ID: 1128104024

View in Genome Browser
Species Human (GRCh38)
Location 15:65029638-65029660
Sequence CTGCGCAGGCGCATCGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 137}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128104013_1128104024 -1 Left 1128104013 15:65029616-65029638 CCTCGGCCGCCGGCGGCCGGCCC 0: 1
1: 0
2: 10
3: 71
4: 668
Right 1128104024 15:65029638-65029660 CTGCGCAGGCGCATCGGGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 137
1128104003_1128104024 29 Left 1128104003 15:65029586-65029608 CCCAACAGCGCCGCACCAACACC 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1128104024 15:65029638-65029660 CTGCGCAGGCGCATCGGGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 137
1128104005_1128104024 19 Left 1128104005 15:65029596-65029618 CCGCACCAACACCCTCATCGCCT 0: 1
1: 0
2: 1
3: 32
4: 313
Right 1128104024 15:65029638-65029660 CTGCGCAGGCGCATCGGGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 137
1128104009_1128104024 8 Left 1128104009 15:65029607-65029629 CCCTCATCGCCTCGGCCGCCGGC 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1128104024 15:65029638-65029660 CTGCGCAGGCGCATCGGGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 137
1128104002_1128104024 30 Left 1128104002 15:65029585-65029607 CCCCAACAGCGCCGCACCAACAC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1128104024 15:65029638-65029660 CTGCGCAGGCGCATCGGGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 137
1128104010_1128104024 7 Left 1128104010 15:65029608-65029630 CCTCATCGCCTCGGCCGCCGGCG 0: 1
1: 0
2: 0
3: 18
4: 142
Right 1128104024 15:65029638-65029660 CTGCGCAGGCGCATCGGGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 137
1128104016_1128104024 -10 Left 1128104016 15:65029625-65029647 CCGGCGGCCGGCCCTGCGCAGGC 0: 1
1: 0
2: 5
3: 31
4: 336
Right 1128104024 15:65029638-65029660 CTGCGCAGGCGCATCGGGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 137
1128104014_1128104024 -7 Left 1128104014 15:65029622-65029644 CCGCCGGCGGCCGGCCCTGCGCA 0: 1
1: 0
2: 2
3: 16
4: 204
Right 1128104024 15:65029638-65029660 CTGCGCAGGCGCATCGGGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 137
1128104007_1128104024 14 Left 1128104007 15:65029601-65029623 CCAACACCCTCATCGCCTCGGCC 0: 1
1: 0
2: 0
3: 13
4: 168
Right 1128104024 15:65029638-65029660 CTGCGCAGGCGCATCGGGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 137
1128104004_1128104024 28 Left 1128104004 15:65029587-65029609 CCAACAGCGCCGCACCAACACCC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1128104024 15:65029638-65029660 CTGCGCAGGCGCATCGGGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128104024 Original CRISPR CTGCGCAGGCGCATCGGGGC GGG Intronic
900113562 1:1019630-1019652 CTGCGGAGCGGGATCGGGGCCGG + Intergenic
900390905 1:2433384-2433406 CTGCTGAGGCCCATCCGGGCCGG + Intronic
900489041 1:2937210-2937232 CTGCACAGGCGATTCTGGGCAGG - Intergenic
900951057 1:5858500-5858522 CTGCAAAGGGGCAGCGGGGCAGG - Intergenic
904160414 1:28518577-28518599 CTGCGCGGGCGCCGCGGTGCGGG - Intronic
906560576 1:46753940-46753962 CTGCCCAGGCAGATCTGGGCTGG - Intergenic
907296757 1:53460511-53460533 GTGCGCAGGCGCACTGGGCCAGG - Intronic
907430039 1:54406317-54406339 CGGCGCAGGCGGAGCCGGGCGGG - Exonic
912561516 1:110555004-110555026 CTGTGCAGGAGCAGCAGGGCTGG + Intergenic
915316102 1:155029996-155030018 CTGTGCAGGGGCTTAGGGGCAGG + Intronic
915509143 1:156377128-156377150 CTGCGCAGGTGGCTCAGGGCTGG + Intronic
924362415 1:243255260-243255282 GTGCGCAGGCGCCTCGGGAAAGG + Intronic
1066094141 10:32056446-32056468 CTGCGCAGGCGCAGTGGGCCAGG + Intergenic
1067710639 10:48648758-48648780 CAGAGCAGGCGCAGCGGGGTGGG + Intronic
1070152284 10:73812020-73812042 CTGCGCAGGCGACGCGGGGCGGG - Intergenic
1070745279 10:78930033-78930055 CTGGGCAGGCCCAGCTGGGCAGG - Intergenic
1072916645 10:99540920-99540942 CAGCGCAGGTGCCACGGGGCGGG + Intergenic
1077487092 11:2844033-2844055 ATGCGGAGGTGCATCCGGGCAGG - Intronic
1077890572 11:6415220-6415242 TTGGGCAGGGGCCTCGGGGCAGG + Intronic
1079238465 11:18706147-18706169 CTGCGCGGGCGGGGCGGGGCAGG + Intronic
1081465362 11:43311899-43311921 CCGCGGAGGCGCATTGGGGTGGG + Intergenic
1084182716 11:67454721-67454743 CTGTCCAGGCCCATCAGGGCTGG - Intronic
1090086398 11:123654409-123654431 CTGGGGAGGTGCAGCGGGGCCGG + Exonic
1091259685 11:134224623-134224645 CTGCTCCAGCGCATCCGGGCTGG + Exonic
1091289417 11:134429173-134429195 CTGGGCAGCCGCCTCTGGGCTGG - Intergenic
1096413046 12:51391116-51391138 CTGCTCAGGCGCAACGTGGCAGG + Intronic
1099970966 12:89500067-89500089 CTGCGCTGGCTCAGCGGGGCCGG + Intronic
1102339207 12:112108594-112108616 CCGGGCAGGCGCAGGGGGGCGGG - Intronic
1103595266 12:122021556-122021578 CTGGGCAGGGGCAGCTGGGCTGG + Exonic
1105022869 12:132828832-132828854 CTCCGCCGGAGCATCCGGGCCGG - Intronic
1105277246 13:18943431-18943453 CTGCGCAGGGGCTTCCGGGAAGG + Intergenic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1112290828 13:98143130-98143152 CGGCGCGGGCGCAGCGGTGCGGG + Intronic
1113820278 13:113208730-113208752 CTGCGCACCCGCGGCGGGGCCGG - Intronic
1119433955 14:74585926-74585948 CTGCGCAGGAGCAGTGCGGCTGG - Exonic
1122486804 14:102087295-102087317 CCGCGCAGGCGCATTGAGGCCGG - Intronic
1122789975 14:104180103-104180125 CCGGACAGGCGCAGCGGGGCCGG - Intronic
1122822121 14:104352985-104353007 CAGTGCAGGCTCAACGGGGCGGG + Intergenic
1202899800 14_GL000194v1_random:28420-28442 CGGCGCAGGCGCAGGGGGGTGGG - Intergenic
1124338902 15:28877100-28877122 CTGCTCAGGAGCAGCGGCGCAGG + Intergenic
1126698008 15:51341833-51341855 CTTTGGAGGCGCAGCGGGGCCGG + Exonic
1128104024 15:65029638-65029660 CTGCGCAGGCGCATCGGGGCGGG + Intronic
1132092494 15:98957477-98957499 GTGCGCACGCGCAGCGGGGTGGG + Exonic
1132148251 15:99441305-99441327 CTGAGGAGGGGCATCGGAGCTGG - Intergenic
1132539757 16:503241-503263 CTGCCAAAGAGCATCGGGGCTGG - Intronic
1133032900 16:3020239-3020261 CTGAGCGGGCGCCGCGGGGCGGG + Intronic
1136512611 16:30748526-30748548 CCGCGCAGGCGCATTCGGGCGGG - Intronic
1138370862 16:56525257-56525279 CAGAGCAGGCGGAACGGGGCTGG + Intergenic
1140456575 16:75109240-75109262 CTGGGCAGGCAGCTCGGGGCAGG + Exonic
1141701150 16:85642724-85642746 CTGAGCAGTTGCAGCGGGGCCGG + Intronic
1142104705 16:88296073-88296095 CTGCAAAGGCGCAGCCGGGCGGG - Intergenic
1142513094 17:410315-410337 CTGCGCAGGCGCAGCAGGGGTGG + Exonic
1143274028 17:5696638-5696660 CTGGGCAGGTGCATGGGGGCGGG - Intergenic
1151576322 17:74954175-74954197 CTCTGCAGGGGCAGCGGGGCGGG + Exonic
1151858148 17:76737461-76737483 GTGCGCAGGCGCTTCGGGTAGGG - Exonic
1152319596 17:79601052-79601074 CTCCGCAGGGGCCCCGGGGCGGG - Intergenic
1152688746 17:81707924-81707946 CTGCGCAGGGGGATTGGGGAGGG + Intergenic
1154978394 18:21481224-21481246 CTGGGCAGGGGGATGGGGGCAGG + Intronic
1156150336 18:34234059-34234081 CTGCCCAGGACCAGCGGGGCGGG - Intergenic
1160618355 18:80151081-80151103 CTGTGAAGGGGCATCGGGCCTGG + Intronic
1161270751 19:3388037-3388059 CTGGGCTGGCGGCTCGGGGCGGG - Intronic
1161279078 19:3435284-3435306 CTGCGCGGGCGCCGCGGGGCAGG + Intronic
1162890783 19:13731754-13731776 TTGCGCATGCGCCTCGGAGCTGG + Exonic
1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG + Intronic
1163783250 19:19261468-19261490 CTGCGGGGGCGCAGCGTGGCCGG - Exonic
1166107879 19:40606300-40606322 CTGCGAAGGTGCAACGGGGCAGG + Exonic
1166660451 19:44643823-44643845 CTGCGCAGGCGCAGGCGCGCGGG + Exonic
1167148227 19:47694982-47695004 CAGCACAGACGCAGCGGGGCTGG - Exonic
1167517054 19:49929552-49929574 CTGCGCATGCGCACTGGGCCCGG + Intronic
1167633453 19:50639707-50639729 CGGCCCCGGCGCATGGGGGCGGG - Intronic
1168151134 19:54449457-54449479 CTGCGCCTGCGCACCGGGCCTGG + Intronic
927249325 2:20983590-20983612 CTGTGCAGGTGCTTCTGGGCTGG - Intergenic
927893019 2:26764267-26764289 CTGCGCGAGCGCTTCCGGGCCGG - Exonic
928158054 2:28894640-28894662 GTGCGCAGGCGCACCGGCGCGGG - Exonic
930209294 2:48617836-48617858 CCGCGCAGGCGCAAAGGGCCAGG + Exonic
932567511 2:72918796-72918818 CTTCGCTGGCGCGTCCGGGCGGG + Intronic
935165110 2:100563210-100563232 CTGCGCAGGCGCAGTGCGGGAGG + Intronic
937320870 2:120959972-120959994 CTGTGCAGGCGCAGGGGGCCTGG + Intronic
943942710 2:194020263-194020285 CTGCCCAGGGCCAGCGGGGCAGG - Intergenic
946386506 2:219387410-219387432 CTGGGCAGGGACATGGGGGCGGG - Intronic
948664861 2:239528482-239528504 CTGAGCAGCCGCATCCAGGCTGG - Intergenic
948808399 2:240462785-240462807 CTGGGCAGGCGGCTCTGGGCTGG + Intronic
1168855000 20:1002165-1002187 CTGGGCAGCCGGATCCGGGCTGG + Exonic
1169009258 20:2236691-2236713 CTGCGCAGGGAGATGGGGGCCGG + Intergenic
1169137218 20:3204432-3204454 CTGCGCGTGCGCACCTGGGCGGG - Intronic
1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG + Intergenic
1171484310 20:25476491-25476513 CGGCGCGAGCGCAGCGGGGCTGG - Exonic
1175332782 20:58176464-58176486 CAGCCCAGGGGCATGGGGGCTGG - Intergenic
1175874324 20:62222205-62222227 CTGCCCAGGCTCTCCGGGGCTGG - Intergenic
1175878587 20:62243440-62243462 CGGGGCAGGCGCTGCGGGGCAGG - Intronic
1175878591 20:62243454-62243476 CCGGGCAGGCGCTGCGGGGCAGG - Intronic
1175992495 20:62796685-62796707 CTGCGGACGCGCGTGGGGGCGGG + Intronic
1176194260 20:63830434-63830456 GGGCGCAGGGGCCTCGGGGCGGG - Intronic
1176194493 20:63831044-63831066 CCGGGCGGGCGCATCGCGGCGGG - Intronic
1176274409 20:64255676-64255698 CTGCGCATGCGCCGCGGGCCTGG - Intronic
1176284528 21:5012466-5012488 CTGTTCAGGTGCATCTGGGCAGG - Intergenic
1176510554 21:7744870-7744892 GTGCGCAGGCGCAGTGGGCCCGG - Intergenic
1176619174 21:9043194-9043216 CGGCGCAGGCGCAGGGGGGTGGG - Intergenic
1178644667 21:34375399-34375421 GTGCGCAGGCGCAGTGGGCCCGG - Intergenic
1179218327 21:39385854-39385876 CTGCGCAGGCGCTCCAGGACTGG + Intronic
1179218343 21:39385964-39385986 CTGCGCAGGCGCCCCAGAGCTGG + Intronic
1179573578 21:42292448-42292470 CTGAGCAGGTGCACTGGGGCTGG - Intronic
1179872653 21:44251009-44251031 CTGTTCAGGTGCATCTGGGCAGG + Intronic
1180019621 21:45113696-45113718 CTGCACAGGCTCCTCTGGGCAGG - Intronic
1180999123 22:19979781-19979803 CTCAGCAGGCGCACCAGGGCAGG + Exonic
1184710610 22:46247333-46247355 CTGCGTGGGCTCATCAGGGCAGG + Intronic
1184856640 22:47149989-47150011 CTCCTCAGGGGCAGCGGGGCTGG + Intronic
1185338293 22:50280474-50280496 CTGCGCAGGTGCACATGGGCGGG - Exonic
950902993 3:16513695-16513717 CGGCGGGGGCGCGTCGGGGCTGG - Exonic
954611045 3:51944736-51944758 GTGGGCAGGAGCAGCGGGGCAGG - Intronic
954688519 3:52383616-52383638 CTGCGCTGGGGCAGCGGAGCTGG + Intronic
961585024 3:127915315-127915337 GTGCGCAGGCGCACAGTGGCTGG + Exonic
961718942 3:128879422-128879444 CCGCGCAAGCGCAGTGGGGCCGG + Intergenic
968457136 4:705664-705686 GGGCGCAGGCGCGTCGGGCCTGG - Intergenic
974862902 4:67545359-67545381 TTGCGCTGGCTCAGCGGGGCCGG - Exonic
978503617 4:109434054-109434076 CTGCACGGCCACATCGGGGCGGG + Intronic
978532598 4:109730058-109730080 CGGCGCAGGCGCACAGGGGACGG - Exonic
979278110 4:118835877-118835899 CTGCCCAGGCACAGCGGAGCGGG - Intronic
980115207 4:128672765-128672787 CTGCCCGGGGGCAGCGGGGCGGG - Intergenic
992837507 5:80654982-80655004 CTGGGCAGGGCCATCGGGGCTGG + Exonic
996379045 5:122845523-122845545 CCCCGCGGGCGCAGCGGGGCGGG + Exonic
1001191642 5:169637498-169637520 CTGCGGCGGGGCCTCGGGGCGGG + Intronic
1002296214 5:178232680-178232702 CAACGCGGGCGCTTCGGGGCGGG - Exonic
1006078285 6:31548326-31548348 CAGGGCAGGGGCATCGTGGCGGG - Exonic
1007018589 6:38495747-38495769 CCGTGCAGGTGCATCTGGGCGGG + Intronic
1019461329 7:1160422-1160444 CCGCGCAGGCGCAGCCGGGCGGG + Intronic
1019713261 7:2526933-2526955 CTACGCAAGCCCATCTGGGCCGG - Intronic
1022139051 7:27476284-27476306 CTGCTCAGGGGCATCAGGGAAGG - Intergenic
1023018323 7:35987317-35987339 CTGCGCAGGCCCAGTGGGGAGGG + Intergenic
1023405811 7:39833252-39833274 CGGCGCAGGCGGAGCCGGGCGGG + Intergenic
1024639384 7:51316936-51316958 CTGAGCAGGCGGGGCGGGGCGGG - Intergenic
1031361966 7:120857873-120857895 CGGCGGGGGCTCATCGGGGCAGG + Exonic
1032054440 7:128673129-128673151 CTGCGCAGGAGCATGGGTTCAGG - Intronic
1034670117 7:152851540-152851562 CTGGGCAGGCGGAGCGGGACAGG + Intronic
1036851315 8:12203621-12203643 CTGCCCGGGTCCATCGGGGCCGG + Intergenic
1036872679 8:12445895-12445917 CTGCCCGGGTCCATCGGGGCCGG + Intergenic
1038734493 8:30156641-30156663 CTGCGCAGGCGCATGTGGGGAGG - Intronic
1040580327 8:48693658-48693680 CTGCGCAGGCTCATCTGTGCAGG + Intergenic
1042648559 8:71013981-71014003 AGGCACAGGGGCATCGGGGCAGG - Intergenic
1048553894 8:135457347-135457369 GTGCGCAGGCGCGGCGCGGCAGG + Intergenic
1049376085 8:142289857-142289879 CCGGGCAGGCGCAGTGGGGCTGG + Intronic
1049838551 8:144755449-144755471 CTGCGCAGTCGCACCGAGCCCGG + Exonic
1050472694 9:6008462-6008484 CTACGCATGCGCACCGGGGATGG - Intergenic
1056643180 9:88388303-88388325 CTGCGCAGGCGCAGTGGGGCGGG - Intergenic
1056834394 9:89942882-89942904 CTGAGGAAGCGCAGCGGGGCTGG + Intergenic
1057067990 9:92073087-92073109 CTGGGCAGGGGCATGGGGGTCGG - Intronic
1057356066 9:94332444-94332466 CTGCGCAGGAGCCTTGAGGCGGG + Intergenic
1057792983 9:98136098-98136120 CTGCCCTGGGGCATCGGGGAAGG + Intronic
1060393981 9:123302942-123302964 CAGCGCAGACCCATCGGGGCAGG - Intergenic
1061487284 9:130926386-130926408 CTGCAGAGGCGCATCAGGGGAGG + Intronic
1062023271 9:134329109-134329131 CTCCACAGGCGCATGGGGTCTGG - Intronic
1185890358 X:3816505-3816527 CTCCTCAGCCGCAGCGGGGCAGG - Intergenic
1189325249 X:40107710-40107732 CGGCTCGGGCGCAGCGGGGCTGG - Intronic
1194384368 X:93235833-93235855 CTGCCCAGGGCCAGCGGGGCTGG - Intergenic
1200215452 X:154366224-154366246 CTGAGCAGGTGCCTCGTGGCAGG - Exonic