ID: 1128106549

View in Genome Browser
Species Human (GRCh38)
Location 15:65049760-65049782
Sequence ACCCAGGAGCACGTGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128106549_1128106555 10 Left 1128106549 15:65049760-65049782 CCAGGCTCCACGTGCTCCTGGGT 0: 1
1: 1
2: 1
3: 21
4: 292
Right 1128106555 15:65049793-65049815 CGTTTTTGTCCCATAACTTTGGG 0: 1
1: 0
2: 2
3: 9
4: 134
1128106549_1128106554 9 Left 1128106549 15:65049760-65049782 CCAGGCTCCACGTGCTCCTGGGT 0: 1
1: 1
2: 1
3: 21
4: 292
Right 1128106554 15:65049792-65049814 TCGTTTTTGTCCCATAACTTTGG 0: 1
1: 0
2: 1
3: 12
4: 106
1128106549_1128106556 17 Left 1128106549 15:65049760-65049782 CCAGGCTCCACGTGCTCCTGGGT 0: 1
1: 1
2: 1
3: 21
4: 292
Right 1128106556 15:65049800-65049822 GTCCCATAACTTTGGGCCAGAGG 0: 1
1: 0
2: 1
3: 6
4: 109
1128106549_1128106559 25 Left 1128106549 15:65049760-65049782 CCAGGCTCCACGTGCTCCTGGGT 0: 1
1: 1
2: 1
3: 21
4: 292
Right 1128106559 15:65049808-65049830 ACTTTGGGCCAGAGGAGATCTGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128106549 Original CRISPR ACCCAGGAGCACGTGGAGCC TGG (reversed) Intronic
900458841 1:2790478-2790500 ACCCAGGGCCACCTGGAGACTGG - Intronic
900462962 1:2810164-2810186 ACCGAGGGGCACATGGAGCAGGG - Intergenic
900498495 1:2987891-2987913 AACCTGGGCCACGTGGAGCCAGG - Intergenic
901187869 1:7386695-7386717 ACCAAGGAGGAGGTGGAGGCTGG - Intronic
901295546 1:8158399-8158421 GCCCAGGAGGATGTGGAGTCAGG - Intergenic
902396405 1:16134427-16134449 ACCCAAGCCCATGTGGAGCCAGG + Intronic
903552765 1:24169449-24169471 ACCCAGGGGGACTTGGAGCTGGG + Exonic
903860250 1:26360480-26360502 CCCCAGGAGCAGGAGGAGCTGGG + Intergenic
904498519 1:30901076-30901098 AGCCAGGAGCTGGTGGAGCCTGG - Intronic
904911461 1:33937408-33937430 ACCCAGGAGCTGAGGGAGCCTGG + Intronic
905593301 1:39183986-39184008 TCACAGGAGCAGGTGGAGACAGG + Intronic
906177475 1:43787234-43787256 AGCCAGGAACAGCTGGAGCCTGG + Intronic
906565597 1:46799026-46799048 ACCCAGGAGCAGCTGAAGGCAGG + Exonic
907301622 1:53490374-53490396 AGCCAGCAGGAAGTGGAGCCTGG - Intergenic
909809177 1:79909122-79909144 ACCCAGAAGAACATGGAGCGAGG - Intergenic
911404743 1:97422561-97422583 ACCCAGTAGCCCGTGGAGGTAGG - Intronic
912320946 1:108712753-108712775 AACCAGGGGCACTTGGAGACCGG - Exonic
913452539 1:119001717-119001739 CCCCAGGAGCAGGGGGATCCAGG + Intergenic
914831842 1:151175994-151176016 TCCCAGCAGCAGGAGGAGCCCGG + Exonic
915493712 1:156266408-156266430 CCCGAGGAACAGGTGGAGCCTGG + Intronic
918605969 1:186426343-186426365 ACACAGCATCACGTGGAGCAGGG - Intergenic
919297737 1:195722993-195723015 GCACAGGAGCCCGTGGAGCAGGG + Intergenic
920313274 1:205060990-205061012 ACCCTGGAGCCAGTGAAGCCGGG - Intronic
920437550 1:205957309-205957331 ACCGAGACGCACATGGAGCCAGG - Intergenic
922719056 1:227891088-227891110 ACCCAGGGGGCCGAGGAGCCAGG + Intergenic
924384765 1:243490619-243490641 TCCCAGTAGCCCGTGAAGCCAGG - Intronic
1062816993 10:508131-508153 ACAGAGGAGCTCGTGCAGCCAGG + Intronic
1062909043 10:1200180-1200202 ACCCAGGAGCCCAGGGAGCCTGG + Intronic
1063197905 10:3760154-3760176 ACCTGGGAGCACTGGGAGCCGGG - Intergenic
1065644512 10:27820197-27820219 AGCCAGTGGCATGTGGAGCCTGG - Intronic
1066047552 10:31606479-31606501 CCCCAGGACCACCTGGACCCAGG - Intergenic
1066242567 10:33552422-33552444 ACCCAGGAACAAGAGGGGCCAGG + Intergenic
1066384839 10:34933316-34933338 AGCCAGGATCACCTGAAGCCAGG + Intergenic
1067282089 10:44880512-44880534 ACCCAGGGCCACGTGGAGCGGGG + Intergenic
1067738927 10:48880549-48880571 AGACAGGAGCATGTGGAACCCGG + Intronic
1069818151 10:71211682-71211704 TCCAAGGAGCACGTGGGGACAGG - Intergenic
1070745511 10:78931389-78931411 AGCCAGGAGGAGGTGGAGCTCGG + Intergenic
1070783162 10:79149046-79149068 ACTCAGGAGCTCCCGGAGCCAGG + Intronic
1070820537 10:79351562-79351584 ACACTGAAGCACGTGGGGCCAGG + Exonic
1071400457 10:85263688-85263710 ATCCAGGTGCACCTGAAGCCAGG + Intergenic
1075900112 10:126036193-126036215 CGCTAGGTGCACGTGGAGCCCGG + Exonic
1076706722 10:132306423-132306445 ACCCTGGAGCGTGTGGGGCCTGG + Intronic
1076812275 10:132893431-132893453 ACCCAGGAGGAGGAGGGGCCAGG - Intronic
1077217452 11:1400860-1400882 TCCCAGCACCACGAGGAGCCTGG - Intronic
1077236499 11:1484411-1484433 ACCAAGGAGCATGAGGGGCCCGG - Intronic
1078105800 11:8357319-8357341 GCCCAGCAGCCCGCGGAGCCAGG + Intergenic
1078488783 11:11749853-11749875 AACCAAGAGCAGGTAGAGCCAGG + Intergenic
1079094155 11:17500319-17500341 AGCCAGGAGAAGGTGGAGGCAGG - Intronic
1079391925 11:20029316-20029338 AGCCAGGAGCAAGGAGAGCCAGG - Intronic
1080683506 11:34496694-34496716 AACCAGGAGTGCTTGGAGCCTGG + Intronic
1081704933 11:45177139-45177161 GCCCAGGAGCCAGTGTAGCCAGG - Intronic
1081805528 11:45887903-45887925 ACCCAGGGTTAAGTGGAGCCTGG - Intronic
1082042374 11:47696552-47696574 ACCCAGGCCCACCTGGGGCCTGG - Intronic
1082807771 11:57461178-57461200 CCCCCGGAGCAGGTGGAGCGGGG - Intronic
1083640854 11:64144581-64144603 AGCCAAGAGCAGGTGGGGCCGGG - Intronic
1084709082 11:70832841-70832863 CCCCACGAGCAGGTGCAGCCAGG + Intronic
1088858521 11:113778528-113778550 TCCCAGCAGCAAGGGGAGCCTGG + Intergenic
1089967026 11:122661835-122661857 AACCAGGACCTCGTGTAGCCTGG - Intronic
1090383613 11:126343923-126343945 GCCCAGGAGCACGGGGAGATGGG + Intronic
1090925878 11:131250129-131250151 ACACAGGGTCACCTGGAGCCGGG - Intergenic
1091412987 12:256434-256456 ACCCAGGAGATGGTGGAGGCGGG + Intronic
1092459355 12:8672755-8672777 AAGCAGGAGCACGGGGAGGCGGG - Intergenic
1092737042 12:11592613-11592635 ACCCCGGACCAGGTGGGGCCAGG + Intergenic
1096482609 12:51952214-51952236 CCCCAGGAGCACCTGGAGGGAGG - Intronic
1096900083 12:54868186-54868208 ACCCAGGAACACAGGTAGCCAGG - Intergenic
1101855253 12:108436994-108437016 ACCCAGGTGCATGGGGAGCTGGG - Intergenic
1101932238 12:109024052-109024074 ACCCAGGAAGAGGTGGAGCTGGG - Intronic
1102003589 12:109573917-109573939 ACCCAGGACGACGCTGAGCCAGG + Intronic
1102162664 12:110782250-110782272 ACCCAGGAACAGGAGGGGCCAGG + Intergenic
1103903939 12:124317869-124317891 AGCCAGCAGCACGTGAAGGCTGG - Intergenic
1104035666 12:125095578-125095600 ACCCAGGGGCAGGTGGAGTGGGG - Intronic
1104794982 12:131511090-131511112 ACCCAGGAGCAGGTGGATGTGGG - Intergenic
1104921432 12:132292662-132292684 GCCCAGGAGGCAGTGGAGCCTGG - Intronic
1106310916 13:28553527-28553549 ACCCAGGAGAACCTGAAGCTCGG + Intergenic
1106419433 13:29573331-29573353 ACCCAGAGGCACGTGTTGCCGGG + Intronic
1108484453 13:50910114-50910136 AACCAGGAACACGTGCTGCCGGG - Exonic
1110283238 13:73719827-73719849 AGGCAGGATCACGTGAAGCCAGG - Intronic
1111855418 13:93631245-93631267 ACCCAGGAAAAGGAGGAGCCAGG + Intronic
1113527220 13:110990086-110990108 ACCCAGAGACACGCGGAGCCTGG - Intergenic
1113611693 13:111650752-111650774 ACACAGGAGAACGTAGAGTCAGG + Intronic
1113861123 13:113488108-113488130 ATGCAGGAGCACATGGATCCAGG + Intronic
1113923698 13:113928842-113928864 ACCAAGGAGCACGGTGACCCAGG - Intergenic
1113961306 13:114127802-114127824 TCCCAGGAGCCCGTGGAGCTGGG + Intronic
1114287910 14:21262640-21262662 AGCCAGGATGACCTGGAGCCAGG - Intronic
1116961737 14:50973968-50973990 ACCTAGGGGCTCCTGGAGCCAGG + Intergenic
1119374153 14:74175463-74175485 CCCCAGGATCACTTGAAGCCAGG + Intronic
1122612870 14:102997847-102997869 AATCAGGATGACGTGGAGCCGGG + Intronic
1124617819 15:31255236-31255258 AGCCAGGAGCAGGGGCAGCCAGG + Intergenic
1125755433 15:42060995-42061017 AGCCAGCAGGAGGTGGAGCCAGG - Intergenic
1128106549 15:65049760-65049782 ACCCAGGAGCACGTGGAGCCTGG - Intronic
1128434027 15:67627993-67628015 CCCCAGGAGCACTTGGTGCTTGG - Intronic
1131918953 15:97302049-97302071 ATCCAGGAGCAGCTGGAACCAGG - Intergenic
1132363153 15:101235131-101235153 ACCCATGAGGACGTGGAGGTGGG - Exonic
1132782491 16:1635492-1635514 ACCTAGGAGGCCGTGGGGCCAGG + Intronic
1132854023 16:2036863-2036885 ACCGAGGAGCACGTGGAAGGTGG + Exonic
1133201586 16:4207354-4207376 ACCGAGGACCAGGGGGAGCCCGG - Intronic
1134014188 16:10877339-10877361 ACCCAGCAGGGCGTGGAGCCAGG - Exonic
1135261062 16:20981305-20981327 ACCCACAAGCACGTGGACCCAGG + Intronic
1137354292 16:47744629-47744651 ACCCAGGAACAGGAGAAGCCAGG + Intergenic
1138174521 16:54884534-54884556 ACCCAGGAAGAGGAGGAGCCAGG - Intergenic
1138599175 16:58045111-58045133 TGCCAGGAGCACGTGGAGCCAGG + Exonic
1139476868 16:67207228-67207250 CCACAGGAGTAGGTGGAGCCCGG + Exonic
1142195888 16:88739156-88739178 ACACAGGAGACCCTGGAGCCTGG - Intronic
1142750490 17:1984505-1984527 AGCCAGGAGCCCATGGTGCCTGG + Intronic
1143129172 17:4665290-4665312 ACACAGGTCCACGTGGAGGCTGG - Intergenic
1143759156 17:9088571-9088593 ACCCAGGAGCGGGTGGAGGTGGG - Intronic
1144408989 17:14981624-14981646 ACCCAGGAGCACGTGGTGCCTGG + Intergenic
1144670579 17:17130514-17130536 ACCCAGCAGCACACTGAGCCTGG - Intronic
1146287718 17:31585479-31585501 TCCCAGGAGGACGTGGGACCTGG + Intergenic
1146547352 17:33750432-33750454 ACTCAGGAGGCCCTGGAGCCTGG + Intronic
1146658712 17:34650406-34650428 ACCCAGGGGCAAGAGGGGCCTGG + Intergenic
1146683044 17:34822305-34822327 AACCAGGAGCAGGTGGGGGCTGG + Intergenic
1148352273 17:46949751-46949773 AGACTGGAGCAGGTGGAGCCTGG + Intronic
1148687791 17:49510298-49510320 GCACAAGAGCACCTGGAGCCAGG + Intronic
1149027408 17:52044165-52044187 ACCCAGGAGCAGATGGATCATGG - Intronic
1150237912 17:63608003-63608025 ACCCGGGGGCACATGTAGCCTGG - Exonic
1151507582 17:74539644-74539666 ACCGAGGTGAACCTGGAGCCAGG - Intergenic
1151515510 17:74592497-74592519 GCCAAGGAGCAGGAGGAGCCAGG + Exonic
1152267886 17:79306789-79306811 TCCCAGGTGCCCGTGGAGCTGGG - Intronic
1152643714 17:81459453-81459475 ACCCATGAGCAGGTGGGGCCTGG - Intronic
1152845496 17:82597184-82597206 ACCGAGGACCACATGGTGCCAGG - Intronic
1153972506 18:10239319-10239341 TCCCAGCAGCACGCAGAGCCGGG + Intergenic
1154500998 18:14998059-14998081 ACCCAGGAGCCCGCGGCCCCGGG - Intergenic
1159946119 18:74445999-74446021 ACCACGGGGCACGTGGGGCCAGG - Intronic
1159946241 18:74446743-74446765 CCCCAGGGGCACCTGGGGCCCGG + Exonic
1160065015 18:75566339-75566361 AGCCAGCAGCACATGGAGACAGG - Intergenic
1160952416 19:1674100-1674122 ACCCAGGAGGGCTGGGAGCCTGG - Intergenic
1161052518 19:2171945-2171967 ACCAGGAAGGACGTGGAGCCGGG - Intronic
1161579824 19:5074745-5074767 GCCCAGGCGCACGGGGAGGCGGG - Intronic
1161667763 19:5587349-5587371 TCCCAGGGCCACGTGGTGCCAGG - Exonic
1164145741 19:22511477-22511499 AGCCATGAGCACCTGAAGCCTGG + Intronic
1164721149 19:30432447-30432469 TTCCTGGAGCACGTGAAGCCAGG + Intronic
1165942799 19:39423632-39423654 CCCCAGGAGCAGGCAGAGCCAGG + Exonic
1166423487 19:42655898-42655920 CCCCAGGGTCACGTGGAGTCAGG - Intronic
1166863803 19:45824261-45824283 AAGCAGCAGCAGGTGGAGCCTGG - Intronic
1167465550 19:49649348-49649370 ACCCAGCAGCAGGTGCAGCCTGG + Intronic
925148096 2:1594505-1594527 CCCCAGGTGCTCGTGGAGCAAGG - Intergenic
925164694 2:1708814-1708836 CACCAAGAGCACGTGGAGTCTGG + Intronic
925254410 2:2470761-2470783 ACTCAAGAGCAAGTGGAGCCTGG + Intergenic
926344449 2:11932453-11932475 ACCCAGGAAGAGGAGGAGCCAGG + Intergenic
929405501 2:41637134-41637156 ACTCAGGAGCCCGTGGCACCAGG + Intergenic
932479048 2:72027730-72027752 CCCCAGGAGCAGGTGGGGGCAGG + Intergenic
933842247 2:86297248-86297270 ACCCAGGAGAGCTTGGAGCTTGG + Intronic
934530408 2:95083608-95083630 AGCCAGAAGCAGGAGGAGCCTGG - Intergenic
935414562 2:102802057-102802079 AACTAGGAGCAGGTGCAGCCTGG + Intronic
935724467 2:106010983-106011005 ACCCAGGAAGAGGAGGAGCCAGG - Intergenic
938251583 2:129819991-129820013 ACCATGGAGAACGTGGGGCCAGG + Intergenic
938322256 2:130373055-130373077 AACCAGGAGGACCTGGAGGCGGG + Intronic
944098237 2:195994002-195994024 ATCCAGGAGATCATGGAGCCTGG + Intronic
946760997 2:222992947-222992969 AGGCAGGAGCACCTGGAGCCTGG + Intergenic
946901792 2:224380082-224380104 ACCCAGGAGCCAGAGGAACCAGG - Exonic
947136251 2:226979422-226979444 ACCCAGGAACAGGAGGGGCCAGG + Intronic
948824616 2:240568333-240568355 AGCCAGGGGCGCGGGGAGCCGGG - Intronic
1169459201 20:5779888-5779910 ACCCAGTAGCTGGGGGAGCCAGG - Intronic
1170671647 20:18439850-18439872 ACCCAGCATCATGTGGAGCAGGG - Intronic
1171352130 20:24511365-24511387 ACACAGCACCATGTGGAGCCGGG - Intronic
1173957289 20:47043457-47043479 ACCCATGACCACGGGCAGCCAGG - Intronic
1175750558 20:61494087-61494109 CTCCAGGAGCAGGTGGAGACAGG + Intronic
1175875558 20:62227738-62227760 AGCCAGGAGCACGTGGCCCCTGG - Intergenic
1176104682 20:63380419-63380441 ACCAAGGAGCTCCTAGAGCCAGG + Intergenic
1176145079 20:63561909-63561931 AACCAGGAGCAGGTGCAGCCCGG - Exonic
1177875313 21:26625394-26625416 ACCTAGGAGCTCCTGGAGCAAGG - Intergenic
1179325513 21:40339299-40339321 GCCCACGATCACGTGGACCCTGG - Exonic
1179801544 21:43813580-43813602 GGCCAGGAGCAGGTGGTGCCGGG + Intergenic
1179889554 21:44328687-44328709 AGCCAGAAGCACGTCCAGCCCGG - Intergenic
1179931422 21:44573423-44573445 CCCCAGGCGCACGTGGAGGGTGG - Intronic
1180960172 22:19758983-19759005 ACCCAGGTGCAGGGGCAGCCAGG + Intronic
1181774015 22:25146861-25146883 ACCCAGGAGCTAGTTGAGCTGGG + Intronic
1183232883 22:36593812-36593834 CTCCAGGAGCACTTGGAGCTCGG + Intronic
1183409512 22:37646742-37646764 ACCCTGGCGCACTTGTAGCCTGG - Intronic
1183933648 22:41249738-41249760 ACCCATGTGCACGAGCAGCCTGG + Exonic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184256576 22:43290464-43290486 ACCCAGGCTGAAGTGGAGCCTGG - Intronic
1184607242 22:45581221-45581243 GCCCAGGGGCCCGGGGAGCCCGG - Intronic
1184773054 22:46609269-46609291 AGCCAGGAGAAGGTGGACCCAGG - Intronic
1184805997 22:46795261-46795283 ACCCATGAGCAGATGAAGCCAGG - Intronic
1184947233 22:47812186-47812208 GCCAAGGATCACCTGGAGCCAGG + Intergenic
1185376806 22:50486479-50486501 ACCCAGAATCACGGGGGGCCTGG + Intergenic
1185388521 22:50547270-50547292 AGCCAGGGGCGCGTGGAGTCTGG - Intergenic
1185388996 22:50548854-50548876 GCCCAGCAGCACGGAGAGCCCGG + Exonic
950288618 3:11765193-11765215 ACCCATGATCAAGTGGACCCAGG + Intergenic
950539453 3:13601502-13601524 ACTCAGGAGCACAAGGTGCCAGG - Intronic
952407802 3:33020050-33020072 ATCCCAGAGCACGTGTAGCCTGG - Intronic
952834907 3:37594261-37594283 TACCAGGAGCAAGTGGAGCTGGG + Intronic
954220896 3:49153306-49153328 AGCCAGGAGGACATGGAGGCGGG + Intergenic
954576082 3:51677069-51677091 AGCCACGAGCACCTGAAGCCTGG - Intronic
958436381 3:94101218-94101240 AGTCAGGATCACTTGGAGCCAGG - Intronic
960155391 3:114292954-114292976 ACCCAGAAGCATCTGAAGCCTGG - Intronic
961164227 3:124752384-124752406 ACCCAGGAGGATGGGAAGCCAGG - Intergenic
961322552 3:126085775-126085797 ACCCAGGAGCACGTTTTGGCTGG - Intronic
961665097 3:128489529-128489551 ACGCTGGAGCGCGCGGAGCCCGG + Intronic
966402698 3:179563285-179563307 CCCGAGGAGCACGGCGAGCCGGG - Intronic
966415090 3:179681134-179681156 CCATAGGAGCACTTGGAGCCAGG + Intronic
966919818 3:184604191-184604213 AGCCCGGAGCACTGGGAGCCAGG - Intronic
967531021 3:190549184-190549206 ACCCAGGAACAAGAGGAACCAGG + Intronic
968142869 3:196273229-196273251 ACCTAGGAGCTCCTTGAGCCAGG - Intronic
968634811 4:1672397-1672419 ACCCAGGAACCCATGGACCCAGG + Intronic
968817334 4:2828856-2828878 CCCCGGGAGCACGGGGCGCCTGG - Intronic
969114979 4:4865806-4865828 AGCCAGGAGGTCCTGGAGCCGGG - Intergenic
969449209 4:7263565-7263587 ATGCAGGAGAACCTGGAGCCAGG - Intronic
970575437 4:17422570-17422592 CTCCAGGAGCACCTGGAGCACGG - Intergenic
971998280 4:33995189-33995211 ACCCAGGAAGAGGAGGAGCCAGG - Intergenic
974157939 4:58098959-58098981 ACCCAGGAAAATGTGGGGCCAGG + Intergenic
974683413 4:65194390-65194412 ACCTAGGAGCTCCTCGAGCCAGG - Intergenic
976511230 4:85911262-85911284 AGCCAGGGACAAGTGGAGCCCGG - Intronic
980826714 4:138082085-138082107 ACCCAGGAACAGGAGGGGCCAGG + Intergenic
982478194 4:155878098-155878120 ACCCAGGAACAGGAGAAGCCAGG + Intronic
984206602 4:176793201-176793223 ACCCTGGACCACGTGCAGCGGGG + Intergenic
985509718 5:306214-306236 ACCCAGGAGCCAGGGGAGCTGGG + Intronic
990245491 5:53859685-53859707 ACCCAAGAACTCGTGGAGCATGG + Intergenic
992609804 5:78497379-78497401 AGCCAGGAGAAGGTGTAGCCCGG - Intronic
992847089 5:80761281-80761303 ACCCAGGAGGAGGAGGGGCCAGG + Intronic
993843421 5:92909465-92909487 ATCAAGGAGCAGGTGGTGCCTGG + Intergenic
994175174 5:96702943-96702965 ACCCGGGAGCACGCGCGGCCTGG - Intronic
995742497 5:115369390-115369412 ACCTAGGAGCTCCCGGAGCCAGG + Intergenic
998307867 5:141096763-141096785 CACCAGGAGCACGTGCAGCGTGG - Exonic
998310408 5:141123962-141123984 CACCAGGAGCACGTGCAGCGTGG - Exonic
998311566 5:141137398-141137420 CACCAGGAGCACGTGCAGCGTGG - Exonic
998312848 5:141152218-141152240 CACCAGGAGCACGTGCAGCGTGG - Exonic
998313542 5:141157967-141157989 CACCAGGAGCACGTGCAGCGTGG - Intergenic
998315036 5:141174802-141174824 CACCAGGAGCACGTGCAGCGTGG - Exonic
998315613 5:141180004-141180026 CACCAGGAGCACGTGCAGCGTGG - Exonic
998316153 5:141184526-141184548 CACCAGGAGCACGTGCAGCGTGG - Exonic
998316711 5:141189285-141189307 CACCAGGAGCACGTGCAGCGTGG - Exonic
998318975 5:141210874-141210896 CACCAGGAGCACGTGCAGCGTGG - Exonic
998319540 5:141216090-141216112 CACCAGGAGCACGTGCAGCGTGG - Exonic
998320517 5:141225472-141225494 CACCAGGAGCACGTGCAGCGTGG - Exonic
998321530 5:141236521-141236543 CACCAGGAGCACGTGCAGCGTGG - Intergenic
998322090 5:141241877-141241899 CACCAGGAGCACGTGCAGCGTGG - Intergenic
1000858947 5:166433428-166433450 ACCCAGGAGCAGGAGGATCTTGG - Intergenic
1001679736 5:173547386-173547408 CCTCAGGAGCAGGTGGAACCTGG + Intergenic
1002443576 5:179276541-179276563 ACACAGGAGCACATGCAGCCTGG + Intronic
1003556157 6:7141806-7141828 GCCCAGGAGAACGGGCAGCCGGG + Intronic
1003623312 6:7721309-7721331 AACCAGTGGCATGTGGAGCCAGG - Intergenic
1004934076 6:20490659-20490681 AGCCAGGAGATCTTGGAGCCTGG - Exonic
1006073763 6:31516168-31516190 GCCCAGGAGCACCTGCAGGCAGG - Intergenic
1006739393 6:36296655-36296677 ACCCAGGAGAAAGTAGAGACAGG - Intronic
1007327440 6:41073168-41073190 GCCCAGGCGCCCGTCGAGCCCGG + Intronic
1010465668 6:76165378-76165400 ACCCGGGAGGGAGTGGAGCCAGG + Intergenic
1012231101 6:96762160-96762182 ACCTGGGAGCTCCTGGAGCCAGG - Intergenic
1012694189 6:102356257-102356279 ACCCAGGAGGAGGAGGGGCCAGG + Intergenic
1015143395 6:129959454-129959476 ACCTAGGAGCTCCTGGAGCCAGG + Intergenic
1015394888 6:132722300-132722322 AACCAGGAGCACATGAAGGCAGG + Intergenic
1015625846 6:135180921-135180943 GCCCGGGAGCACGCGGAGCCGGG + Intergenic
1015999606 6:139029365-139029387 CACCAGGGGCTCGTGGAGCCCGG + Intronic
1017211813 6:151865471-151865493 ACCCAGGATCGCATGGAGCTTGG + Intronic
1018290461 6:162287907-162287929 ACCCAGCAGCAGATGGAACCTGG + Intronic
1018346489 6:162904439-162904461 ACCTGGGAGCACGTGGAGTGAGG + Intronic
1019173401 6:170147418-170147440 AGCCAGGACCAGGTGGAGCCAGG + Intergenic
1019174713 6:170154222-170154244 ACCCAGGAGGGCGAGGAGCTAGG - Intergenic
1019623440 7:2003552-2003574 CCACGGGAGCACCTGGAGCCTGG - Intronic
1021036868 7:15810111-15810133 ACCAAGCAGCATGGGGAGCCTGG + Intergenic
1022514182 7:30964960-30964982 ACTCAGGAGCAGGTGCAGCAAGG - Intronic
1025959327 7:66205954-66205976 ACCCAGGGACACCTGGAGCGGGG - Intronic
1026227695 7:68457228-68457250 AACCAGGAGCACGGTGACCCAGG + Intergenic
1029273943 7:99393242-99393264 GCCCAGGTGCTAGTGGAGCCTGG + Intronic
1030172231 7:106615018-106615040 ACCCAGGATCACACGGGGCCAGG - Intergenic
1031834609 7:126668094-126668116 ACCCAGGAAGAGGAGGAGCCCGG - Intronic
1032198410 7:129802754-129802776 ACACAGGAGGGAGTGGAGCCTGG + Intergenic
1032580075 7:133096238-133096260 ACCCAGGAACAGGAGAAGCCAGG + Intergenic
1033096487 7:138436514-138436536 ACACATGTGCACTTGGAGCCTGG - Intergenic
1033210140 7:139454174-139454196 ACCCAGGAGTGCCTGGAGACTGG + Exonic
1034996049 7:155577880-155577902 GCCCGGGAGCAGGTAGAGCCAGG - Intergenic
1034996061 7:155577931-155577953 GCCCGGGAGCAGGTAGAGCCAGG - Intergenic
1035310459 7:157964581-157964603 ACACAGGAGCAGGTGCAGCAGGG + Intronic
1035776815 8:2194347-2194369 AGCCAGGAGCATGTGGATTCTGG + Intergenic
1037273763 8:17156622-17156644 GCCCAGGAGCCCGTCCAGCCAGG + Exonic
1040286683 8:46104008-46104030 ACGCAGGAGGACGTTGAGGCAGG - Intergenic
1040300311 8:46184588-46184610 ACTCAGGAGAACGTTGAGACAGG - Intergenic
1040302251 8:46194144-46194166 ACTCAGGAGGACGTTGAGGCAGG + Intergenic
1040314536 8:46254079-46254101 ACTCAGAAGGACGTTGAGCCAGG + Intergenic
1040315294 8:46257754-46257776 ACTCAGGGGCACATGGAGACAGG + Intergenic
1040332087 8:46390905-46390927 ACTCAGGAGAACGTTGAGGCAGG + Intergenic
1040341051 8:46441298-46441320 ACTCAGGGGGACGTTGAGCCAGG - Intergenic
1040546397 8:48401417-48401439 ATCCAGCAGCCAGTGGAGCCTGG + Intergenic
1044580368 8:93820146-93820168 AGGCAGGAGCACCAGGAGCCAGG - Intergenic
1044729782 8:95220526-95220548 AGCCAGGAGCAGGAGGAGCAGGG - Intergenic
1049004840 8:139847962-139847984 GCCCTGGGGCACGTGGGGCCTGG + Intronic
1049211275 8:141387478-141387500 ACTCAGGGGCAGGGGGAGCCAGG + Intergenic
1049221928 8:141432341-141432363 ACACAGGAGCTGGGGGAGCCAGG - Exonic
1049317578 8:141977457-141977479 AGCCAAGAGCACTTGGAGCCTGG - Intergenic
1049615446 8:143573884-143573906 ACCCTGAAGCCCGGGGAGCCAGG + Intergenic
1049689816 8:143953543-143953565 ACCCCGAACCAGGTGGAGCCCGG + Intronic
1050591485 9:7164685-7164707 ACCCAGGTGGAAGTGGAGCAGGG - Intergenic
1050873008 9:10599019-10599041 ACCCAGTTGCACGTGAAGCTGGG - Intronic
1053013306 9:34647572-34647594 CCCCAGCAGCAGTTGGAGCCAGG - Intronic
1053015510 9:34659854-34659876 CACCTGGAGCACCTGGAGCCCGG + Exonic
1053229942 9:36400290-36400312 ACCCAGGAGAACGCGGAACCCGG - Intronic
1054905827 9:70413212-70413234 ACCAAGGAGCACGGTGACCCGGG - Exonic
1054976335 9:71149930-71149952 ACCCAGGCTGAAGTGGAGCCTGG - Intronic
1055645526 9:78358237-78358259 ACCCAGGAGCTTCTTGAGCCAGG + Intergenic
1056126166 9:83538068-83538090 ATCCAGGTGCGCGTGGAACCGGG - Exonic
1057046253 9:91888551-91888573 ACCCAGGAACAAGTGAAGCCAGG + Intronic
1057792014 9:98130781-98130803 CCCTAGGAACACCTGGAGCCAGG - Intronic
1058663114 9:107283746-107283768 CGCCAGGAGCTCGTGGGGCCGGG + Intronic
1059443292 9:114323105-114323127 ACCAGGAGGCACGTGGAGCCAGG - Exonic
1059444484 9:114329876-114329898 ACCAGGAGGCACGTGGAGCCAGG - Exonic
1059449909 9:114364188-114364210 AGGCAGGAGAACCTGGAGCCAGG - Intronic
1060251404 9:121989193-121989215 ACCTGGAAGCACGTGGGGCCCGG + Exonic
1060672836 9:125485435-125485457 ATTCAGGAGGCCGTGGAGCCAGG - Intronic
1061193890 9:129097105-129097127 ACCTGGGAGCACCTGGAGCCAGG - Intronic
1061236517 9:129346197-129346219 ACCCAGGCACAGGTGAAGCCTGG - Intergenic
1061453523 9:130681687-130681709 ACCCAGGAGCGCGCGGGGCCCGG - Exonic
1061676264 9:132217610-132217632 ACTCAGGAGCTCCTAGAGCCAGG - Intronic
1062212343 9:135371929-135371951 ACCCTGGAGGCCGTGGGGCCTGG - Intergenic
1062286986 9:135777740-135777762 ACCCAGGAGCCAGAGGAGCTGGG - Intronic
1062483848 9:136764564-136764586 GCCCAGGAGCAGGTGCACCCAGG - Intronic
1185819422 X:3187259-3187281 ACCATGGTGGACGTGGAGCCAGG - Intergenic
1188929378 X:36087622-36087644 ACCCAGGATCACTGGGAGCATGG + Intronic
1190944005 X:55073088-55073110 CCCCAGTAGCACCTGGAACCCGG - Intergenic
1192805072 X:74501530-74501552 ACCCTGGAGCAGGTAGAGCATGG + Intronic
1194662526 X:96642832-96642854 ACCCAGGAGCAGGAGAGGCCAGG + Intergenic
1195577455 X:106467637-106467659 ACCCGGGAGCAGGAGGACCCAGG - Intergenic
1197869149 X:131049568-131049590 ACCCAGGAGCAGGTAGAACAAGG + Intergenic
1200070235 X:153525627-153525649 CCCCAGGAGCCAGAGGAGCCAGG - Intronic
1200397491 X:155999668-155999690 CCCCAGAAGCAGCTGGAGCCTGG - Intronic