ID: 1128107574

View in Genome Browser
Species Human (GRCh38)
Location 15:65055898-65055920
Sequence CAGAGGCAGGAGAGGGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2085
Summary {0: 2, 1: 3, 2: 27, 3: 224, 4: 1829}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128107574 Original CRISPR CAGAGGCAGGAGAGGGCAGG GGG Intronic
Too many off-targets to display for this crispr