ID: 1128090817

View in Genome Browser
Species Human (GRCh38)
Location 15:64917493-64917515
Sequence CACACAGACGTGCCTCTGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 166}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128090817_1128090826 23 Left 1128090817 15:64917493-64917515 CCTCACAGAGGCACGTCTGTGTG 0: 1
1: 0
2: 1
3: 10
4: 166
Right 1128090826 15:64917539-64917561 CTCAGGGTGGTGGGGGGCACTGG 0: 1
1: 0
2: 2
3: 58
4: 662
1128090817_1128090819 7 Left 1128090817 15:64917493-64917515 CCTCACAGAGGCACGTCTGTGTG 0: 1
1: 0
2: 1
3: 10
4: 166
Right 1128090819 15:64917523-64917545 CTGTCTGTCTGTCTGTCTCAGGG 0: 4
1: 10
2: 44
3: 159
4: 685
1128090817_1128090820 10 Left 1128090817 15:64917493-64917515 CCTCACAGAGGCACGTCTGTGTG 0: 1
1: 0
2: 1
3: 10
4: 166
Right 1128090820 15:64917526-64917548 TCTGTCTGTCTGTCTCAGGGTGG 0: 1
1: 1
2: 6
3: 73
4: 520
1128090817_1128090818 6 Left 1128090817 15:64917493-64917515 CCTCACAGAGGCACGTCTGTGTG 0: 1
1: 0
2: 1
3: 10
4: 166
Right 1128090818 15:64917522-64917544 TCTGTCTGTCTGTCTGTCTCAGG 0: 7
1: 17
2: 77
3: 255
4: 1347
1128090817_1128090821 13 Left 1128090817 15:64917493-64917515 CCTCACAGAGGCACGTCTGTGTG 0: 1
1: 0
2: 1
3: 10
4: 166
Right 1128090821 15:64917529-64917551 GTCTGTCTGTCTCAGGGTGGTGG 0: 1
1: 0
2: 3
3: 41
4: 341
1128090817_1128090824 16 Left 1128090817 15:64917493-64917515 CCTCACAGAGGCACGTCTGTGTG 0: 1
1: 0
2: 1
3: 10
4: 166
Right 1128090824 15:64917532-64917554 TGTCTGTCTCAGGGTGGTGGGGG 0: 1
1: 0
2: 4
3: 45
4: 528
1128090817_1128090825 17 Left 1128090817 15:64917493-64917515 CCTCACAGAGGCACGTCTGTGTG 0: 1
1: 0
2: 1
3: 10
4: 166
Right 1128090825 15:64917533-64917555 GTCTGTCTCAGGGTGGTGGGGGG 0: 1
1: 0
2: 2
3: 59
4: 630
1128090817_1128090822 14 Left 1128090817 15:64917493-64917515 CCTCACAGAGGCACGTCTGTGTG 0: 1
1: 0
2: 1
3: 10
4: 166
Right 1128090822 15:64917530-64917552 TCTGTCTGTCTCAGGGTGGTGGG 0: 1
1: 0
2: 1
3: 23
4: 266
1128090817_1128090823 15 Left 1128090817 15:64917493-64917515 CCTCACAGAGGCACGTCTGTGTG 0: 1
1: 0
2: 1
3: 10
4: 166
Right 1128090823 15:64917531-64917553 CTGTCTGTCTCAGGGTGGTGGGG 0: 1
1: 0
2: 2
3: 24
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128090817 Original CRISPR CACACAGACGTGCCTCTGTG AGG (reversed) Exonic
900235609 1:1588554-1588576 CACACAGAAATACTTCTGTGAGG - Intergenic
900250938 1:1669187-1669209 CACACAGAGAACCCTCTGTGTGG + Intronic
900354733 1:2254967-2254989 GACACAGAGGTGACACTGTGGGG - Intronic
902243308 1:15102785-15102807 CTCCAAGACGTGCCACTGTGTGG + Intronic
903641323 1:24862279-24862301 CAAACTGCGGTGCCTCTGTGGGG - Intergenic
906061695 1:42953215-42953237 CACACTGACTTGCCTCCCTGAGG - Intronic
907319207 1:53592307-53592329 CTCACAGTGGGGCCTCTGTGTGG - Intronic
912191916 1:107350999-107351021 CACACAGAGGTAACTATGTGAGG + Intronic
915196360 1:154192856-154192878 CACACAGACTTTGGTCTGTGTGG + Intronic
915321786 1:155060517-155060539 CTCACAGCTGTGCCCCTGTGGGG + Intronic
918189800 1:182163232-182163254 CACACCCACGTCCCTCTGTCTGG - Intergenic
919767685 1:201137950-201137972 CACCCAGTCCTGCCTCAGTGTGG + Intronic
920268463 1:204744626-204744648 CAAACAGATGTGCATGTGTGAGG + Intergenic
923438271 1:233990630-233990652 CACACAAAGGTAACTCTGTGAGG + Intronic
1062821434 10:537213-537235 CATACGGCCTTGCCTCTGTGTGG - Intronic
1063126721 10:3142530-3142552 CTCACAGACGTGCACCTTTGGGG - Intronic
1067578972 10:47427752-47427774 CACACACAGGTGCCTGTTTGGGG - Intergenic
1070702220 10:78612499-78612521 GACACAGAGGTGGCTCTGAGAGG + Intergenic
1074039217 10:109771612-109771634 GACTCAGAGCTGCCTCTGTGTGG - Intergenic
1075841522 10:125508675-125508697 CCCACAGCTGTGCTTCTGTGGGG - Intergenic
1077475809 11:2789932-2789954 CACAGAGAGGAGCCTCTGAGTGG - Intronic
1080232557 11:30034333-30034355 CACAGAGAAGGGCCTCTGTTGGG + Intergenic
1081633714 11:44706647-44706669 CACACAGTCTTTCCTCTGTGCGG - Intergenic
1083070388 11:59972960-59972982 CACACACACGTGTGTGTGTGTGG + Intergenic
1083683248 11:64360905-64360927 CACACAGACTTTCCTCTCTCTGG + Intronic
1084424672 11:69077969-69077991 CACACAGACGTGTCTCAAGGAGG + Intronic
1087797778 11:102472684-102472706 CACACAGAGCTGCCTGTGCGGGG + Intronic
1092728705 12:11508655-11508677 CACAAAGAGATGCATCTGTGGGG + Intergenic
1097420408 12:59371627-59371649 CACACACACGTGCCTGCATGTGG - Intergenic
1100011096 12:89954239-89954261 CACACACATTTGCCTGTGTGTGG - Intergenic
1102415827 12:112761750-112761772 CCCACAGCTGTGCCTCTGAGGGG + Intronic
1104133855 12:125919292-125919314 CACACAGAGCTGTCTCTTTGGGG - Intergenic
1104795458 12:131514046-131514068 CACACAGGTGTGTCTCTCTGGGG + Intergenic
1104930760 12:132338292-132338314 CACACAGACGCCTCTCTGGGTGG + Intergenic
1104944373 12:132409162-132409184 CTCACTGAGGGGCCTCTGTGGGG - Intergenic
1105592642 13:21808956-21808978 CACACAAAGGTCCCTGTGTGAGG + Intergenic
1106814162 13:33388450-33388472 CACACAGAGCTGCCTCTGCAGGG - Intergenic
1109959466 13:69612189-69612211 CATACAGACTTGCCTCTGCAAGG + Intergenic
1114713614 14:24803077-24803099 CACACAGCTGTGACTGTGTGAGG - Intergenic
1116219226 14:42060784-42060806 TACACAGATGTGCGTGTGTGTGG + Intergenic
1118502965 14:66380457-66380479 CACACACACGTGCCACCCTGGGG + Intergenic
1118641160 14:67793745-67793767 CACTCAGACTTCCCTCTGTTGGG + Exonic
1119566846 14:75636224-75636246 CACACAAACCCGCTTCTGTGAGG + Intronic
1122389579 14:101371070-101371092 AACACATAGCTGCCTCTGTGTGG + Intergenic
1122898222 14:104770993-104771015 CTCCCAGAGCTGCCTCTGTGGGG - Intronic
1128090817 15:64917493-64917515 CACACAGACGTGCCTCTGTGAGG - Exonic
1128328787 15:66742355-66742377 CTAACAGACAGGCCTCTGTGAGG + Intronic
1131796200 15:96019320-96019342 CACCCGGACTTCCCTCTGTGTGG - Intergenic
1132667963 16:1090575-1090597 CAGACAGACGTCCGCCTGTGGGG - Exonic
1136230358 16:28882341-28882363 CACACACCCCTGCCTGTGTGGGG + Intronic
1136233467 16:28901193-28901215 CACAAATATGTGCCACTGTGAGG - Intronic
1136685404 16:31991247-31991269 GATACAGACGTGCCTGCGTGGGG + Intergenic
1139775755 16:69316191-69316213 AACACAGAGGGGCCCCTGTGAGG - Intronic
1140983173 16:80130298-80130320 CACAAAGAGTTGCCTCTGTTTGG + Intergenic
1141428014 16:83956177-83956199 CACACAGATGGGCCACTGAGAGG - Intronic
1141594498 16:85088973-85088995 CACACACACGTCCCTCTGGTGGG - Exonic
1141965216 16:87437553-87437575 CACACAGGCCTGCCTGGGTGCGG - Intronic
1142010543 16:87711752-87711774 CACACAGAGGGGCTTCTGTGGGG + Intronic
1143751648 17:9032495-9032517 CACACAGATGTGGTTCTGAGTGG - Intronic
1144376994 17:14653134-14653156 CACACAGAGGTAACTGTGTGAGG - Intergenic
1147139006 17:38451229-38451251 CACACCCAGCTGCCTCTGTGGGG - Intronic
1147947024 17:44086169-44086191 GACACAGACGTGCCTGAGGGTGG - Intronic
1148923134 17:51057421-51057443 CACACAGCCTTGCCTGTTTGCGG - Intronic
1152148120 17:78581444-78581466 CACACAGAGCTGGCTGTGTGAGG - Intergenic
1152422474 17:80201577-80201599 CACACACCAGAGCCTCTGTGGGG - Intronic
1152422587 17:80202125-80202147 CACAGATACGAGCCTCTGCGAGG - Intronic
1152739805 17:82013882-82013904 CACACAGAAGTGACTGTGTGAGG - Intronic
1152962111 18:86249-86271 CACACAGAAGTGCATCTGGCAGG - Intergenic
1160514633 18:79471623-79471645 CAGCCAGCCCTGCCTCTGTGGGG + Intronic
1163291176 19:16380175-16380197 CACACAGACGTGGCCGTGTAAGG + Intronic
1163296109 19:16413925-16413947 CACACAGAGGGGCTTTTGTGGGG - Intronic
1163412591 19:17165218-17165240 TACAGATATGTGCCTCTGTGTGG - Intronic
1165390369 19:35535098-35535120 CACACAGACCTGCTGCTCTGTGG - Intronic
1168267810 19:55231864-55231886 CACACTGAGGGGCCCCTGTGGGG + Exonic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925770808 2:7281422-7281444 CACACAGACGTGCATCTAGTTGG - Intergenic
926110476 2:10179979-10180001 CACAGAGAGGTGGCTCTGGGTGG - Intronic
930555159 2:52886065-52886087 CACCCAGTGGTGGCTCTGTGTGG + Intergenic
932180071 2:69638946-69638968 TACACGTACGTGCCTCTTTGTGG - Intronic
934494921 2:94788527-94788549 CACACAGCCGTGTCTGTGAGTGG - Intergenic
935720728 2:105976673-105976695 CACACAGTTGTGCCACTGTCAGG + Intergenic
936255453 2:110906864-110906886 CACACAGATGTCCCCCAGTGGGG + Intronic
936580569 2:113696909-113696931 CACCCAGCCTTGCCTCAGTGTGG - Intergenic
940473320 2:154127701-154127723 CACACACACGTGTGTGTGTGTGG + Intronic
940490512 2:154353400-154353422 CACACACACGTAACTATGTGAGG - Intronic
943585841 2:189739027-189739049 TACACAGATGTACCTCTGTCTGG + Intronic
946165472 2:217860981-217861003 CAGACAGTTTTGCCTCTGTGTGG - Intronic
947481101 2:230500754-230500776 CACACAGGGGTGGTTCTGTGTGG - Intronic
947977935 2:234383986-234384008 CACACTGACTTGCCTCTATCAGG - Intergenic
948586465 2:239023088-239023110 CACAGCGCCGTGACTCTGTGAGG + Intergenic
948690002 2:239695981-239696003 CACACGCACTTGCCTGTGTGTGG + Intergenic
948781322 2:240323648-240323670 AACGCAGACGTGCCTCTTAGAGG + Intergenic
948985626 2:241521026-241521048 CACACAAACGTAACTCTGTGAGG - Intergenic
1169359276 20:4934520-4934542 CCCATAGACGTGCTTCTGTGTGG - Intronic
1169415910 20:5416071-5416093 CCCACAGACCTTGCTCTGTGTGG + Intergenic
1170631325 20:18068715-18068737 CATACACATGTACCTCTGTGAGG - Intergenic
1172760109 20:37315678-37315700 CTGTCAGAGGTGCCTCTGTGGGG - Intronic
1174054572 20:47788968-47788990 CACTCAGCCGGGCCTCGGTGGGG + Intergenic
1176111665 20:63413722-63413744 CACACAGAAGGGCCTTTATGTGG + Intronic
1176859994 21:14006566-14006588 CACACAAACGTGAGACTGTGAGG - Intergenic
1178564787 21:33673389-33673411 CACACACACGTAGCTATGTGAGG + Intronic
1179614811 21:42575571-42575593 CACATAGATGTGCAGCTGTGAGG + Intronic
1180141262 21:45894492-45894514 CACACAGAGGTGCTTCTCAGGGG + Intronic
1180143228 21:45905680-45905702 CACAGAGGGGTGACTCTGTGAGG - Intronic
1180167815 21:46039121-46039143 CGCACTGACCTGGCTCTGTGAGG + Intergenic
1180645134 22:17332601-17332623 CACCCAGTCCCGCCTCTGTGGGG - Intergenic
1182528033 22:30933746-30933768 CACACAGACGTACATCAGTGAGG - Intronic
1183735503 22:39642705-39642727 CACACAGTGGGGCCTCTGTCTGG + Intronic
1184360840 22:44017702-44017724 GACACAGAGATGCATCTGTGGGG - Intronic
1185364401 22:50430303-50430325 CACACAAACGTGAGACTGTGAGG - Intronic
950632107 3:14288997-14289019 CACACCCACGTTCCCCTGTGTGG - Intergenic
950705089 3:14774598-14774620 CACACAGACCTGTCTCTGAAGGG + Intergenic
951309689 3:21109353-21109375 CAAATAGATGTGCCTCTGAGTGG - Intergenic
952429154 3:33204989-33205011 CACACACACGTGTGTGTGTGTGG - Intronic
956164455 3:66385864-66385886 GACACACACATGCTTCTGTGGGG - Intronic
957245968 3:77716570-77716592 CACACAGCAGAGCCACTGTGGGG - Intergenic
962250356 3:133832488-133832510 CACAAAGCAGTGCTTCTGTGTGG + Intronic
962829024 3:139123482-139123504 CACACATTCTTGCCTCTGTTGGG + Intronic
965040726 3:163503142-163503164 CACACACAGGTACCTATGTGAGG + Intergenic
966685770 3:182692883-182692905 CACAAAGAAGTACCCCTGTGAGG - Intergenic
966822005 3:183932450-183932472 CAGTTAGACGTGCCTCTTTGTGG - Intronic
971238405 4:24864788-24864810 CACACATAAGTGGATCTGTGTGG - Intronic
973973284 4:56236552-56236574 CACACAGGTGGGCCACTGTGGGG + Intronic
975007258 4:69305320-69305342 CACACAGCGGTGCCTGTGGGGGG + Intronic
976329001 4:83806212-83806234 CACACACACGTAGCTATGTGAGG + Intergenic
982503084 4:156184006-156184028 CACACACACATCCCTATGTGGGG - Intergenic
985419677 4:189772153-189772175 CTCACACAGGTGCATCTGTGTGG - Intergenic
985513184 5:323241-323263 CCCACAGAAATGCCCCTGTGAGG - Intronic
985780816 5:1869859-1869881 CAAACAGATGTGCATATGTGTGG + Intergenic
986181208 5:5394622-5394644 GGCACAGACCTGCTTCTGTGGGG - Intergenic
986269667 5:6219760-6219782 CACAAAGATGTTCCTCTATGTGG + Intergenic
987706915 5:21469886-21469908 GGCACAGACCTGCTTCTGTGGGG + Intergenic
988868960 5:35367036-35367058 CAAAGAGATGTGCCTATGTGTGG + Intergenic
989256494 5:39371290-39371312 CACACAGTCGTGTCTTGGTGAGG + Intronic
994457168 5:100025669-100025691 CACACACACATGCCTATGAGGGG - Intergenic
997729942 5:136162298-136162320 CACACAGACGTGGCCCTGGCTGG + Intronic
999836711 5:155381529-155381551 CACACAGCCTTGGCTCTGTCTGG + Intergenic
1006598883 6:35213051-35213073 CACATAGACATGATTCTGTGGGG + Intergenic
1009021309 6:57950613-57950635 GGCACAGACCTGCTTCTGTGAGG - Intergenic
1011648518 6:89483480-89483502 CACAAAGCCCTGGCTCTGTGAGG + Intronic
1012984997 6:105866204-105866226 CACACTCAAGTACCTCTGTGCGG + Intergenic
1017998829 6:159560294-159560316 CACACAGCAGTGTCTGTGTGGGG + Intergenic
1019595455 7:1856377-1856399 CCCACAGGCCAGCCTCTGTGGGG + Intronic
1019927055 7:4200156-4200178 CACCCAGACCTGGCTCTGGGTGG - Intronic
1020274679 7:6616882-6616904 CCCACAGTTGTGTCTCTGTGGGG + Intronic
1020937286 7:14483527-14483549 CACACAGACATGAATCTTTGGGG + Intronic
1024291366 7:47806986-47807008 CACACAGACGGGACTCTGTCGGG + Intronic
1027343809 7:77237277-77237299 CACTCAGAGGCTCCTCTGTGAGG - Intronic
1027343810 7:77237278-77237300 CTCACAGAGGAGCCTCTGAGTGG + Intronic
1029208134 7:98881727-98881749 CACACACACGTGCCTCTTTGGGG - Intronic
1029642778 7:101831690-101831712 AAGACAGAAGTGACTCTGTGGGG - Intronic
1030390742 7:108925197-108925219 CACACACTGGAGCCTCTGTGGGG - Intergenic
1032256092 7:130298096-130298118 CACCCAAACGAGCCTCTGTGTGG + Intronic
1034824821 7:154252200-154252222 CACACACACGTGACATTGTGAGG - Intronic
1035051378 7:156000871-156000893 CTCACAGACGTGATGCTGTGTGG + Intergenic
1035231304 7:157467650-157467672 CACCTAGACTTGCCGCTGTGTGG + Intergenic
1035813661 8:2515103-2515125 CACACAGATGCGCGTCTGTTTGG - Intergenic
1040885191 8:52255167-52255189 CACACAGAATGGTCTCTGTGCGG + Intronic
1041292647 8:56321342-56321364 CACACAGCAGTGTCGCTGTGTGG - Intergenic
1047653978 8:126955424-126955446 CACACACACGGGCCTCTCGGGGG + Intergenic
1048316095 8:133363412-133363434 AACACAGTGCTGCCTCTGTGAGG + Intergenic
1050094863 9:2053543-2053565 CACACAGACACGCCTCTGTAAGG - Intronic
1052023624 9:23551684-23551706 CACACAGTCATGCCTTTGTCTGG - Intergenic
1054826519 9:69579104-69579126 CAAGCAGAGGTGCCTCAGTGAGG - Intronic
1060748702 9:126154798-126154820 CACACAGACATGCCTCTGCCAGG - Intergenic
1062083898 9:134638696-134638718 CAGCCAGACGTGACTCTGGGAGG + Intergenic
1062656644 9:137607095-137607117 CATTCAGACCAGCCTCTGTGAGG - Intronic
1062736029 9:138137868-138137890 CACACAGAAGTGCATCTGGCAGG + Intergenic
1185800666 X:3007633-3007655 CACAGGGTCGTCCCTCTGTGTGG + Intronic
1186009296 X:5111360-5111382 CACAGGGTCGTCCCTCTGTGTGG + Intergenic
1186016797 X:5204755-5204777 CACACACACGTAATTCTGTGAGG - Intergenic
1187247820 X:17568825-17568847 CACACACTGGGGCCTCTGTGGGG - Intronic
1188214744 X:27462666-27462688 CAAACAGACATGCCTCGTTGAGG + Intergenic
1188297087 X:28462681-28462703 CACACACTGGTGCCTCTATGGGG + Intergenic
1189324010 X:40102314-40102336 CACCCACACGTGCCTGTGTTCGG - Intronic
1192465195 X:71350027-71350049 CACTCAGAATTGGCTCTGTGTGG + Intergenic
1192473094 X:71416462-71416484 CACTCAGAATTGGCTCTGTGTGG - Intronic
1197306466 X:124848174-124848196 CACACATACCTGCATGTGTGGGG - Intronic