ID: 1128103941

View in Genome Browser
Species Human (GRCh38)
Location 15:65029348-65029370
Sequence GAAGGCCTCCAGGCCGCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 163}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128103941_1128103946 -6 Left 1128103941 15:65029348-65029370 CCGGGCGCGGCCTGGAGGCCTTC 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1128103946 15:65029365-65029387 GCCTTCAGCGGCCGGGTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 132
1128103941_1128103951 8 Left 1128103941 15:65029348-65029370 CCGGGCGCGGCCTGGAGGCCTTC 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1128103951 15:65029379-65029401 GGTCCCCGGATCCCTGGCCCGGG 0: 1
1: 0
2: 0
3: 29
4: 269
1128103941_1128103956 18 Left 1128103941 15:65029348-65029370 CCGGGCGCGGCCTGGAGGCCTTC 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1128103956 15:65029389-65029411 TCCCTGGCCCGGGTACCTGGCGG 0: 1
1: 0
2: 2
3: 14
4: 166
1128103941_1128103948 2 Left 1128103941 15:65029348-65029370 CCGGGCGCGGCCTGGAGGCCTTC 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1128103948 15:65029373-65029395 CGGCCGGGTCCCCGGATCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 158
1128103941_1128103950 7 Left 1128103941 15:65029348-65029370 CCGGGCGCGGCCTGGAGGCCTTC 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1128103950 15:65029378-65029400 GGGTCCCCGGATCCCTGGCCCGG 0: 1
1: 0
2: 3
3: 29
4: 275
1128103941_1128103955 15 Left 1128103941 15:65029348-65029370 CCGGGCGCGGCCTGGAGGCCTTC 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1128103955 15:65029386-65029408 GGATCCCTGGCCCGGGTACCTGG 0: 1
1: 0
2: 1
3: 18
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128103941 Original CRISPR GAAGGCCTCCAGGCCGCGCC CGG (reversed) Intronic
900206459 1:1433858-1433880 GAGGGACTCCAGGCAGAGCCGGG + Intergenic
901871179 1:12140189-12140211 CAAGGCCTGCAGGCCATGCCAGG - Intronic
904466732 1:30712493-30712515 GAAGGGCTCCAGCCTGGGCCTGG - Exonic
910137573 1:83990463-83990485 AAAGGCATCCAGGCCGGGCGCGG - Intronic
912487749 1:110042369-110042391 GAAGGCCTCCTGGCATGGCCTGG - Intronic
917414086 1:174790331-174790353 GAAGGCCTCTGGGCCGGGCACGG + Intronic
1077076143 11:703092-703114 GACGGCCTCCAGGCCGTGAAGGG - Exonic
1077108868 11:853417-853439 GTAGGCCCCCAGGCTGCCCCAGG - Intronic
1077144516 11:1038736-1038758 GAAGCCCTACAGGCCTGGCCGGG - Intergenic
1077474572 11:2780270-2780292 CAAGCCCTCCAGGCCCAGCCAGG - Intronic
1079077151 11:17391025-17391047 TAAGGCCTCAAGGCTGCACCAGG - Intergenic
1082795721 11:57376598-57376620 GGAGGCCTTCCGGCCGCCCCAGG + Intergenic
1083141977 11:60729636-60729658 GAAGGTCTCCAGGCCATGTCTGG - Exonic
1084470530 11:69356679-69356701 GAAGACCTCCATGCTGGGCCAGG + Intronic
1085454870 11:76660117-76660139 GGAGGCCTCCAGGCCTCCCAAGG + Exonic
1088462231 11:110093503-110093525 GAGGGCCGCGGGGCCGCGCCCGG + Intronic
1089256266 11:117195920-117195942 GCGGGCCTCCCGGCCGAGCCGGG + Intronic
1090287429 11:125512045-125512067 GAAGTTCTCCCGGCGGCGCCTGG - Intergenic
1090353117 11:126120480-126120502 GAAGGCCTCCAGGAGGAGACAGG + Intergenic
1091332286 11:134739355-134739377 CAAGGCCGACAGGCCGCTCCCGG + Intergenic
1091558336 12:1592936-1592958 GATGCGCTCCAGGCCGCGCTTGG + Exonic
1095465325 12:42483394-42483416 GAGGGGCTGCAGGCCGCGCTCGG - Intronic
1096078475 12:48818846-48818868 CAAGGACTGCGGGCCGCGCCCGG - Exonic
1096770956 12:53935822-53935844 GAAGGCCGGCGGGGCGCGCCCGG + Intergenic
1100477042 12:94944368-94944390 GAAGGCCTTCTGGCCGGGCGCGG - Intronic
1101746384 12:107544646-107544668 GGAGGCCTCCAGGCAGCCTCCGG - Intronic
1103120493 12:118376250-118376272 GACAGCCGCCAGGCGGCGCCTGG - Intergenic
1103716328 12:122947475-122947497 GACGGCCTCCAGGTGGTGCCGGG - Intronic
1103800511 12:123534171-123534193 GGAGGGGTCCAGGCCGCCCCGGG + Intergenic
1103972048 12:124678590-124678612 GGAGGCCTCAAGGCCACCCCCGG - Intergenic
1104792582 12:131493270-131493292 GGAGGCCTGAAGGCCGTGCCTGG + Intergenic
1112504625 13:99968596-99968618 GAAGGGCCCTAGGCCGCGCGCGG + Intronic
1112656107 13:101453890-101453912 GACAGCCTGCAGGCGGCGCCCGG - Exonic
1113456167 13:110450407-110450429 GAGGGCCTCCAGGACCCCCCGGG + Exonic
1113484602 13:110645110-110645132 GAAGGCAGCCAGGCCGGGCTGGG - Intronic
1115145692 14:30223559-30223581 AAAGGCCTCCAGCCAGCCCCAGG + Intergenic
1119725374 14:76919054-76919076 GAAGGCCTCCAGACCCGGCCTGG + Intergenic
1119767523 14:77199744-77199766 GAAGGAGTCCAGGCCCTGCCCGG - Intronic
1121886381 14:97546705-97546727 GAGGGCCACCAGGCCCCGCCAGG + Intergenic
1122271053 14:100568611-100568633 GAGGGTCTCCAAGCCGCGCGCGG - Intronic
1122975222 14:105168236-105168258 GAAGCCCTCGAGGCTGCGCGCGG - Intronic
1123012500 14:105356171-105356193 GGAGGCCTGCAGGCTGGGCCTGG - Intronic
1123699272 15:22902662-22902684 GGGGGCCTCCAGGCCGGGCTGGG - Intronic
1123709489 15:22976907-22976929 TAAGGTCGCCAGGCCGGGCCCGG + Intronic
1124211781 15:27770256-27770278 GCAGGCCTCCTGGTCGCGCGCGG + Intronic
1124743135 15:32315378-32315400 GGCGGCCTCGGGGCCGCGCCGGG - Intergenic
1125886264 15:43231830-43231852 GAAGACTTCCAGGCCGGGCGCGG - Intergenic
1127053765 15:55111565-55111587 CAAGGCCTCCAGGCCAGGCATGG + Intergenic
1127673884 15:61222133-61222155 GGAGGACTCCAGGCTGCCCCAGG - Intronic
1128103941 15:65029348-65029370 GAAGGCCTCCAGGCCGCGCCCGG - Intronic
1128797929 15:70478593-70478615 GAAGGCCACCAGGCCAGGCAGGG - Intergenic
1131360352 15:91785070-91785092 GAAGGGCTCCAGGGAGGGCCAGG + Intergenic
1131392687 15:92062049-92062071 CAAGGCCTCCAGGAGGGGCCCGG - Intronic
1132715491 16:1288157-1288179 GAAGCCATCCAGGACGCGTCTGG + Intergenic
1139717206 16:68823049-68823071 GCCGGCCTCCAGGCCGGGCTGGG + Intronic
1140409902 16:74735172-74735194 GGAGGCCTCCTGGCCGAGCCTGG - Intronic
1140469606 16:75206781-75206803 GAAGGCCTCAGGGCAGCCCCCGG + Intronic
1143010394 17:3862925-3862947 GAAGGCCCTCAGGCCGGGCACGG - Intronic
1143334095 17:6159486-6159508 GAAGGCCTGAAGGGCTCGCCAGG - Intergenic
1143538668 17:7557163-7557185 GAATTCCTCCAGGCAGCGCAGGG - Exonic
1147720680 17:42537514-42537536 GATGGCCTCCTGGCCGCTCCAGG - Exonic
1148233570 17:45952356-45952378 GGAGGCCTCCAGCCCAGGCCAGG - Intronic
1148341607 17:46876609-46876631 GAAGGCCACCAGGCGGCTCTGGG - Exonic
1148460764 17:47837935-47837957 GAAGGCCTCGAGGCCACACAGGG - Exonic
1149439272 17:56661670-56661692 GAAGGCCACCTGGCCATGCCAGG + Intergenic
1149571391 17:57674979-57675001 GGAAGCCTCCGGGCCGCGCCGGG - Exonic
1150590642 17:66559180-66559202 CAAGCCCTCCAGGCCGGGCACGG + Intronic
1151724064 17:75874653-75874675 GAAGGCCTCCCGGCCCCGCCGGG - Exonic
1152592588 17:81221188-81221210 CAAGGCCTCAAGGCTGCACCGGG + Intronic
1152762004 17:82113631-82113653 GAAGGGCTCCACTCCACGCCAGG + Intronic
1154322198 18:13363408-13363430 GAAGGTCTTCAGGCTGCGCCGGG + Intronic
1158938368 18:62384989-62385011 GAAGGCCTCGAGGCCGGTGCAGG + Exonic
1160658720 19:288239-288261 GGAGGCCTCCAGGCCAAGGCAGG - Intronic
1160715107 19:572902-572924 GGAGCCCGGCAGGCCGCGCCGGG - Intronic
1160845687 19:1165065-1165087 CAAGGCGTCCAGCCCGAGCCAGG + Intronic
1161220362 19:3115595-3115617 CAGGGCCTCCAGGACGGGCCGGG + Intronic
1161404557 19:4084259-4084281 CGGGGCCTCCAGGCCGCACCTGG - Intergenic
1162488043 19:10973858-10973880 GAAAACCTCCAGGCCGGGCGCGG - Intronic
1162816140 19:13195942-13195964 AAGGGCCTCCAGGCCGTCCCTGG + Intergenic
1165830836 19:38729461-38729483 GACGGCCTCCAGGAGGGGCCTGG + Exonic
1166317319 19:41996434-41996456 GAAGGGCTCAAGGCCTCCCCCGG - Intronic
1168056144 19:53866378-53866400 GCAGCCAGCCAGGCCGCGCCCGG + Intronic
926982249 2:18584666-18584688 GAAGTCCTCCAGCCAGCGCAGGG - Exonic
927125968 2:20012619-20012641 GGAGCCCACCATGCCGCGCCCGG - Exonic
927542645 2:23926785-23926807 GACGGAGTCCACGCCGCGCCCGG + Exonic
930849111 2:55939084-55939106 GAGGGCCTCCAGGCCGGGCGCGG + Intergenic
933996701 2:87675495-87675517 TGAGGCCTCCTGGCCGAGCCAGG + Intergenic
935345051 2:102100051-102100073 GAATGCCTCGAGGCCAAGCCAGG - Intronic
935754741 2:106268204-106268226 GAGGACCACCAGGCCGCCCCGGG + Intergenic
936297152 2:111275415-111275437 TGAGGCCTCCTGGCCGAGCCAGG - Intergenic
940857309 2:158739492-158739514 AAAGGCCTCCAGGCCGGGCGCGG - Intergenic
945951705 2:216045006-216045028 AAAGGCCCCCAGGCAGGGCCAGG + Intronic
947625296 2:231614843-231614865 GGAGGTCTCCCGGGCGCGCCGGG - Intergenic
947872915 2:233449709-233449731 GCAGCCCTCCAGCCTGCGCCAGG + Intronic
948342427 2:237265111-237265133 CAAGGCCTCCAGCCCGCTCCTGG + Intergenic
948645293 2:239400614-239400636 CAAGGCCTGCAGGCTGCGCGGGG + Exonic
948921213 2:241066771-241066793 GAAAGCCTCCTGGCCACACCTGG + Intronic
1169657669 20:7942965-7942987 GAAGGCAGCCAGGCCGGGCACGG - Intergenic
1170656001 20:18288451-18288473 GCCGGCCTTCAGGGCGCGCCTGG + Exonic
1171036064 20:21713909-21713931 GGAGGAATCCAGGCCGCTCCAGG + Intronic
1172039126 20:32031406-32031428 GAAGACCCCCCGGCCCCGCCAGG - Exonic
1173699637 20:45057043-45057065 AAAGGCCTCCTGGCCCAGCCAGG - Intronic
1175931716 20:62496658-62496680 GAGGGTCTCCAGGAGGCGCCGGG + Intergenic
1175954766 20:62603637-62603659 GAAGGCCTGGAGCCCGTGCCTGG + Intergenic
1178486586 21:33023325-33023347 GGACGCCTCCAGGACGCACCAGG + Intergenic
1179117788 21:38509916-38509938 TAAGGCTTCCAGGACGCCCCAGG + Intronic
1179148136 21:38787293-38787315 GAAGGCCAACAGGCTGCTCCTGG - Intergenic
1179512025 21:41879419-41879441 GCAGGACCCCCGGCCGCGCCAGG - Exonic
1180196179 21:46195705-46195727 GAAGGCCTCCAGGCCAAACCAGG + Exonic
1180597515 22:16988363-16988385 TGAGGCCTCCAGGCTGCTCCAGG - Intronic
1180791419 22:18577506-18577528 AAAGCCCACCGGGCCGCGCCAGG - Intergenic
1181230320 22:21417805-21417827 AAAGCCCACCGGGCCGCGCCAGG + Intronic
1181248330 22:21517058-21517080 AAAGCCCACCGGGCCGCGCCAGG - Intergenic
1181478160 22:23181074-23181096 CAAGGCCTCCATTCGGCGCCTGG + Exonic
1182740387 22:32563204-32563226 GAAGTTCTCCAGGCAGGGCCTGG + Intronic
1183543416 22:38443022-38443044 GAAGGGCTGCAGGCCGGGCACGG - Intronic
1184592504 22:45494489-45494511 GAAGGCTTCCTGGCCGGGCACGG - Intergenic
1185387816 22:50544363-50544385 GAGCGCCCCCGGGCCGCGCCTGG - Intergenic
953491875 3:43359710-43359732 GAAGGTGTCCAGGCAGAGCCAGG - Intronic
956601949 3:71032135-71032157 GAAGGCATCGGGGCTGCGCCGGG - Intronic
961551829 3:127673836-127673858 GGAGGCCTCCAGGCTGCACCTGG - Intronic
962049866 3:131801836-131801858 CAATGCCTCCAAGCCGCGCTAGG + Intronic
962848534 3:139290615-139290637 GAAAGCCTCCTGGCAGCGGCAGG - Intronic
962941731 3:140130718-140130740 GAAGGCCTCCAGGACCCTTCAGG - Intronic
966808920 3:183826525-183826547 GAAGGTATCCAGTCTGCGCCTGG + Intergenic
968604382 4:1525255-1525277 GAAGGCCTCCTGCCTGCCCCCGG + Intergenic
968764849 4:2462901-2462923 GGCGGCCTCCAGGCGGCGCGCGG - Exonic
969694885 4:8728864-8728886 GAAGACCACCAGGCCAGGCCAGG - Intergenic
973197613 4:47463495-47463517 GAAGGCGTCCGGGTCGCACCCGG + Intronic
984531257 4:180918907-180918929 GAAAGCCTACAGGCCGGGCGCGG - Intergenic
989568508 5:42924480-42924502 GGAAGCCTCCAGGCTGAGCCCGG - Intergenic
994177556 5:96728279-96728301 GAAGGCCTCCTGGTGGCCCCTGG + Intronic
995658798 5:114457758-114457780 GGAGACCTCCAGGCAGTGCCAGG + Intronic
996717786 5:126601348-126601370 GCCGGCCTCCAGGAGGCGCCAGG - Intronic
997454100 5:134004840-134004862 GACAGCGTCCAGGCCGGGCCAGG + Intronic
1000111005 5:158108002-158108024 GAAGACCTCCAGGCCACCCTGGG - Intergenic
1001293942 5:170485696-170485718 CAAGGCCTCCAGGCTGCCTCTGG + Intronic
1002670363 5:180861433-180861455 CACGGCCTCCTGGCCGCGCCTGG - Intergenic
1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG + Exonic
1006436343 6:34027795-34027817 GCAGGCCACCAGGGGGCGCCTGG - Intronic
1011506327 6:88047969-88047991 GCGGGCCTCCAGTCCGCGCGCGG + Exonic
1013168846 6:107618117-107618139 GAAGGCATACGGGCCGCGCACGG - Intronic
1013459052 6:110358112-110358134 GGTGGCCGCCAGGCCGGGCCCGG + Exonic
1014998963 6:128190787-128190809 AAAGGTCTCCAGGCCAGGCCTGG - Intronic
1017006702 6:150032621-150032643 GTAGGCCACCAGGCCTGGCCAGG + Intergenic
1019331572 7:463104-463126 GACGGCCCCCAGGCAGCCCCGGG + Intergenic
1019466792 7:1194079-1194101 GAGGGCTTTCACGCCGCGCCGGG - Intergenic
1019625946 7:2015675-2015697 GAAGGTCGCCAGCCTGCGCCTGG - Intronic
1019670852 7:2277508-2277530 ACAGGCCTCCAGGCCGGGCGCGG + Intronic
1020006927 7:4788204-4788226 GAAGGCCTCCAGGCAGCTGGGGG - Exonic
1020086589 7:5313717-5313739 CAAGGCCCCCAAGGCGCGCCCGG - Exonic
1022703876 7:32785480-32785502 GGAGGCCTCCAGGAGGCGCTGGG - Intergenic
1023037641 7:36147382-36147404 GAAGGCCTCAGGGCCTCGCTAGG - Intergenic
1029272431 7:99385244-99385266 GAAGTCATCCAGGCCAGGCCCGG - Intronic
1032198700 7:129804504-129804526 TAAGGCCTCCAGGCCTGTCCGGG + Intergenic
1034446174 7:151115306-151115328 GAGCGCCGCCAGGCCGCGCCGGG - Intronic
1034970634 7:155417211-155417233 GAAGAACTCCAGGGCGGGCCAGG - Intergenic
1044604999 8:94040720-94040742 GACTGCCTCCAGACAGCGCCTGG - Intergenic
1045634371 8:104166354-104166376 GAAGTCATCCAGGCCGGGCCCGG - Intronic
1048895197 8:138985989-138986011 GGAGGCCTTCAGGCCAAGCCTGG + Intergenic
1049573192 8:143379043-143379065 GAAGGCCTCCATAGCGCGGCGGG - Exonic
1049671849 8:143873508-143873530 GCAGGCACCCAGGCGGCGCCGGG + Intronic
1051338872 9:16092905-16092927 GAAGGCCACCAGGCTGCACAGGG - Intergenic
1051522337 9:18003170-18003192 GAAGGACTCCAGGATGAGCCTGG - Intergenic
1052888934 9:33677359-33677381 GAGGGGCTTCAGGCCGGGCCGGG + Intergenic
1054775692 9:69121813-69121835 GAAGGCATCCCGGCGACGCCTGG - Intronic
1057424710 9:94938957-94938979 GAAGGCTTCTAGGCCGGGCGCGG + Intronic
1058136702 9:101315763-101315785 GAATGCCTCCAGGCTCCTCCAGG - Intronic
1061669949 9:132183013-132183035 GAAGGGCTCCAGGGCAGGCCTGG - Intronic
1062208646 9:135351253-135351275 GAAGGCCACCCGGCTGTGCCTGG - Intergenic
1203776414 EBV:75622-75644 GAAGCCCTGCAGGTGGCGCCGGG - Intergenic
1203490036 Un_GL000224v1:96055-96077 GAAGTCCTCCTGGTGGCGCCTGG - Intergenic
1203502659 Un_KI270741v1:37938-37960 GAAGTCCTCCTGGTGGCGCCTGG - Intergenic
1187773082 X:22723816-22723838 AAAGGCATCCAGGCCGAGCGTGG - Intergenic
1188242301 X:27808012-27808034 AAAGGCATCCAGGCCCCGCCAGG + Exonic
1188242396 X:27808520-27808542 GAAGGCATCCAGGCCCTGCCAGG + Intronic
1190462870 X:50696038-50696060 GAATGGCTCCAGGCAGCTCCTGG + Intronic
1192237551 X:69305706-69305728 GCAGGCGGCGAGGCCGCGCCGGG - Intergenic
1192522433 X:71814537-71814559 GAAGGAATCCAGGCCAAGCCCGG + Intergenic
1195625203 X:106999886-106999908 GAAGGCCTGCGGGCCGCCGCCGG + Exonic
1199357981 X:146883185-146883207 AAGGGCCTCCAGGCCGGGCGCGG - Intergenic