ID: 1128106305

View in Genome Browser
Species Human (GRCh38)
Location 15:65047842-65047864
Sequence CTGCCTACTTACTCATTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128106305_1128106311 21 Left 1128106305 15:65047842-65047864 CCCTCAAATGAGTAAGTAGGCAG 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1128106311 15:65047886-65047908 GTCTAAGAAAGGGCCAGGCACGG 0: 1
1: 1
2: 7
3: 83
4: 667
1128106305_1128106312 24 Left 1128106305 15:65047842-65047864 CCCTCAAATGAGTAAGTAGGCAG 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1128106312 15:65047889-65047911 TAAGAAAGGGCCAGGCACGGTGG 0: 1
1: 25
2: 226
3: 1898
4: 9303
1128106305_1128106310 16 Left 1128106305 15:65047842-65047864 CCCTCAAATGAGTAAGTAGGCAG 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1128106310 15:65047881-65047903 TGAAAGTCTAAGAAAGGGCCAGG 0: 1
1: 0
2: 0
3: 34
4: 367
1128106305_1128106313 30 Left 1128106305 15:65047842-65047864 CCCTCAAATGAGTAAGTAGGCAG 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1128106313 15:65047895-65047917 AGGGCCAGGCACGGTGGCTCAGG 0: 12
1: 120
2: 558
3: 1480
4: 2837
1128106305_1128106307 10 Left 1128106305 15:65047842-65047864 CCCTCAAATGAGTAAGTAGGCAG 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1128106307 15:65047875-65047897 AGTCCTTGAAAGTCTAAGAAAGG 0: 1
1: 0
2: 1
3: 13
4: 205
1128106305_1128106308 11 Left 1128106305 15:65047842-65047864 CCCTCAAATGAGTAAGTAGGCAG 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1128106308 15:65047876-65047898 GTCCTTGAAAGTCTAAGAAAGGG 0: 1
1: 0
2: 0
3: 19
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128106305 Original CRISPR CTGCCTACTTACTCATTTGA GGG (reversed) Intronic
902972481 1:20063906-20063928 CTGCTTACTTGCTTACTTGAAGG - Intronic
910054180 1:83011640-83011662 CTCCCTCCATACTCATTTGGGGG - Intergenic
910390600 1:86739230-86739252 CTCTATACTTACTCCTTTGAGGG - Intronic
914448077 1:147767114-147767136 CTCCCTACATACCCATTTTAAGG - Intronic
916841058 1:168601254-168601276 CAGCCCAATGACTCATTTGATGG + Intergenic
919220397 1:194621053-194621075 CTGTCTACTTTATGATTTGAGGG - Intergenic
919983519 1:202657437-202657459 CTGGCTTCTTAGGCATTTGAAGG + Intronic
1063533133 10:6855560-6855582 CTGCCTAATAACTCATTGGTTGG + Intergenic
1063818726 10:9809185-9809207 CTGGTTGCTTAGTCATTTGATGG + Intergenic
1064960251 10:20955487-20955509 CTGCCTACTTACTCTGTTCTGGG - Intronic
1068080369 10:52311745-52311767 CTGCCCACTAAATGATTTGAAGG + Intergenic
1068930277 10:62582274-62582296 CTTCCTACTTACTCCTTTGCAGG + Intronic
1077454256 11:2668749-2668771 CTGCCTTCTTCCTCTCTTGATGG + Intronic
1081721148 11:45289505-45289527 CTCCCTCCTTTCTCAATTGAAGG + Intergenic
1081957227 11:47104082-47104104 CTCCCTACTTACCCATTTCATGG + Intronic
1085745788 11:79113153-79113175 CTGGCTGCTTTCTCACTTGAAGG - Intronic
1085806177 11:79638497-79638519 CCTCCTACTTCCTCATTTTACGG - Intergenic
1087009257 11:93498298-93498320 CTGCTGACTTATTCATTTAAAGG + Intronic
1088031213 11:105253270-105253292 CTGCCTACCACCTCATTTAAAGG - Intergenic
1090443892 11:126747145-126747167 AGGCCAACTTGCTCATTTGATGG - Intronic
1094498933 12:31006376-31006398 CTGCCTGCTTTCCCAGTTGAGGG + Intergenic
1097686691 12:62697616-62697638 CTTCCTTCTTTCTCATTTGGGGG + Intronic
1100852129 12:98723280-98723302 CTGCTTTCTTGGTCATTTGATGG + Exonic
1101238388 12:102813238-102813260 CTACCTACTTACTCCTGGGAAGG - Intergenic
1106058117 13:26257972-26257994 CTGCCTACTTACTAATCTCTGGG - Intronic
1106329983 13:28731091-28731113 CTGCTTTCTTTCTTATTTGATGG + Intergenic
1106602321 13:31199002-31199024 CTTCATATTTACTCATTTGTTGG - Intergenic
1107619708 13:42213764-42213786 CTGCCTTCTTGCTCATCTGCAGG + Intronic
1111986010 13:95067629-95067651 CTGCCTGCTTGCTCATCTCAGGG - Intronic
1113091598 13:106622632-106622654 CTGTATACTTACACATTTGAGGG + Intergenic
1115878213 14:37885254-37885276 CTACCTTCTAACTCATTTGATGG - Intronic
1118125774 14:62902161-62902183 CTGCCACTTTACTCAGTTGATGG + Intronic
1118273088 14:64361659-64361681 GTGCCTAGCTACTCATTTCAAGG - Intergenic
1119840408 14:77788478-77788500 CTGCCTCCTTGCTCCTTTGCTGG - Intergenic
1124207789 15:27737786-27737808 CTGCCTTGTTACTCTTTTAATGG - Intergenic
1127239293 15:57094266-57094288 CTATCTACTTAATCATTTCAGGG - Intronic
1127640539 15:60912005-60912027 CTGCCCAGTAACTGATTTGAGGG + Intronic
1128106305 15:65047842-65047864 CTGCCTACTTACTCATTTGAGGG - Intronic
1129823569 15:78620296-78620318 CCGCCCACCTCCTCATTTGACGG - Intronic
1130312128 15:82765035-82765057 CTCCCTCCTCACTCATTTGTAGG + Intronic
1131605925 15:93902053-93902075 CTCCCTAGTTACAAATTTGATGG - Intergenic
1135418974 16:22291703-22291725 CTTTCTACTCACTCAGTTGATGG - Intergenic
1142884864 17:2906160-2906182 CTGCCTCCTGAGTCATCTGAGGG + Intronic
1150997552 17:70336292-70336314 CTTCCTTCTTACACATTTAACGG + Intergenic
1157692243 18:49692884-49692906 CTGGCTACTCACTCATTTCTTGG - Intergenic
926698282 2:15785556-15785578 GCGCCTTCTTTCTCATTTGAAGG - Intergenic
926948240 2:18212708-18212730 CTGCTTACTTACTGATGGGAAGG - Intronic
927610853 2:24539101-24539123 ATTCCTTCTTACCCATTTGAAGG + Intronic
935882091 2:107574958-107574980 CTGCTTATTTTCTCATTTGTGGG - Intergenic
940088624 2:149891448-149891470 CTACCTTCTTACTGATTTGAAGG - Intergenic
940411712 2:153372005-153372027 CTGCTTACTTTCTCTTGTGAGGG + Intergenic
942656157 2:178216024-178216046 GTCCTAACTTACTCATTTGAGGG + Intronic
943320902 2:186440924-186440946 CCATCTTCTTACTCATTTGAAGG + Intergenic
945250151 2:207759122-207759144 CTGCCTACTTACCCATCTGGTGG + Intronic
946568838 2:220998660-220998682 CTGCATCCTTAATCATTTGTGGG + Intergenic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
947982601 2:234423327-234423349 CTGCCTCCTTCCGCATTTAAGGG - Intergenic
1169078217 20:2775718-2775740 TTGCCTACTTCCTGATTTTAGGG - Intergenic
1169686654 20:8281846-8281868 CTACCTACTAACTCAATTGTAGG + Intronic
1169973103 20:11292257-11292279 CTGCTTACTAACTTCTTTGAAGG + Intergenic
1170016960 20:11792160-11792182 CTACCTACTGACTCTTTTCAGGG + Intergenic
1175362474 20:58424196-58424218 TTGCATACTTACACACTTGAGGG + Intronic
1175477052 20:59283848-59283870 CTGCCTTATTACTCTGTTGATGG + Intergenic
950260392 3:11539198-11539220 ATGCCCACTAACTCATTTCATGG + Intronic
950864959 3:16181638-16181660 CTGCCTCCTTCCTCTTTTGCAGG - Intronic
950936656 3:16846201-16846223 CTCCCTACTTACTCATCTGTTGG + Intronic
953935350 3:47036998-47037020 CTAACTACTTACTCATTTGAGGG - Intronic
956464413 3:69504895-69504917 CTGCTTCCTTTCTCATTTGAAGG + Intronic
960359336 3:116691990-116692012 CTGCCTACTCATTCATTTCTGGG + Intronic
960652255 3:119964048-119964070 CTGCCTTCTTACTCTGTTGATGG - Intronic
962196407 3:133367496-133367518 CTGCCTAATTTCCCATTTCAAGG - Intronic
962812196 3:138969029-138969051 CTGGCTAGTTACTCCCTTGAGGG + Intergenic
967138260 3:186530791-186530813 CTTACTAATTACTTATTTGAGGG - Intergenic
971402488 4:26288927-26288949 ATGCCAAGTTTCTCATTTGAAGG - Intronic
971922634 4:32962289-32962311 CTGCCTAATTAGTCATCTTAAGG - Intergenic
972050149 4:34721665-34721687 TTGCCTCCCTAGTCATTTGAAGG + Intergenic
979922058 4:126510269-126510291 TTGCCTACTTATTTATTTGTGGG + Intergenic
980093782 4:128468691-128468713 CTGCTCACTTACTCACATGAGGG - Intergenic
982730268 4:158948364-158948386 CTTCCTACTTGCTCATTGGTTGG + Intronic
986065738 5:4231858-4231880 CTGCCTGCCTACTTCTTTGATGG + Intergenic
986312383 5:6561976-6561998 CTGGATACATACTCAATTGAGGG - Intergenic
989956025 5:50361092-50361114 ATGCCTACTTACTATTTTGGGGG + Intergenic
993740821 5:91537347-91537369 CAGCCTACTTAACCTTTTGAAGG - Intergenic
994263998 5:97692980-97693002 CTCCCTACTTGCTCCTTAGAGGG - Intergenic
995417342 5:111925628-111925650 CTGTCTCCTGACTCAGTTGAAGG - Intronic
996202201 5:120689597-120689619 CAGCCTTCATACTCCTTTGAAGG + Intergenic
996474917 5:123906515-123906537 CTGTCTCCTGAGTCATTTGAAGG - Intergenic
999575425 5:152971496-152971518 CAGCCTACTTTCTCATCAGAAGG - Intergenic
1001284708 5:170414296-170414318 CTGCCTCCTTACATATTTTAAGG + Intronic
1005440489 6:25862267-25862289 CTGCCTGTTGACTCATTTGGTGG - Exonic
1005518688 6:26579086-26579108 CTGCCTATTTACTCTGTTGATGG + Intergenic
1008743016 6:54633105-54633127 CTCCCTTCTTTCTCCTTTGAAGG - Intergenic
1015370991 6:132452509-132452531 GAGCCCACTTACTCATTTTAGGG - Exonic
1019013240 6:168860339-168860361 CTGCCTCCTTACATATTTTAGGG + Intergenic
1027989309 7:85336033-85336055 CTGCCATCTTACTTTTTTGATGG + Intergenic
1033062603 7:138122761-138122783 CTGCCTACATACTCACTTCCCGG - Intergenic
1041070344 8:54122471-54122493 CAGCCTACACACACATTTGAAGG - Intergenic
1041444726 8:57938327-57938349 CTGCCTTCTCACTTAATTGATGG + Intergenic
1041826970 8:62106624-62106646 ATGCCTACCTAGTCTTTTGAGGG - Intergenic
1048388035 8:133931611-133931633 CTTTCTATTTACTCATTTAATGG + Intergenic
1049981458 9:907882-907904 CTGCATACTGAATTATTTGAGGG + Intronic
1050663356 9:7908206-7908228 TTGGCTGCTTACTCATTGGAAGG + Intergenic
1051698285 9:19791753-19791775 CTGTTTAATAACTCATTTGATGG - Intergenic
1051976692 9:22958692-22958714 CTGCCTGTTTACTCTGTTGATGG + Intergenic
1053052458 9:34973003-34973025 CTGGCTAGTTACTTGTTTGAGGG + Intronic
1057074848 9:92133115-92133137 ATGCCTACATGCTCCTTTGAAGG - Intergenic
1058088281 9:100774905-100774927 ATGCCAACTTACTTATTTCAAGG + Intergenic
1059910465 9:119038209-119038231 TTGTTTACTTACTCATTAGAAGG + Intergenic
1187822595 X:23304205-23304227 CTGCAAACTTAGTCATTTGGAGG - Intergenic
1188745533 X:33837376-33837398 CTGCCTACTAACTTATTTTTTGG - Intergenic
1190777074 X:53561531-53561553 CTGCCTATTTACTGAGGTGAAGG + Intronic
1194598156 X:95885505-95885527 CTTCCTGGTCACTCATTTGATGG - Intergenic