intronic
1156358879 18:36366480-36366502 ATAATGTCTACCTTCTCCTGAGG - Intronic
1156368510 18:36451604-36451626 CCCTCCTCTTCCTTCTCCTCCGG + Intronic
1157762194 18:50273410-50273432 GCCTTCTCTTGCTTCACCTGGGG + Exonic
1158186727 18:54779971-54779993 ACCGTGTCTCCCCTCTCCTGAGG + Intronic
1158198103 18:54910610-54910632 AGCCTGTCTGCCTTCTGCTGTGG + Intronic
1158438729 18:57454498-57454520 ACCTTGTCCTCCTCCTACAGAGG - Intronic
1158945122 18:62441459-62441481 ACCTTCTCAGCCTGCTCCTGTGG - Intergenic
1159088975 18:63825011-63825033 ACCCTCTCTTCCTTCTGCTCTGG - Intergenic
1159955393 18:74515322-74515344 ACCTTCTCTTCCTATTCCAGAGG - Intronic
1161255799 19:3308641-3308663 CCCTAGTCTTCCTTCTCCTGTGG + Intergenic
1161683871 19:5693709-5693731 CCCTTGGCATCCTTGTCCTGTGG + Exonic
1162213969 19:9116752-9116774 ACCTTATCTTCACTTTCCTGTGG - Intergenic
1162512741 19:11129516-11129538 TCCTCGTCTTCCTTTGCCTGGGG + Exonic
1163114310 19:15180036-15180058 ACCTCCTCTTCCCTCTCCTGGGG + Intronic
1163219693 19:15908787-15908809 ACCTTCTCAACCTTCTCTTGGGG - Intergenic
926162881 2:10501021-10501043 ACCTTGGCTCCCTTCTCCTGCGG + Intergenic
926587702 2:14706606-14706628 ACCTGCTCTTACTTTTCCTGTGG + Intergenic
926735944 2:16073463-16073485 TCCTGGCCTTCCTTCTCCTCCGG - Intergenic
927068741 2:19502570-19502592 ATGTTGTCTACCTTCTCCAGTGG + Intergenic
927143997 2:20149055-20149077 CCTTTGTCTTCCTTCTTTTGTGG - Intergenic
927163367 2:20291954-20291976 ACTTTGACTTCTTTCTCCAGTGG + Intronic
928369063 2:30726314-30726336 ACCTTGTGTTCCTGATCTTGGGG - Intronic
928462398 2:31486478-31486500 TGCTTTTCTTCCTTCTCCTTGGG + Intergenic
929255842 2:39810799-39810821 ATCTTTTCTGCTTTCTCCTGTGG + Intergenic
930190096 2:48449307-48449329 ACCCTACCTTCCTTCTTCTGAGG - Intronic
930207275 2:48600699-48600721 ACAGTGTCTTCCTTCTCCACAGG + Intronic
930275090 2:49301503-49301525 ATCTTATCTGCTTTCTCCTGTGG - Intergenic
931985900 2:67742066-67742088 ATCTTGCCTGCTTTCTCCTGTGG + Intergenic
933147038 2:78866606-78866628 ACCTTTTCTTCTTTCTTCTCTGG + Intergenic
933796847 2:85926833-85926855 ACCTTGTCTCCATCCTCCTTGGG - Intergenic
935468038 2:103422781-103422803 ACCTTTTGTTCCTTCTCCATGGG + Intergenic
935961769 2:108432395-108432417 ATCTTTTCTACTTTCTCCTGTGG - Intergenic
937203995 2:120224099-120224121 ACCATGTTTTCCTTTTCCTTTGG + Intergenic
937272014 2:120659047-120659069 ACCCTGCCTTCCTTCTCCAAAGG + Intergenic
937705164 2:124912126-124912148 AGCTTGGCTTCCTCCTGCTGTGG + Intronic
938031695 2:128000021-128000043 CCCTCCTCTTCCTTCTACTGGGG - Intronic
938097784 2:128474735-128474757 GCCTTGTCTGCCTCCTTCTGTGG - Intergenic
938535184 2:132234219-132234241 ATCTTTTCTTCTTTCTCTTGTGG - Intronic
939313299 2:140512430-140512452 AACTTGTCTTTCTTCTCCCTCGG - Intronic
939640558 2:144635763-144635785 ATCTTTTCTGCTTTCTCCTGTGG + Intergenic
940758237 2:157707508-157707530 ACCTTTCCTGCTTTCTCCTGTGG - Intergenic
940866238 2:158820123-158820145 AACTTCTCTTCCTTTTCCTTTGG - Intronic
941247283 2:163114924-163114946 ACCTTTTCTTTATTCTCCTTTGG - Intergenic
941387847 2:164875066-164875088 TCCTCTTCTTCCTCCTCCTGTGG - Intergenic
943589514 2:189780656-189780678 ACCTTCTCTTTCTTCTTATGGGG - Intronic
944561197 2:200940385-200940407 AACTTGTCTGCCTTGTCCTTTGG + Intronic
944976724 2:205061989-205062011 AACCTGTCATCCATCTCCTGAGG + Intronic
945276631 2:207994323-207994345 ACCTTGTCTTCTTTATCCTACGG + Intronic
945406539 2:209455727-209455749 ACCTTGTAATCCTGGTCCTGAGG + Intronic
945969419 2:216221386-216221408 ACTTTGTTTTCCTTCTCCATAGG - Intergenic
946705338 2:222453033-222453055 ACCTTGTCTTCCTTCTTTTGTGG + Intronic
947541832 2:230985232-230985254 ATCTTTTCTTCCTTCACCTCCGG + Intergenic
947791245 2:232870631-232870653 AAGTTGTCCTCCTTCTCCAGAGG - Intronic
948307432 2:236959840-236959862 ACCTTCTCCTCCTTCTCCGCAGG - Intergenic
948310509 2:236982125-236982147 ATCCTTGCTTCCTTCTCCTGGGG + Intergenic
1168841079 20:910635-910657 ACCTTCTTCTCCTTCTCCTTGGG - Intronic
1168953921 20:1821035-1821057 AGTTTGTCTTCCTTTCCCTGGGG + Intergenic
1169725108 20:8720169-8720191 ACCTTGTCTTCCTTTGCATGTGG + Intronic
1170381129 20:15760631-15760653 ATCTTCTCCTCCCTCTCCTGGGG - Intronic
1170584513 20:17724367-17724389 ACCTTCTCTTCCTTCTTTTGAGG + Intronic
1171325947 20:24292935-24292957 AGCTTGTGTTTCTTCCCCTGCGG - Intergenic
1171441696 20:25168968-25168990 ACCTTTCCTGCTTTCTCCTGTGG - Intergenic
1172639069 20:36430227-36430249 CCCTTGCCTTGCTTGTCCTGAGG + Intronic
1172823992 20:37764432-37764454 ACCCAGGCTTCCTTCTCCTTAGG - Intronic
1173670192 20:44793552-44793574 TCCCTGGCTTCATTCTCCTGAGG - Intronic
1174690031 20:52494970-52494992 AGCTTGTCTTCTTACTCCTTGGG + Intergenic
1174936613 20:54877368-54877390 ATCTTGTCTTCCTTCTGCTTAGG - Intergenic
1175150242 20:56928188-56928210 ACCTGCCCTTCCTTCTCATGGGG - Intergenic
1175884153 20:62279431-62279453 ACCCTGTCATTTTTCTCCTGAGG + Intronic
1176403815 21:6343668-6343690 ACCTTTTCTGCTTTCTCTTGTGG + Intergenic
1176412936 21:6458519-6458541 CCATTGTCCTCCTTCCCCTGTGG + Intergenic
1176413876 21:6463753-6463775 TCCTTGGCTTCCTTATCCTCTGG + Intergenic
1176433342 21:6645436-6645458 ACCTTTTCTGCTTTCTCTTGTGG - Intergenic
1179689374 21:43072075-43072097 TCCTTGGCTTCCTTATCCTCTGG + Exonic
1180228851 21:46414379-46414401 CCCTTCTCCTCCTTCTCCTCTGG + Intronic
1181325145 22:22039101-22039123 TCTTTGTCTTCCTTCCCCGGTGG - Intergenic
1181713244 22:24704967-24704989 ACCTGTACTTCTTTCTCCTGGGG - Intergenic
1182443062 22:30375360-30375382 AGCTCATCTTCCTTCTCCCGAGG - Intronic
1182975840 22:34623437-34623459 ACCTTTTCATAATTCTCCTGAGG - Intergenic
1183365310 22:37403656-37403678 GCCTTTTCTGCCTTTTCCTGTGG - Intronic
1183645347 22:39123269-39123291 ACCTGGCCCTCCTTCTCCAGAGG + Intronic
1184350825 22:43942916-43942938 ACTTTTTCTTCCTCTTCCTGGGG + Intronic
949265353 3:2151033-2151055 CTATTGTCTTTCTTCTCCTGTGG - Intronic
950169004 3:10823406-10823428 AACTTGTCTCCCTTGGCCTGTGG + Intronic
950299608 3:11865087-11865109 ACCTTTTCTGCTTTCTCTTGTGG + Intergenic
953252893 3:41262497-41262519 ACCTTTATTTCCTCCTCCTGGGG + Intronic
953351683 3:42220864-42220886 AACTTGGCTTCCTCATCCTGTGG + Intronic
953474285 3:43192965-43192987 ACCTTGTGTTCCTTCTTTTATGG - Intergenic
954081654 3:48215753-48215775 ACCTTGCTGTCCTTCTCATGGGG - Intergenic
955466343 3:59241089-59241111 ACCTTGTCTGCTCTCTTCTGAGG + Intergenic
957617517 3:82550232-82550254 ATCTGGTCTTCCTTATCTTGGGG + Intergenic
957995315 3:87680963-87680985 ACCTTCTGTTCCTTTTCCTCTGG - Intergenic
959063888 3:101638492-101638514 AGCCTGTCTTTCTTCTTCTGTGG - Intergenic
960533927 3:118795630-118795652 CCCTTGTCTGCCTTCTCTTTGGG - Intergenic
960751898 3:120964382-120964404 ATCTTTCCTTCCTTCTCTTGTGG + Intronic
962967176 3:140365916-140365938 AGCTTGTATTCTTCCTCCTGGGG + Intronic
963482318 3:145891653-145891675 ACCTTTTCTTTCTTCCTCTGTGG + Intergenic
964422553 3:156519421-156519443 TCCTTCTTTTCATTCTCCTGTGG + Intronic
964662896 3:159140356-159140378 ACCTTCTTTTCCTTCTCCAGGGG - Intronic
966984005 3:185163456-185163478 GCCTTCTCTTCCTTCAGCTGTGG - Intergenic
967106431 3:186258341-186258363 ATCTTCTCTTCACTCTCCTGTGG + Intronic
967447653 3:189585338-189585360 ACCTGGTCTTCCCTCACCTGTGG - Intergenic
967827210 3:193886832-193886854 ACCTTTTCTTCCTTCTTCCAAGG + Intergenic
968018907 3:195366174-195366196 ACCTTTTCTTCCTTCCTCTAAGG + Intronic
969631389 4:8340711-8340733 CCCGTGTTTTCCTCCTCCTGAGG - Intergenic
972071507 4:35024163-35024185 ACCTTTTCTTGCTTTTCATGTGG - Intergenic
973077566 4:45948362-45948384 AACTTGTCTTCTTTCTCTTGAGG + Intergenic
973682173 4:53331629-53331651 ATCTTTCCTTCTTTCTCCTGTGG - Intronic
973895026 4:55403423-55403445 TCTTTTTCTTCCTTCTCTTGAGG + Intronic
976731292 4:88264951-88264973 TCCTTTCCTTCCTTCTCCTTGGG + Intronic
976778571 4:88733612-88733634 ACCCTGTTTTCCTTATCCAGGGG - Intronic
977528476 4:98172770-98172792 ACCTTTTCTTGCTCCTCCTGTGG - Intergenic
978278039 4:106975848-106975870 ATCTTTTCTGCCTTTTCCTGTGG + Intronic
978531490 4:109719249-109719271 ACCTTGTCTTCCTTAGCCTTAGG - Intronic
978694389 4:111559328-111559350 ATCTTTTCTGCTTTCTCCTGTGG + Intergenic
978810543 4:112844650-112844672 ACCTTGTCTTCCTTTGCCTTAGG - Intronic
979100407 4:116605115-116605137 ACCCTGTCTTCCTCCTGCTCTGG - Intergenic
979547176 4:121951604-121951626 CCCTCGTCTTCCTCCTCCTCCGG + Exonic
980011879 4:127604990-127605012 ACCTTCTCTCCCTCATCCTGGGG - Intergenic
980496701 4:133594095-133594117 ACCTTGTTTTCCTACTCTAGGGG - Intergenic
981076692 4:140599542-140599564 AGCTTGGACTCCTTCTCCTGAGG + Intergenic
981136614 4:141217942-141217964 ATCTTTTCTTCCCTCTCCAGAGG + Intergenic
981481116 4:145240265-145240287 ACCTTTCCTACTTTCTCCTGTGG + Intergenic
981701916 4:147616972-147616994 TCCTTGTCTTCTTACTCCAGCGG + Intergenic
982100440 4:151962037-151962059 GCCTTCTCTTCCTTCTTTTGTGG + Intergenic
983042605 4:162947648-162947670 ATCTTCTTTTTCTTCTCCTGTGG - Intergenic
983105425 4:163680615-163680637 TCCTTGTCATCCTTCCTCTGTGG + Intronic
984553862 4:181191286-181191308 ACCTTGTCTGTCTTCTATTGAGG + Intergenic
985845227 5:2339725-2339747 ACCTGGCCTGGCTTCTCCTGAGG + Intergenic
986091908 5:4516948-4516970 TCCTTCTCTTCCTTCTTCTTTGG + Intergenic
986446703 5:7827557-7827579 TTCCTGTCTTCTTTCTCCTGTGG + Exonic
987262353 5:16216132-16216154 ACCTTGACTTTGTTCTCCAGTGG - Intergenic
988304918 5:29481510-29481532 ACCTGGTTTTCCCTCTCCTTAGG - Intergenic
989800084 5:45526690-45526712 AGCTAGATTTCCTTCTCCTGGGG + Intronic
990023716 5:51159908-51159930 AGCCTGTCTGCCTTCTGCTGAGG - Intergenic
990359118 5:54999952-54999974 ATCTTGCCTTCTTTCTCTTGTGG - Intronic
990811213 5:59725722-59725744 ACTTTGTGTTCCTTCTCATTGGG + Intronic
990833480 5:59986952-59986974 ATCTTGTCTTACTTCACTTGGGG + Intronic
991116908 5:62964697-62964719 ACCTTTTCTTCATTGTCTTGGGG + Intergenic
991406568 5:66305920-66305942 ACCTGTTCCTCCTCCTCCTGGGG - Intergenic
992288214 5:75257331-75257353 ACCTTTTCCACTTTCTCCTGTGG - Intergenic
993655657 5:90575563-90575585 ACCTTGCCTTCATTTTCCAGGGG + Intronic
994506948 5:100655504-100655526 ACCTTGTCTGCTTTCTCTTTTGG - Intergenic
994557399 5:101320704-101320726 ATCTTGTCTTGCCTCTCTTGAGG + Intergenic
995670868 5:114601053-114601075 ATCTTTTCTGCTTTCTCCTGTGG - Intergenic
997509771 5:134446224-134446246 GCCTTGTCTTCCTTCTGCCAGGG - Intergenic
999079075 5:148826463-148826485 CCCTCGCCCTCCTTCTCCTGGGG - Exonic
999290490 5:150422283-150422305 ACTCTGTCTCCCTCCTCCTGTGG - Intergenic
1001246349 5:170108110-170108132 ATTTTCTCTTCCTTTTCCTGCGG - Exonic
1001385460 5:171334989-171335011 ACATTGTCTTCTCTCCCCTGGGG + Intergenic
1001965908 5:175909748-175909770 ACCTTGTTTTTTTTTTCCTGTGG - Intergenic
1002522940 5:179801356-179801378 ACCGAGTCCTCCTTCTCCTGCGG + Exonic
1002945139 6:1753916-1753938 ATCTTTTCTGCATTCTCCTGTGG - Intronic
1004580610 6:16947446-16947468 AACTTTTCTTCTTTCTTCTGTGG - Intergenic
1004998674 6:21218644-21218666 TCCTTCCATTCCTTCTCCTGTGG + Intronic
1005040289 6:21594985-21595007 ACCTTGTCTCCCTTCTCCCCCGG - Exonic
1005274489 6:24201535-24201557 ATCTTTTCTGCTTTCTCCTGTGG - Intronic
1007783062 6:44265153-44265175 TCCGCGTCTTCCTTCTCCTGTGG + Exonic
1007787723 6:44290830-44290852 CCCTTCTCCTTCTTCTCCTGGGG + Intronic
1008037005 6:46756057-46756079 ACCTTCTCTTTCTTCTCCCCAGG + Intronic
1008284683 6:49633900-49633922 TCCTTGTCTGCCTTTCCCTGTGG + Intronic
1008852198 6:56035875-56035897 ATCTTTACTTCCATCTCCTGAGG - Intergenic
1009512592 6:64571310-64571332 ATCTTTTCTGCTTTCTCCTGTGG - Intronic
1009576361 6:65466783-65466805 TCCTTGTGTTCCTTCTCTTCTGG - Intronic
1010434975 6:75818785-75818807 ACTTTGTCTTTCCTGTCCTGAGG - Intronic
1011296544 6:85832484-85832506 ATCTTTTCTGCTTTCTCCTGTGG + Intergenic
1011776497 6:90736847-90736869 ATCTTTTCTGCTTTCTCCTGTGG + Intergenic
1012363486 6:98411276-98411298 ACCTTCCCTGCTTTCTCCTGTGG + Intergenic
1012562534 6:100600987-100601009 ATCTTGTCTCCCTTCTCCTTAGG + Intronic
1012832475 6:104222096-104222118 ACATTTTATTCCTTCTCCTGGGG + Intergenic
1013263001 6:108465022-108465044 ATCTCCTCTTCCTTCTCCTAAGG - Intronic
1013605663 6:111745255-111745277 TCCTTGTCTGCCTTCTCCCATGG - Intronic
1014058214 6:117041192-117041214 ATCTTTTCTGCTTTCTCCTGTGG + Intergenic
1014475166 6:121863144-121863166 ATCTTTTCTGCCTTCTCTTGTGG + Intergenic
1015064847 6:129012020-129012042 CCCTTGTGTTCCTTCTACTCAGG + Intronic
1016242148 6:141943126-141943148 ATCTTTTCTGCTTTCTCCTGTGG - Intergenic
1016814892 6:148294223-148294245 TTCTTGTCTGCCTTCTCTTGTGG - Intronic
1017091165 6:150760383-150760405 ACTTTGTCTTCCTTGTCATCAGG - Intronic
1017683062 6:156883509-156883531 AGCTTTACTTCCTTCTCCTCTGG + Intronic
1018206164 6:161439138-161439160 ACCTTGTCTGCCTTTTCCTCCGG - Intronic
1018410226 6:163537809-163537831 AACTGGTATTCCTTCTTCTGGGG + Intronic
1018525130 6:164702026-164702048 ACATTGACTTCCTTCTCCACAGG - Intergenic
1020511985 7:9067972-9067994 ATCTTTTCTGCTTTCTCCTGTGG + Intergenic
1021224283 7:18010042-18010064 ATCTTTTCTGCTTTCTCCTGTGG + Intergenic
1021271765 7:18597084-18597106 ACCTTTACTTCCTTCCCCTTAGG + Intronic
1022885178 7:34635907-34635929 ATCTTTTCTACTTTCTCCTGTGG - Intergenic
1023074587 7:36470475-36470497 ACCTTGACTTCCATCTTGTGAGG - Intergenic
1023430485 7:40085970-40085992 CCCTTGCCTTCCTCCACCTGAGG + Intronic
1023499004 7:40828327-40828349 ACATGGTCTTTCTTGTCCTGAGG + Intronic
1023549000 7:41348783-41348805 ACCTTTTCTAACTTCTGCTGAGG + Intergenic
1024755112 7:52519869-52519891 TCCTTCTCTTCCTTCTGCTCTGG - Intergenic
1026294249 7:69037451-69037473 ACCTGCTTTTCCTCCTCCTGAGG + Intergenic
1027619559 7:80466630-80466652 CCCTTTTTTTCCTCCTCCTGGGG - Intronic
1028171650 7:87604135-87604157 ACCTATTTTTCCTTCTCCTATGG + Intronic
1028828628 7:95303013-95303035 ATCTTGGCTGCCTTCTACTGGGG + Intronic
1028953477 7:96663366-96663388 ACCTTGTCATCTACCTCCTGGGG - Intronic
1030078760 7:105759259-105759281 ATTATGTCTTCCTTCTTCTGTGG + Intronic
1030671505 7:112343205-112343227 ACCATTTCTTCTTTCTTCTGTGG - Intergenic
1031222177 7:118982174-118982196 TCCTCTTCTTCCTTCTCCTAGGG - Intergenic
1031312862 7:120220589-120220611 ACCTTTTCTTCCTACTTTTGGGG - Intergenic
1031751739 7:125583254-125583276 ATCTTGTCTTCCTTTTTTTGTGG + Intergenic
1032085676 7:128882269-128882291 ACCATGGCTTCCTTAGCCTGAGG + Intronic
1032662533 7:134001109-134001131 ACCATGTCTTTCATCTCTTGGGG - Intronic
1032868681 7:135956443-135956465 ACCATGTTTTCCTTTTCCTCTGG + Intronic
1032987452 7:137354390-137354412 ACATTTTCTTCTTTCTCTTGGGG + Intergenic
1033653912 7:143361329-143361351 CCCCTGTCTCCCTTCTCCTCAGG - Intronic
1038211876 8:25525994-25526016 ATCTTTCCTGCCTTCTCCTGTGG - Intergenic
1038381987 8:27104722-27104744 TCATTGCCTTCCTTCTCTTGAGG - Intergenic
1038619628 8:29128674-29128696 TCCTTTTCTTCCCTCTCCTTAGG - Intronic
1039176521 8:34813729-34813751 AACCAGTGTTCCTTCTCCTGTGG + Intergenic
1039781797 8:40793406-40793428 AACTTGTCTTCCTCCTTGTGTGG - Intronic
1041120761 8:54584109-54584131 ATCTTGTCTTCTTTCTCTTGTGG + Intergenic
1041122874 8:54605147-54605169 ATCTTGTCTTCTTTCTCTTGTGG + Intergenic
1041229511 8:55734931-55734953 AGCTCCTCTCCCTTCTCCTGAGG - Intronic
1041553018 8:59120580-59120602 ACATTGTCCTCCATCTCATGAGG + Intergenic
1041638335 8:60169106-60169128 AACTTGTATTCCTTCAGCTGAGG - Intergenic
1041684763 8:60633229-60633251 CCCTGGTGCTCCTTCTCCTGGGG + Intergenic
1041759617 8:61350236-61350258 ACCTATTTATCCTTCTCCTGAGG + Intronic
1041995374 8:64050141-64050163 GCCTTGTCTGCCTCTTCCTGTGG - Intergenic
1042115741 8:65429372-65429394 ATCTTTTCTGCCTTCTCTTGTGG - Intergenic
1043565412 8:81542182-81542204 GCCTTGACCTCCTTCTCTTGAGG + Intergenic
1045151496 8:99413539-99413561 ATCTTTTCTGCTTTCTCCTGTGG + Intronic
1046241805 8:111506413-111506435 TCCTTCTCTTCCTCCTCTTGTGG - Intergenic
1048225059 8:132577173-132577195 ACCAAGTCTTCCTTCTTATGGGG + Intronic
1049807276 8:144546755-144546777 ACCTTGGCTGCCTGCTCCTCAGG + Intronic
1049959994 9:729307-729329 ATCTTTTGTACCTTCTCCTGGGG - Intronic
1050284256 9:4084758-4084780 TCCTTGGCTTCCTCCTCGTGTGG + Intronic
1051969991 9:22876789-22876811 ACCATCTCTTCTTTCTCCTTTGG + Intergenic
1052021950 9:23535281-23535303 GCCTTTTCTTACTTCTCGTGAGG - Intergenic
1052563922 9:30122149-30122171 CCCTTGTCTTGCTTCTGCTTTGG - Intergenic
1052996260 9:34552982-34553004 TCCATGTCCTCCTTCTCCTCAGG - Intronic
1053363379 9:37505318-37505340 ACTTTGTCTTCCTTCAGCAGAGG + Intergenic
1053485719 9:38454592-38454614 TCCTCTTCCTCCTTCTCCTGTGG + Intergenic
1055210594 9:73786069-73786091 ATCTTTTCTGCTTTCTCCTGTGG - Intergenic
1056489558 9:87091979-87092001 ACATTGGCTTCCTGCTTCTGAGG - Intergenic
1056843314 9:90016394-90016416 ATCTTGTCTCTCTTCTTCTGTGG + Intergenic
1058413731 9:104763854-104763876 ACCTCCCCTTCCTTCTCCAGGGG + Intergenic
1060224616 9:121783354-121783376 ACTGTATCTGCCTTCTCCTGGGG + Intronic
1060474857 9:123979116-123979138 CCCAGGGCTTCCTTCTCCTGAGG - Intergenic
1060596392 9:124851696-124851718 ACTATCTCTTCCTTCTCCTCAGG - Intergenic
1060969019 9:127727427-127727449 TCCTTTTCTTCCTCCTCCTCAGG - Exonic
1061114631 9:128601772-128601794 ACCTTGTCTGACCTCTCCTGAGG + Intronic
1062084662 9:134642383-134642405 AACTTTTCTTCCTTGGCCTGTGG + Intronic
1203438194 Un_GL000195v1:163234-163256 ACCTTTTCTGCTTTCTCTTGTGG + Intergenic
1186057335 X:5664000-5664022 CCCTTGTCTTCTTTTTCCTGGGG + Intergenic
1186364617 X:8878371-8878393 AACAAGTCTTCCTTCTCTTGAGG + Intergenic
1187883332 X:23865902-23865924 CTCTTTTCTTCCTTTTCCTGGGG - Intronic
1189091594 X:38089116-38089138 ATCTTGACTTCCACCTCCTGAGG - Intronic
1189209654 X:39274172-39274194 ATCTTTCCTGCCTTCTCCTGTGG + Intergenic
1189721586 X:43925007-43925029 ATCTTTTCTGCTTTCTCCTGTGG + Intergenic
1190328442 X:49221033-49221055 ACCAGGCCTTCATTCTCCTGTGG + Exonic
1190334296 X:49253084-49253106 TCTTTGTCTTCCTCCTCCTTGGG + Intronic
1190442242 X:50486347-50486369 ACCATATCTTCCTTCTCCTCAGG - Intergenic
1190627118 X:52346735-52346757 ACCCACTCTTCCTTCTCTTGGGG - Intergenic
1190648339 X:52544081-52544103 ATGTTGTCGTCCTTCTCATGTGG + Intergenic
1192292069 X:69808688-69808710 ACCTTATCTTGCTACTCATGGGG - Intronic
1193248784 X:79263577-79263599 GCCTGGTCTTCTTTCTCCTTTGG + Intergenic
1193267141 X:79485108-79485130 ACCTTTCCTGCTTTCTCCTGTGG - Intergenic
1193422374 X:81296719-81296741 AGGTTGTCTTCCTTCTCCTCTGG - Intronic
1193461987 X:81801864-81801886 ACCTTGACTTTCTTCTACAGTGG + Intergenic
1194006506 X:88500279-88500301 AACTTGTCATCCCCCTCCTGTGG + Intergenic
1194130958 X:90081144-90081166 ACAGTGTCTTCCTTATCCTTGGG + Intergenic
1196411782 X:115427502-115427524 TCCTCTTCTTCCTTCTGCTGAGG - Intergenic
1197327670 X:125114294-125114316 ATCTTTTCTGCTTTCTCCTGTGG - Intergenic
1198322317 X:135530590-135530612 ACCATGTCTACCTCCTCCAGAGG - Intronic
1198795819 X:140392864-140392886 TCCTTTTCTTCATTATCCTGGGG - Intergenic
1198993980 X:142551738-142551760 TCCTTCTCTTCCTTATCCTCTGG - Intergenic
1201595666 Y:15665865-15665887 ATCTTTTCTACTTTCTCCTGTGG + Intergenic
1202092026 Y:21201613-21201635 ATCTTTCCTGCCTTCTCCTGTGG + Intergenic