ID: 1128099306

View in Genome Browser
Species Human (GRCh38)
Location 15:64985380-64985402
Sequence CATTCTAAGGAGAATGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128099306 Original CRISPR CATTCTAAGGAGAATGAAGG GGG Intronic
901748822 1:11393293-11393315 CATTCTAAACAGCAGGAAGGAGG - Intergenic
901754047 1:11430202-11430224 CATTCTAATGAGGATGAAAAGGG + Intergenic
904615962 1:31750008-31750030 CATTCTAGGGATAATGAAAAGGG - Intronic
904755459 1:32766288-32766310 AATTCCTAGGAGAAGGAAGGAGG - Intronic
905045658 1:34998419-34998441 CATTCTGAAAAGAATAAAGGAGG - Intronic
905308735 1:37035313-37035335 CTTTCTCAGGAGAATGAGGGAGG - Intergenic
905329569 1:37183706-37183728 AATTCAAGGGAGAAAGAAGGAGG + Intergenic
905909843 1:41646240-41646262 CAGCCTATGGAGAAGGAAGGAGG + Intronic
906863482 1:49389162-49389184 CATTCTTAGCTGAAGGAAGGAGG - Intronic
906924296 1:50098170-50098192 CATTTTATGGATAATGAAGTGGG + Intronic
907758583 1:57335481-57335503 GAATCTAAGGACAATGAAAGGGG - Intronic
908807555 1:67946808-67946830 CATTTTGAAGACAATGAAGGAGG - Intergenic
908814086 1:68013815-68013837 CAGTCAAAAGAGAGTGAAGGGGG - Intergenic
908872790 1:68633711-68633733 CATTCTAAGTGGACTGAATGGGG + Intergenic
910767269 1:90794232-90794254 CATCCTAAGGAGAGTGTAAGGGG + Intergenic
910862944 1:91760893-91760915 CACACTATGGAGAATGAAGGAGG + Intronic
912623017 1:111184362-111184384 CATATTAAGGAGAATGGGGGTGG + Exonic
913579794 1:120214755-120214777 CATTCTTAGGAGATAGAGGGAGG - Intergenic
913628380 1:120683633-120683655 CATTCTTAGGAGATAGAGGGAGG + Intergenic
914561727 1:148826181-148826203 CATTCTTAGGAGATAGAGGGAGG - Intronic
914611105 1:149304026-149304048 CATTCTTAGGAGATAGAGGGAGG + Intergenic
916216856 1:162403056-162403078 CATTCTAACGGGCATGATGGTGG - Intronic
916466803 1:165081129-165081151 CATTCTAGAGAGTATGAAGGAGG - Intergenic
917160458 1:172051583-172051605 AAATCTAAAGAGGATGAAGGGGG - Intronic
917255349 1:173110006-173110028 CCTACTAAGGAGGAAGAAGGAGG + Intergenic
917869783 1:179230568-179230590 CAGTCTAAAGAGAGTGAATGAGG + Intergenic
918132427 1:181641449-181641471 CATTCCAAGGAGAGAGAAAGAGG - Intronic
921550654 1:216531740-216531762 CATTCAAAGTAGAATGGAGAAGG + Intronic
922658310 1:227405691-227405713 AATTCTATGAAGAATGATGGTGG - Intergenic
924882683 1:248180014-248180036 GATTCCAAGGAGGATGAAGTCGG - Exonic
1063658740 10:8017926-8017948 CATTGAAAGGAGAACAAAGGCGG - Intergenic
1064244909 10:13660503-13660525 CCTTGTGAGGAGAATGTAGGGGG + Exonic
1064870992 10:19936753-19936775 CATTCTAAGGCAAATGATCGTGG - Intronic
1065097489 10:22296156-22296178 CATTCTAAGGACTCTGAATGTGG - Intergenic
1065873235 10:29974116-29974138 CTTACTAAGCAGAATGAAAGAGG + Intergenic
1068362191 10:55991464-55991486 AATTCAAAGGGGAATGGAGGTGG - Intergenic
1068859049 10:61828465-61828487 CATGTTATTGAGAATGAAGGAGG - Intergenic
1069068501 10:63970937-63970959 CACTCTAAAGATAATGAAGATGG + Intergenic
1070310056 10:75266432-75266454 CATTCAAAGGTGAAAGAGGGAGG - Intergenic
1070420227 10:76229086-76229108 AATTCTAAGGAGAATGGAGCTGG + Intronic
1070837364 10:79457866-79457888 CATTCTAGGGGGAATGGAGATGG + Intergenic
1071202627 10:83237112-83237134 CGTTTTGAGGAGAATAAAGGCGG + Intergenic
1073772707 10:106752762-106752784 AATGCTAAGGAGAATGGGGGAGG + Intronic
1074269537 10:111940006-111940028 CATTTTATAGATAATGAAGGAGG - Intergenic
1074837974 10:117317035-117317057 CATGCTAACGAAGATGAAGGAGG + Intronic
1074960200 10:118437660-118437682 CATTTCAAGGAGAAAGAATGTGG - Intergenic
1075639770 10:124056346-124056368 CATTCAAAGGAGATTGAAGGAGG - Intronic
1079758427 11:24296763-24296785 CATTCTACGAAGACTGAAAGAGG - Intergenic
1079791289 11:24743214-24743236 AATTCTGAGAAGAATGATGGTGG + Intronic
1080593401 11:33744465-33744487 CATTCCAAGGAGAAAGAAAAAGG + Intronic
1082150850 11:48736871-48736893 CATTCAAAGCAGAATGTAGAGGG + Intergenic
1082771580 11:57211632-57211654 CATTCCCAGGAGAAAGAAGGAGG - Intergenic
1083354152 11:62053192-62053214 CATTCTAATGATAAGGCAGGGGG + Intergenic
1083867471 11:65464596-65464618 CATTTTTAAGAGAATGAAGACGG + Intergenic
1084394006 11:68897033-68897055 CATTCTCATGAGAATGAACCAGG - Intronic
1085094149 11:73745393-73745415 CATTCTTAGAAAAATGAAAGTGG + Intronic
1087157790 11:94921848-94921870 CATTATAAGGAGAAGGCAGGAGG - Intergenic
1088665232 11:112087233-112087255 CATTCTAGGGACAGTGAACGGGG - Intronic
1089083931 11:115800844-115800866 CATTCACAGGAGAAGGCAGGGGG - Intergenic
1090701491 11:129299868-129299890 CATTCTAAGCAGAAAGAAAAAGG + Intergenic
1091971537 12:4791394-4791416 CATCCTAGTGAGTATGAAGGTGG - Intronic
1093356727 12:18176233-18176255 CAGTCTTAGGAGAGTCAAGGGGG - Intronic
1094702641 12:32885042-32885064 CATTTTAAGGAAAATAAAGTAGG + Intronic
1096125248 12:49114409-49114431 GATACTCAGGAGACTGAAGGAGG + Intergenic
1096585616 12:52617852-52617874 CACCCCAAGGACAATGAAGGCGG + Intronic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1097419988 12:59364927-59364949 TCTTCTAGGGAGAATGAAGGGGG + Intergenic
1098341779 12:69459167-69459189 CATGCTAAAGAAAAAGAAGGAGG - Intergenic
1099215466 12:79847890-79847912 TATTCTAAGGAAAATGAACTGGG - Intronic
1099687253 12:85906395-85906417 CATTCTGTGAAGAATGATGGTGG + Intergenic
1101872253 12:108575659-108575681 AATTCTATGGAGACTGATGGAGG - Intergenic
1103236995 12:119381691-119381713 CATTCTAAGGACGAGGAAGCTGG + Intronic
1103648919 12:122417892-122417914 CATCCTAGGGAGAAGGAAGGAGG - Intronic
1104649607 12:130522240-130522262 AATTCTAATGAGGATGAGGGAGG + Intronic
1105418133 13:20231119-20231141 AATTCTAAGGAGACTGCATGGGG + Intronic
1105814107 13:24017738-24017760 GATTTAAAGGAGAAAGAAGGAGG - Intronic
1105931177 13:25053975-25053997 AATTCTATGAAGAATGATGGTGG - Intergenic
1106842252 13:33696365-33696387 CATTTTAAGGAGAATCAAAGTGG - Intergenic
1108358062 13:49644861-49644883 CATTCTAGGGCCAATGCAGGAGG - Intergenic
1108366298 13:49717816-49717838 CATTATAAGGAGACAGAAGTGGG - Intronic
1108736140 13:53284917-53284939 CATGCTAGGGAGAATGGATGAGG + Intergenic
1109670351 13:65598467-65598489 CAAACTCAGGAGAATGAAGGAGG + Intergenic
1111524002 13:89443752-89443774 CATTCAAAGGTAAAAGAAGGTGG + Intergenic
1113353640 13:109554892-109554914 CAGTCAAAGGAGAAAGAATGAGG + Intergenic
1113632430 13:111897471-111897493 CACTCCCAGGAGAAAGAAGGAGG + Intergenic
1114505088 14:23204748-23204770 AATTCTATGAAGAATGATGGTGG + Intronic
1115130118 14:30044846-30044868 AATTCTATGAAGAATGATGGTGG - Intronic
1115959366 14:38818016-38818038 TCTTCTAAGGAGATTGAAGGAGG - Intergenic
1116226411 14:42159135-42159157 CATTGTAAAAAGAATGAAGGGGG + Intergenic
1116262188 14:42644579-42644601 CATTCTAAATAGCATGAAGACGG + Intergenic
1117111762 14:52464551-52464573 CATTCAAAAGGGAAGGAAGGTGG + Intronic
1118294881 14:64559587-64559609 CATTCTAGGGAGAAGGAACATGG + Intronic
1120345307 14:83281460-83281482 AAGTCTCAGAAGAATGAAGGAGG - Intergenic
1121960910 14:98258565-98258587 CATTCTAAGGTGAGTGAATTGGG - Intergenic
1123818533 15:24003328-24003350 CATTCTACAGAGAAAGCAGGAGG + Intergenic
1124469459 15:29969708-29969730 GCTTCTCAGGAGAATGAGGGGGG + Intergenic
1125402938 15:39323524-39323546 CATTCTCAGGAGAAAGAAAGGGG + Intergenic
1125592610 15:40864244-40864266 AACTCTAAAGAGGATGAAGGTGG + Intergenic
1127203251 15:56682122-56682144 CTTTCTACTGAGAATAAAGGCGG - Intronic
1127475857 15:59332485-59332507 TATTCTAATGAGAATGGACGTGG - Intronic
1128099306 15:64985380-64985402 CATTCTAAGGAGAATGAAGGGGG + Intronic
1130204815 15:81865983-81866005 CATCAACAGGAGAATGAAGGTGG + Intergenic
1130437842 15:83919778-83919800 TTTTCTAAGAAGATTGAAGGGGG + Intronic
1131016999 15:89066248-89066270 CCTTCTGAGGGGTATGAAGGAGG + Intergenic
1131580093 15:93634908-93634930 CATTCCAAGCAGACTGAAGGTGG + Intergenic
1132019833 15:98351256-98351278 CATTCTCAGCATAATAAAGGGGG + Intergenic
1202976746 15_KI270727v1_random:303155-303177 CATTTTTAGAAGAATGTAGGAGG - Intergenic
1133646641 16:7770613-7770635 CATTAGAATTAGAATGAAGGGGG + Intergenic
1133780178 16:8932663-8932685 AGTTCTAAGGAAAATGAATGTGG - Intronic
1135167749 16:20155847-20155869 CAGCCTAGGGAGCATGAAGGAGG + Intergenic
1136420949 16:30132601-30132623 CCTACTCAGGAGACTGAAGGAGG + Intergenic
1137876299 16:51999605-51999627 CATTTCAAGGAGAAGGAAGGGGG - Intergenic
1138902321 16:61287745-61287767 TATTCTAGGGAGTCTGAAGGAGG - Intergenic
1139406268 16:66720558-66720580 CATCCTCATGAGTATGAAGGTGG - Intergenic
1142905343 17:3037375-3037397 CATGCTAAGGAGCAGGAAGCGGG - Exonic
1143403446 17:6660472-6660494 CAGGCTAAGGAGCATGAAGTGGG + Intergenic
1144283210 17:13747190-13747212 TATTCTAAATAGAATAAAGGTGG - Intergenic
1146308219 17:31746852-31746874 CATTCCAAGCAGGAAGAAGGGGG - Intergenic
1146320894 17:31845524-31845546 CATGGAGAGGAGAATGAAGGAGG + Intergenic
1146503949 17:33388454-33388476 CATACCACAGAGAATGAAGGTGG + Intronic
1147796952 17:43050844-43050866 CCTTCTCAAGAGCATGAAGGTGG - Intronic
1148753977 17:49962972-49962994 TTTTCTAAGGAGAATTAATGAGG + Intergenic
1149117284 17:53112579-53112601 CCTTCTTAGGAGATTGGAGGAGG - Intergenic
1149124104 17:53207233-53207255 AATTCTAAGAAGAATGATGGTGG - Intergenic
1149274865 17:55022336-55022358 CATTCTCATGGCAATGAAGGAGG + Intronic
1149855936 17:60082691-60082713 CATTCCAGGCAGAATGAAGTGGG - Intergenic
1150128675 17:62654343-62654365 CATTCCAAGGACAAGGAAGGCGG - Intronic
1151041465 17:70865607-70865629 CATTCTAGGTAGGATGATGGTGG + Intergenic
1151509080 17:74547316-74547338 GATTCTGTGGAGAATGAAAGGGG - Intergenic
1151563965 17:74886847-74886869 CAAACTAAGGAGCAGGAAGGTGG - Intronic
1151566290 17:74900475-74900497 CAGGCTCAAGAGAATGAAGGAGG + Intergenic
1154375384 18:13804799-13804821 CATTGTAAGGAAACTGAATGAGG + Intergenic
1155112477 18:22729677-22729699 TATTCTAGGCAGAAAGAAGGAGG - Intergenic
1156141868 18:34122190-34122212 CATTCCCAGGAAAATGAGGGTGG + Intronic
1156399527 18:36728020-36728042 CATTCTAGGCAGGAAGAAGGGGG + Intronic
1156713790 18:39981739-39981761 CATTCTAAGGTGACTGAATTTGG + Intergenic
1157095924 18:44685359-44685381 CCTCCTTAGGAGAATCAAGGGGG - Intronic
1158002994 18:52640831-52640853 AATTCTATGAAGAATGATGGTGG - Intronic
1159133043 18:64302958-64302980 CATCCTAAGAAGAAGGATGGGGG + Intergenic
1159137008 18:64348293-64348315 CATGCAAAAGAGAATGAAGTCGG + Intergenic
1162708698 19:12575317-12575339 CTTTCTATGTAGAATGAAGCTGG - Intronic
1164420817 19:28090617-28090639 CATTCAAAGCAGAATGTAGAGGG + Intergenic
1164430151 19:28180442-28180464 CATTCAAAGCAGAATGTAGAGGG + Intergenic
1166895836 19:46021568-46021590 CATTCTAAGGAGGAGGTAGCTGG + Intronic
1166920413 19:46225411-46225433 TGTTCTGAGGAGAAGGAAGGAGG - Intergenic
1167722135 19:51186141-51186163 GATTCTAAGGGGAGTGAGGGCGG - Intergenic
925501085 2:4505632-4505654 CATTTTAAGCAGAAAGAAGGTGG - Intergenic
928113498 2:28528476-28528498 CACTCTCAGGAGAAGGGAGGGGG + Intronic
930189580 2:48443559-48443581 GATGCTAAGGAGACTGTAGGAGG + Intronic
930672319 2:54164152-54164174 CATTCAGAGGAGAGGGAAGGTGG + Intronic
931019990 2:58033343-58033365 CTTTCTAAGAAGGAAGAAGGAGG + Exonic
931063085 2:58553356-58553378 CCTTCTAAAGAGAATGTGGGAGG - Intergenic
931080239 2:58761060-58761082 CATTTTCAGTAGGATGAAGGGGG - Intergenic
931450894 2:62366786-62366808 TATTCTATGGAGAAGGCAGGGGG - Intergenic
933194205 2:79370430-79370452 GACTCTAAAGAAAATGAAGGAGG - Intronic
933258362 2:80105984-80106006 CAGTCCAATGACAATGAAGGAGG + Intronic
933592115 2:84244577-84244599 CCTTCTGATGAGAATGAATGAGG - Intergenic
933695907 2:85217001-85217023 CGTTCTAGGGACAATGAATGGGG - Intronic
935110413 2:100088895-100088917 TATTCTAATGAAAATGAAGAAGG - Intronic
936124562 2:109776309-109776331 TATTCTAATGAAAATGAAGAAGG + Intergenic
936220126 2:110595147-110595169 TATTCTAATGAAAATGAAGAAGG - Intergenic
936574767 2:113643896-113643918 CATTCTCAGAAGAGTGAGGGGGG + Intergenic
938663011 2:133506519-133506541 CAGTGTGAGGAGAATGAAGTGGG + Intronic
939223706 2:139337932-139337954 CTATCTCAGGAGAAGGAAGGTGG + Intergenic
939715463 2:145578529-145578551 CATTCTAGGTAGAAGGAATGAGG + Intergenic
941627814 2:167849196-167849218 AATTCTATGAAGAATGATGGTGG - Intergenic
942069802 2:172305900-172305922 CATTCTAGGCAAAAAGAAGGGGG + Intergenic
942768027 2:179480360-179480382 AAATGTAAGGAGAAAGAAGGTGG - Intronic
943538357 2:189180879-189180901 GATTCTAGGGAGACTCAAGGTGG - Intergenic
945443340 2:209906651-209906673 AATTCTGAGGGGAATGAAGGTGG + Intronic
945556955 2:211288679-211288701 ACTTCTCAGGAGAATGAATGGGG + Intergenic
945818222 2:214631668-214631690 CATCCTATGCAGAATGCAGGGGG - Intergenic
946980160 2:225204417-225204439 CATTAAAGGGAGAAGGAAGGAGG - Intergenic
948004384 2:234595323-234595345 CATCCTGAGAAGCATGAAGGAGG + Intergenic
1168850800 20:975574-975596 CATTTTATGGAGAATGAGAGTGG + Intronic
1169473367 20:5908092-5908114 CATCCTAAGGAAAAACAAGGTGG + Intergenic
1172783260 20:37449864-37449886 CATGCAACAGAGAATGAAGGTGG - Intergenic
1173340706 20:42150305-42150327 CAAGCAAAGGAGAGTGAAGGGGG - Intronic
1174211278 20:48880463-48880485 CATTCTAAGGATAGTGAGGCAGG - Intergenic
1174602707 20:51737940-51737962 GATTCTTAGGAGACTGAAGTGGG + Intronic
1175053421 20:56176101-56176123 CATTTTAAGGAGAAAGAAACAGG + Intergenic
1175433176 20:58921671-58921693 CATGCAGAGGAGAGTGAAGGAGG + Intergenic
1176423162 21:6532483-6532505 CATTCTAGGGAGCATTGAGGAGG - Intergenic
1177038145 21:16071034-16071056 CATCCTAAGGAGGATTAAGAAGG - Intergenic
1178183104 21:30187003-30187025 CATTGTTTGCAGAATGAAGGCGG + Intergenic
1178185155 21:30209902-30209924 CCTTCTCAGGACAAGGAAGGAGG + Intergenic
1179698655 21:43140799-43140821 CATTCTAGGGAGCATTGAGGAGG - Intergenic
1180737858 22:18031998-18032020 CATTTTTAGGAAAATGAAGAAGG - Intergenic
1184449405 22:44574207-44574229 GTTTCTAAGGAGAGGGAAGGAGG - Intergenic
1184940512 22:47761403-47761425 CACTCTTAGGTGAAAGAAGGGGG + Intergenic
1185425406 22:50766980-50767002 CATTCTCAGAAGAGTGAGGGGGG - Intergenic
950961361 3:17111364-17111386 CATTTTAAGGATAATGCATGTGG - Intergenic
951019787 3:17770043-17770065 AATTTTTAGGAGAATGAAGATGG + Intronic
952604398 3:35126789-35126811 CTCTCTGAGGATAATGAAGGGGG + Intergenic
953188063 3:40656507-40656529 ATTTGAAAGGAGAATGAAGGAGG - Intergenic
953199282 3:40764101-40764123 CATTCAAAGAAGCAAGAAGGAGG - Intergenic
953829009 3:46279135-46279157 CAATCTAAAGAGGATGAAGAAGG + Intergenic
956626675 3:71273539-71273561 CATTCAAGGAAGACTGAAGGGGG - Intronic
956884754 3:73547860-73547882 GGTTCTAAGAAGAATGAAGCGGG + Intronic
958176205 3:89998949-89998971 CATTCAAAGGAGTATGTAGAGGG + Intergenic
958577966 3:95976583-95976605 CATTCTGTGAAGAATGACGGTGG - Intergenic
959274951 3:104266805-104266827 AATTCTATGAAGAATGATGGTGG + Intergenic
959456972 3:106574614-106574636 TATTCTAAGGAAAATAAAAGAGG - Intergenic
959866375 3:111275055-111275077 GATTCAAAGGAGAATGCAGAGGG + Intronic
960593997 3:119391659-119391681 AATTCTAAGCAGATTGTAGGTGG + Intronic
960797997 3:121508765-121508787 AATTCTCATTAGAATGAAGGGGG - Intronic
963596892 3:147339392-147339414 CATTTTTAGGAGAGAGAAGGGGG + Intergenic
964017731 3:151967712-151967734 CAATCTAAGGAGAATGGAACTGG + Intergenic
965374036 3:167899297-167899319 CTTTGTAAGGCGAGTGAAGGAGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966686632 3:182703012-182703034 AATTCTGTGGAGAATGATGGTGG + Intergenic
968162851 3:196441114-196441136 GCTTTTAAGGAGAAAGAAGGAGG + Intergenic
969920981 4:10539516-10539538 CATTCTATGCAGAAACAAGGAGG + Intronic
970586290 4:17517605-17517627 CCTTCTAAGAAGGAAGAAGGAGG - Intronic
972180620 4:36460457-36460479 CCTTCTAAGAAGAAAGCAGGAGG - Intergenic
973179215 4:47247545-47247567 AATTCTATGAAGAATGATGGTGG + Intronic
973632143 4:52829614-52829636 CATTCCAGGCAGCATGAAGGAGG - Intergenic
974327743 4:60436999-60437021 CATTCTGTGAAGAATGATGGTGG - Intergenic
975801904 4:78068818-78068840 CATTTTAAGGACAATGAAACTGG + Intronic
976464364 4:85350933-85350955 CATTCTGTGAAGAATGATGGTGG + Intergenic
976633984 4:87268952-87268974 TATTCTGAGAAGAATGATGGTGG - Intergenic
977077155 4:92469285-92469307 CAATCCAATGAGAATGAAGAAGG + Intronic
978137242 4:105276742-105276764 CATTCTATGCAAAAAGAAGGTGG + Exonic
979607947 4:122658717-122658739 CATTCCAAGGAAAAAGAAAGAGG + Intergenic
979691180 4:123560252-123560274 CATTCTAAGGAAAAGCAAGGAGG - Intergenic
980729485 4:136808784-136808806 CAATGTAAGGAGAATAGAGGAGG + Intergenic
981114916 4:140978378-140978400 CATTCTAAGGAAAATAAAATTGG - Intronic
981549590 4:145930294-145930316 CCTTCAAAGGAGACTGAAGAAGG - Intronic
983685439 4:170402813-170402835 AATTCTATGAAGAATGATGGTGG + Intergenic
983729113 4:170971603-170971625 CATTCTAGGGAGATTCACGGAGG + Intergenic
983873625 4:172851051-172851073 CATTCTCTGGAGAAGGAAGGGGG - Intronic
984482873 4:180328271-180328293 CATTCCAAGAAAAATGAAGGGGG - Intergenic
985285690 4:188334492-188334514 CATTCCAAGGAGAAAGTAGGAGG - Intergenic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
987006185 5:13711979-13712001 CATTCTTTGAAGAATGATGGTGG - Intronic
987576033 5:19730023-19730045 CATCCAAAGCAGAAAGAAGGTGG - Intronic
987902436 5:24030217-24030239 AATTCTGTGAAGAATGAAGGTGG + Intronic
988806728 5:34747133-34747155 AATTCAAAGGAAAATGAAGGAGG - Intronic
991923629 5:71682540-71682562 CATTTTCAGGAAAATGAAAGTGG - Intergenic
992363556 5:76068691-76068713 CATTCCAAGAAGAATGAAAGAGG + Intergenic
993631431 5:90290716-90290738 CATTACAAGCATAATGAAGGAGG + Intergenic
994192272 5:96881748-96881770 CATTCTAGGCAGGAAGAAGGGGG + Intronic
994883358 5:105526963-105526985 AATTCTATGAAGAATGATGGTGG + Intergenic
994968366 5:106703024-106703046 AATTCTAAGGAACAGGAAGGAGG - Intergenic
995443050 5:112212856-112212878 CAGTCTAAAGAGAATGAGGGTGG - Intronic
995633537 5:114160155-114160177 CATTCTAAGCAGTATGTAGAGGG - Intergenic
996214898 5:120854525-120854547 TATTCTAAAGAAAATGAGGGAGG - Intergenic
996731870 5:126724742-126724764 CATTCTCAGGAGAATGGACCAGG - Intergenic
997797981 5:136830012-136830034 CATTCTGTGAAGAATGATGGTGG + Intergenic
998027568 5:138831964-138831986 CATTCTACAGTGGATGAAGGAGG + Intronic
999069525 5:148729270-148729292 AATTCTCAGGAGTAAGAAGGAGG - Intergenic
999721878 5:154404480-154404502 CATTGCCAGGAGAATTAAGGAGG + Intronic
999909981 5:156187209-156187231 CATTCTAGGGTGACTGAAGATGG + Intronic
1001694960 5:173663192-173663214 CTTTTTCAGGAGAAGGAAGGGGG + Intergenic
1002405739 5:179028793-179028815 AATTCACAGGAGAATGAATGCGG - Intronic
1004282599 6:14293589-14293611 CCTTCTAGGGAAAGTGAAGGGGG + Intergenic
1007954350 6:45902650-45902672 CTTTCTAAGAAGGATGAAGATGG + Exonic
1012794183 6:103738854-103738876 AATTCTATGAAGAATGATGGTGG - Intergenic
1013142976 6:107358539-107358561 CATTCTATGGAGAATAAAGATGG + Intronic
1014730278 6:125024280-125024302 CATGATAAGGAACATGAAGGAGG + Intronic
1015222520 6:130820878-130820900 AATTCTATGAAGAATGATGGTGG - Intergenic
1017064978 6:150520084-150520106 CACTCTAAGCAGGAGGAAGGAGG + Intergenic
1017389082 6:153918862-153918884 CATTCTAATTAGAAAGAGGGGGG - Intergenic
1019831366 7:3334332-3334354 CCATCTAATGAGAATGAAAGAGG - Intronic
1019862603 7:3674304-3674326 CATGGTAATGAGAAGGAAGGAGG + Intronic
1020854514 7:13400874-13400896 CATTCAAATCAGAATGAAGCAGG + Intergenic
1023117104 7:36873307-36873329 CACTCTAAGGAGGCTGCAGGGGG + Intronic
1023665132 7:42514959-42514981 TCTCCTAAGGAGATTGAAGGTGG - Intergenic
1023682196 7:42698780-42698802 CATTCAAAGTAGAATGATGCTGG - Intergenic
1023734624 7:43223919-43223941 CAATCAAAGGAGAGAGAAGGTGG - Intronic
1025969323 7:66307416-66307438 CATTTTAAAGTGAATGAAGTGGG - Intronic
1027472825 7:78594137-78594159 CATTCTGAGGAGTATCAAAGAGG - Intronic
1028055889 7:86242495-86242517 AATTCAAAGGGGAATGAAGCAGG + Intergenic
1028409972 7:90519848-90519870 CAAACAAAGAAGAATGAAGGAGG - Intronic
1029042160 7:97587495-97587517 CATTCCAAGGAGAATCATGTGGG - Intergenic
1031562985 7:123260623-123260645 CCTTCTAAGGACAAGGAAGGAGG - Intergenic
1031596910 7:123659261-123659283 GATTCTTTGGAGAATGGAGGTGG - Intronic
1033143380 7:138848433-138848455 CACTTTAAGGAGAATAAAGGAGG - Intronic
1033156628 7:138962507-138962529 GCTTCTAAGGGGAATGAAGCAGG - Intronic
1033472945 7:141665442-141665464 CGTTCTGAGGAGACTGGAGGTGG + Intronic
1036033594 8:4996037-4996059 CAATCTAAGAAAATTGAAGGAGG - Intergenic
1039039622 8:33395095-33395117 CACTGTAAGAAGACTGAAGGTGG + Intronic
1040394595 8:46984967-46984989 CCTTCTAAGTAAAATGAAGGTGG + Intergenic
1040494633 8:47955637-47955659 AGTTGTGAGGAGAATGAAGGAGG - Intronic
1042890973 8:73609673-73609695 AATTATAAGGGGAATGAAGAGGG + Intronic
1043471421 8:80566517-80566539 GATTCTTAGGAGAATAAAGAGGG + Intergenic
1043617776 8:82148208-82148230 CAATCTAAACAGATTGAAGGAGG - Intergenic
1043871379 8:85437785-85437807 CATGCAAAGGAGAATAAAAGTGG - Intronic
1045633844 8:104159614-104159636 CATTCTAATGAGTATGAGGGTGG + Intronic
1046748973 8:117906787-117906809 TATTTTAAGGAGAATGATGGTGG + Intronic
1048653950 8:136514497-136514519 AATTCTATTGACAATGAAGGAGG + Intergenic
1048727761 8:137406476-137406498 CATCATAAGGTTAATGAAGGTGG - Intergenic
1049032111 8:140045699-140045721 CATCCTAAGGAAGATGACGGTGG + Intronic
1051325576 9:15963988-15964010 CATTCTAGCGAGAAGAAAGGAGG - Intronic
1051740230 9:20244335-20244357 CATTGTAAAGAGCAGGAAGGAGG + Intergenic
1052003833 9:23322406-23322428 CATTCTATGGAGGATGAAGCAGG - Intergenic
1056638046 9:88347641-88347663 CATACAAAGGAGAAATAAGGAGG + Intergenic
1058606162 9:106725886-106725908 CTTTTTTAAGAGAATGAAGGAGG + Intergenic
1058678784 9:107423772-107423794 CATTCTAAGGACGAAGAAAGTGG + Intergenic
1061552793 9:131347748-131347770 CATTTGAAGGTGAGTGAAGGAGG + Intergenic
1186165095 X:6819538-6819560 CATTCTATGGAGATAAAAGGGGG - Intergenic
1188569226 X:31561944-31561966 TTTTCAAAGGAGAATGAAAGAGG - Intronic
1188630412 X:32350885-32350907 TATTCTAAGGTCATTGAAGGAGG - Intronic
1189125588 X:38442666-38442688 CATTGAAAGTGGAATGAAGGAGG + Intronic
1190641601 X:52485720-52485742 CATCCCAAGAAGACTGAAGGGGG - Intergenic
1190646071 X:52527145-52527167 CATCCCAAGAAGACTGAAGGGGG + Intergenic
1191847663 X:65560509-65560531 AGTTCTAAAGAGAATTAAGGAGG - Intergenic
1192030142 X:67501992-67502014 CAGACTAAGGAGAAAGAATGAGG + Intergenic
1194302103 X:92201365-92201387 CCTTCTAAAGCCAATGAAGGAGG + Exonic
1194937853 X:99972533-99972555 TATTCTAAGCAGAAGGACGGAGG - Intergenic
1195148480 X:102042686-102042708 CTTTCTAAGGAGTATGTATGGGG - Intergenic
1195814946 X:108874647-108874669 CTTTCTAAGGAGACAGGAGGAGG - Intergenic
1196195446 X:112834191-112834213 AATTGAAAGGAGAATGACGGTGG - Intronic
1196948480 X:120851887-120851909 CATTCTAAGGAAAAGGAAACAGG + Intergenic
1197169698 X:123418199-123418221 CATTGAAAGGAGAAGGTAGGAGG - Intronic
1198701772 X:139404817-139404839 CATTCTACAGAGAAGGAAAGAGG + Intergenic
1198997411 X:142589666-142589688 CATTGAAAGGAGAATGCAAGTGG + Intergenic
1199385672 X:147220402-147220424 CCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199969706 X:152850564-152850586 CATTCTAAGCAGTAAGAATGTGG - Intronic
1201316140 Y:12647997-12648019 AATTCTGAGAAGAATGATGGTGG - Intergenic
1202099826 Y:21295451-21295473 CAATCTAAGCAGAATGCAGTTGG - Intergenic