ID: 1128107984

View in Genome Browser
Species Human (GRCh38)
Location 15:65058443-65058465
Sequence CCTGCTGCTGGGCAACAAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128107984_1128107993 28 Left 1128107984 15:65058443-65058465 CCAGCTTGTTGCCCAGCAGCAGG 0: 1
1: 0
2: 2
3: 36
4: 266
Right 1128107993 15:65058494-65058516 CGTGCAAGGCAAGCAGCTCCAGG 0: 1
1: 0
2: 1
3: 3
4: 168
1128107984_1128107991 14 Left 1128107984 15:65058443-65058465 CCAGCTTGTTGCCCAGCAGCAGG 0: 1
1: 0
2: 2
3: 36
4: 266
Right 1128107991 15:65058480-65058502 CTGTGTCTCCTTCGCGTGCAAGG 0: 1
1: 0
2: 1
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128107984 Original CRISPR CCTGCTGCTGGGCAACAAGC TGG (reversed) Exonic
900418854 1:2546989-2547011 CCTGGCGCTAGGCACCAAGCAGG - Intergenic
900705181 1:4076065-4076087 CCTGCTGCTGGGCTCCATGGTGG - Intergenic
902232598 1:15037187-15037209 CCTGCTGCTGGGCATGGGGCTGG - Intronic
902447840 1:16478391-16478413 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902467740 1:16628604-16628626 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902506840 1:16944124-16944146 CCTGCTGCTGGGCCACCTGCAGG - Exonic
902565543 1:17308810-17308832 CCTGCTGCTGGCTAGCAAGGAGG + Intronic
903056131 1:20637454-20637476 ACGGCTCCTGGGCAACTAGCAGG - Intronic
903329321 1:22589079-22589101 CCTGCTGGTGGCCAACCTGCTGG + Exonic
904972250 1:34428067-34428089 GCTGCTGCTGGTCAACCAGGAGG - Intergenic
905581393 1:39085050-39085072 GCTGCTGCTTGGCAAAGAGCTGG - Intronic
905663299 1:39745175-39745197 CCTGTCGCTGGGCATCCAGCTGG + Intronic
905892208 1:41524579-41524601 TCTGCCACTGGGCACCAAGCTGG + Intronic
907251628 1:53143328-53143350 CCTGGTGCTGGGCACCCTGCAGG + Intergenic
907270920 1:53290718-53290740 GCTGCTGCTTGGGAAGAAGCTGG - Intronic
907284381 1:53370712-53370734 ACTGCTGCTGGGCAGCGGGCAGG - Intergenic
908160604 1:61404241-61404263 CCTGATGCTGGTCAGCAGGCTGG + Exonic
909299685 1:73996543-73996565 CCTGGAGCAGGGCAACATGCTGG - Intergenic
910720014 1:90275468-90275490 CATGCTGCTGGTCAACAGGTGGG - Intergenic
913673162 1:121116921-121116943 CCTGCTGCTGCCCGGCAAGCTGG - Intergenic
915653336 1:157335925-157335947 CTTGCTGGTGGGCAGGAAGCAGG + Intergenic
915684237 1:157615582-157615604 CTTGCTGGTGGGCAAGAAGCAGG - Intergenic
915835395 1:159171812-159171834 CCTGCTGCTGGGCGCCCGGCGGG + Exonic
917525829 1:175787703-175787725 CATCCTGCAGGGCAAAAAGCTGG + Intergenic
919341009 1:196306578-196306600 CCTACTGCTCTGCAGCAAGCAGG + Intronic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
920736589 1:208538321-208538343 CATGATGCTAGGGAACAAGCCGG - Intergenic
922756088 1:228097694-228097716 CCTGGTGTTCGCCAACAAGCAGG + Exonic
923452931 1:234136777-234136799 CCTGCTGCAGGTCAACAGGCTGG - Intronic
924625435 1:245693364-245693386 CCCAGTGCTGGGCACCAAGCAGG - Intronic
924796695 1:247297733-247297755 CCTGCTGCATGGCATCAACCTGG + Exonic
1064116257 10:12579920-12579942 CCTGAGCCAGGGCAACAAGCAGG - Intronic
1065239081 10:23687212-23687234 AATGATGCTGGGCTACAAGCAGG - Intergenic
1066054702 10:31669876-31669898 CCTGCTGCTGTGCAGCAACTTGG - Intergenic
1067299239 10:44994056-44994078 GCTGCTGCTGGGCATTGAGCGGG - Exonic
1067753322 10:48985896-48985918 CCTGCTTCTGGGCCCCAGGCAGG - Intergenic
1068940997 10:62681228-62681250 GTTGCTGCTGGGCCACCAGCAGG - Intergenic
1068971396 10:62962118-62962140 CCTGCTGCTGAGCAAAGAGGAGG - Intergenic
1069411162 10:68154839-68154861 CATGGTGCTGGGCACAAAGCAGG + Intronic
1070747956 10:78946217-78946239 CCTGCTGCTGGGGAGCAGCCTGG - Intergenic
1071251357 10:83823012-83823034 CCGGCTGCTGGGATGCAAGCTGG + Intergenic
1071849551 10:89554760-89554782 CCTGCTGTTGAGCAAAGAGCAGG - Intronic
1072317923 10:94221700-94221722 ACTCCAGCTGGGCAACAAGAGGG + Intronic
1072726248 10:97815904-97815926 CCTGCTGCTGTGTAGCAGGCTGG - Intergenic
1073330274 10:102665920-102665942 CCTGCTGCAGGGCACTGAGCTGG + Intergenic
1073363680 10:102919434-102919456 ACTGCTGCTGGGCAACGTGCTGG + Exonic
1073480592 10:103784027-103784049 CCTGCAGCTGGGCACCAGGGTGG - Intronic
1074819645 10:117168508-117168530 CCTGCTGCTGGGGAACGTGGAGG - Intergenic
1075486149 10:122823323-122823345 CCTCCTGCAGGTCAGCAAGCTGG + Intergenic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1076546522 10:131249091-131249113 CCTGATGCTGGGAATCCAGCAGG + Intronic
1076571866 10:131438429-131438451 CCAGCTGCTGGGCAAGGAGGAGG + Intergenic
1076817285 10:132921210-132921232 CCGGCTGCTGGGCACTGAGCTGG + Intronic
1077433746 11:2528411-2528433 GCTGCTGCTGGGACACCAGCAGG - Intronic
1077633740 11:3827787-3827809 CCTGCTGGTGGGCACCAAGAAGG - Exonic
1078050430 11:7960954-7960976 CCTGCTGCTGGAGAGCAAACTGG - Exonic
1080651366 11:34225283-34225305 CCTGGTCCTGGGCCAAAAGCCGG + Intronic
1081692435 11:45087493-45087515 CCTGCAGCTGGACAAGCAGCAGG - Intergenic
1081786323 11:45750391-45750413 CCTGCTGCATGGCTGCAAGCAGG + Intergenic
1083170715 11:60922664-60922686 CCTACTGCTGGGCAATGAGGAGG - Exonic
1084971519 11:72774731-72774753 CCTGCTCCTCGGGAACAAACTGG + Intronic
1086457899 11:86977376-86977398 GCTGCTTCTGGGGAACCAGCTGG + Intergenic
1089138729 11:116269857-116269879 CCTGCTGCTGGGAGAGAAGCAGG + Intergenic
1092427006 12:8382867-8382889 CCAGCTGCTGGTCTACAAGATGG - Intergenic
1094192919 12:27715166-27715188 ACTCCAGCTGGGCAACAAGTGGG - Intronic
1096214867 12:49793225-49793247 CCTGGTGCTTGGCACCAAGATGG + Intronic
1097559790 12:61188943-61188965 CCAGCTGGCGGGCAACAAGATGG + Intergenic
1101375359 12:104166740-104166762 CCTGCAGCTGTGCAACATGGTGG + Intergenic
1102418844 12:112788041-112788063 CCTGCTGCAGTGCCACAGGCTGG + Intronic
1103729504 12:123017849-123017871 CCTGCTGCTGGGGAACATGGGGG + Intronic
1104017641 12:124971388-124971410 CCTGCTGCTGCGGTACAAGGTGG - Exonic
1104866957 12:131961441-131961463 CCTGCTGCTGCTGAACCAGCTGG - Exonic
1104885506 12:132104809-132104831 CCTGCTGCTGCTGAACCAGCTGG - Exonic
1104946759 12:132418119-132418141 CCAGCTGCTGGGGAAGTAGCTGG - Intergenic
1105502837 13:20988195-20988217 CCTGCTGCTGCGCAGCAAGTCGG - Exonic
1107749145 13:43545597-43545619 CCTGCTGCTTGGCAGAAAACAGG - Intronic
1107965039 13:45590124-45590146 CCTGCAGCTGGGCACGTAGCAGG + Intronic
1108269487 13:48745759-48745781 CCTGCCCCAGGGCAACAAGAAGG + Intergenic
1108356222 13:49630798-49630820 CTTGGTGCTGGCCAACAAGCAGG + Exonic
1113628790 13:111866008-111866030 CCTGCGGCAGGACAACCAGCCGG - Intergenic
1113651376 13:112036336-112036358 CCTGCTGCTGAGGAAAATGCAGG - Intergenic
1117424046 14:55577480-55577502 CCTGCAGATGGAGAACAAGCTGG - Intronic
1119389431 14:74281043-74281065 CCTGGCCCTGGGCATCAAGCAGG - Intergenic
1122206387 14:100149990-100150012 CCTGCTGGGTGGGAACAAGCTGG - Intronic
1122592504 14:102864881-102864903 CCTACTGCTGGGCACTAACCTGG - Intronic
1123124680 14:105937896-105937918 CCTGCTGCTGCACATCCAGCTGG + Intergenic
1124232530 15:27957631-27957653 CCTGCTGCTGGGGAAGGTGCTGG - Exonic
1124426070 15:29564201-29564223 CTTGATGCTGGGAAACAAGTGGG - Intronic
1125574324 15:40744979-40745001 GCTGCTGCTCAACAACAAGCTGG - Exonic
1127622375 15:60746333-60746355 GCTGCAACTGGGCAGCAAGCTGG - Intronic
1128107984 15:65058443-65058465 CCTGCTGCTGGGCAACAAGCTGG - Exonic
1128468257 15:67930555-67930577 CCTGCTGATGGGGAACAAGCTGG + Intergenic
1129718110 15:77863496-77863518 CCTGGTGCTGGGCATACAGCAGG + Intergenic
1130331306 15:82924401-82924423 CCTGGTGCATGGGAACAAGCAGG - Intronic
1130460805 15:84157275-84157297 CCTGGTGCTGGGCATACAGCAGG - Intergenic
1130570331 15:85036961-85036983 CCTGCCACTGGGGAAGAAGCTGG - Intronic
1130982148 15:88820103-88820125 AATGCTGCTGGGCACCATGCTGG + Intronic
1132849018 16:2015875-2015897 CCTGTTCCTGGGCACCAGGCTGG + Intronic
1132878954 16:2152867-2152889 CATGCTGCTGGGGAACAAGGTGG + Exonic
1133371252 16:5247498-5247520 CCAGCTGCTGGTCTACAAGATGG + Intergenic
1134362327 16:13543093-13543115 CCAGGTGCTGGGCAAGATGCTGG + Intergenic
1135562339 16:23486441-23486463 CCTGTTGCTGGGACCCAAGCTGG + Intronic
1136156108 16:28383331-28383353 CCTGCTGCTGCGCAGCCTGCAGG - Exonic
1136206978 16:28731957-28731979 CCTGCTGCTGCGCAGCCTGCAGG + Exonic
1136569176 16:31086652-31086674 CCTCCTGCTGGGCCACTGGCTGG - Exonic
1137440922 16:48497996-48498018 GCTGCTGCTGGGCTAGAAGAGGG - Intergenic
1137596065 16:49724738-49724760 AATGCTGCTGTGCAACAAGCCGG - Intronic
1138336882 16:56260429-56260451 CCGGCTGCTGGGCCAGAAGCAGG + Intronic
1138544445 16:57707368-57707390 CCTGGGGCTGGGGAACCAGCAGG - Intronic
1139298349 16:65922437-65922459 CCTGGTGCTGGGCTAGAGGCTGG - Intergenic
1140296347 16:73712835-73712857 CCTATTGCTGGGCCACAAACTGG - Intergenic
1141164655 16:81652420-81652442 CCTGCTGCTTGGCATGGAGCCGG - Intronic
1141671600 16:85494944-85494966 CCTGCTGCTTGGAAACAGGTGGG + Intergenic
1142227386 16:88884265-88884287 CCTGCTGCTGGGCCCCCACCGGG + Intronic
1142713138 17:1734149-1734171 CGTGCTGCGGGGCCTCAAGCTGG - Exonic
1143783112 17:9239818-9239840 CCTGCTGCTGGGCAACGCGGAGG + Exonic
1144676317 17:17164483-17164505 CCTGCTGCTGGAGAAGACGCAGG + Intronic
1145813200 17:27777219-27777241 CCTGGTGCTGGGCACTAGGCTGG - Intronic
1146539299 17:33680641-33680663 TCTCCTGCTGGGCGCCAAGCAGG + Intronic
1146640932 17:34541093-34541115 CCTGCTGCTGGGGAAGGAGGCGG - Intergenic
1146695230 17:34903864-34903886 CCTTCTCCTGGGAAACAAACTGG - Intergenic
1147522717 17:41189936-41189958 CCTGCTGCAGGACAACCTGCTGG + Exonic
1147530427 17:41271360-41271382 CCTGCTGCAGGACAACCTGCTGG + Intergenic
1147545816 17:41400892-41400914 CATTCTGCAGGGCAACCAGCAGG - Intergenic
1147845265 17:43400122-43400144 GCTGGTGCTGGCCAACAAGCAGG + Exonic
1148034161 17:44645682-44645704 CATGCTGCTGAGCTATAAGCAGG + Intergenic
1149560927 17:57607509-57607531 CCTGGTGCTTGGCCACACGCTGG + Intronic
1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG + Intronic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150504049 17:65680544-65680566 CCTGATGCTGGGCTAAACGCTGG + Intronic
1150973315 17:70055475-70055497 CCTGCTTCTGGGGAAGAAACAGG - Intronic
1151327424 17:73387892-73387914 CCTGCCGCTGGGCAGCTCGCGGG + Exonic
1151543141 17:74775656-74775678 CTTGCTGCTGGGGAAGAAGGTGG - Exonic
1151727390 17:75892811-75892833 CCTGCTGCTGGGTAACCTCCAGG + Exonic
1152649132 17:81483869-81483891 CCTGGTGCTGCCCAAGAAGCAGG - Intergenic
1152744736 17:82033481-82033503 CCTCCTGGTGGGCACCAAGCTGG + Exonic
1152772436 17:82178587-82178609 CCTGCAGCTTGGCAGCAACCTGG + Exonic
1155787224 18:29915676-29915698 AGTGCTTCTGGGCAACCAGCAGG - Intergenic
1156547828 18:37983149-37983171 GCTGCTGCTTCGCAACAACCAGG - Intergenic
1157283307 18:46360268-46360290 CCTGCTGCTGGGCACAGAGGCGG + Intronic
1160157142 18:76442580-76442602 CCTGCTGCGGAGCAGCAAGAAGG - Exonic
1160358713 18:78251338-78251360 CCTACTGCTGATCAACAACCTGG - Intergenic
1160816348 19:1037708-1037730 CCTGCAGATGGGCTACACGCAGG + Exonic
1161699331 19:5786419-5786441 ACTGCTGCTGTGCATGAAGCTGG + Intronic
1162379504 19:10323211-10323233 CCTGCAGCTGCTCAACAACCTGG - Exonic
1162405345 19:10469724-10469746 CCGTCTGCTGGGGAACAAGTAGG - Intergenic
1162446840 19:10728593-10728615 CCAGTTGCTGGGCACCCAGCAGG + Intronic
1162735951 19:12747190-12747212 CCTGCAGATGTGCAACATGCTGG + Exonic
1164216530 19:23155581-23155603 CCTGCTACTTGGCCACAAGACGG - Intergenic
1164483489 19:28633878-28633900 CCATCTGCTGTGCCACAAGCTGG + Intergenic
1164605511 19:29595192-29595214 CCTGCTGCAGGGGAAGAAGGAGG + Intergenic
1165061247 19:33206297-33206319 CCTGCTGCTGGTCATCGCGCTGG + Exonic
1166748507 19:45153467-45153489 CTCGGTGCTGGGCAACAAGCCGG - Exonic
1167457054 19:49601780-49601802 CCTGCATCTGGCCAAAAAGCAGG + Exonic
927979826 2:27368024-27368046 CCTGCTGCAAGGCACGAAGCAGG + Exonic
932596895 2:73099565-73099587 CCTGGTGAAGGGCAAGAAGCTGG + Intronic
933573031 2:84035977-84035999 CCTGCTGCTCAGCAATAAGCAGG + Intergenic
935342282 2:102068802-102068824 CCTGTGGATGGGCAACAAGGGGG - Intronic
935721112 2:105980162-105980184 CCTGCTACTTGGCCACAAGATGG - Intergenic
936981054 2:118265729-118265751 GCTGCTGATGCACAACAAGCAGG - Intergenic
938171750 2:129084162-129084184 CCTCATGCTGGGGAACAAGCTGG + Intergenic
938727328 2:134120270-134120292 GCTGCTGCTGCCCAACAAGGAGG + Exonic
938886245 2:135651984-135652006 CCTGCTGCTGGAGCACAGGCTGG - Exonic
940658673 2:156519957-156519979 CCAGATGCTGGGCAAGAACCTGG - Intronic
941540868 2:166782555-166782577 CCTGTTACTGGGGAACTAGCTGG - Intergenic
941755881 2:169185136-169185158 CCTGCTGCTTGTCATCACGCTGG + Intronic
942950379 2:181714346-181714368 GCTGCTGCTGGAGCACAAGCAGG + Intergenic
947312707 2:228821567-228821589 CCAGCTGGTTGGCAACAAGATGG + Intergenic
947463985 2:230325450-230325472 ACTGCTCTTGGGCAGCAAGCAGG - Intergenic
948318730 2:237051964-237051986 CCTGCTGCAGCGCAATGAGCTGG - Intergenic
948385325 2:237577289-237577311 GATGCTGGTGGGCAACAAGACGG - Exonic
948454949 2:238100596-238100618 CCAGCTGCCCGGCAACCAGCGGG + Exonic
948632019 2:239308336-239308358 CCTGTTGCTGAGTACCAAGCAGG - Intronic
1169040833 20:2494019-2494041 CTGGCTGCAGGGAAACAAGCTGG - Exonic
1172130672 20:32652746-32652768 CCTGCTGCTGGGCAATTTGGTGG + Intergenic
1172606509 20:36217694-36217716 CCTGCTGCTGGGCCACATTCTGG + Intronic
1173352921 20:42261515-42261537 CCTGGGGATGGGCTACAAGCAGG + Intronic
1174576946 20:51543267-51543289 CCAGGTGCTGGGCACCCAGCCGG + Intronic
1175532733 20:59685191-59685213 CCAGCTGCTGGGCAGGAAGGGGG - Intronic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1176172393 20:63701838-63701860 CTTGGTGCTGGCCAACAAGCAGG - Exonic
1176519256 21:7812531-7812553 CCTGCTACTTGGCAACAAACAGG - Intergenic
1177705979 21:24705393-24705415 ACTGCTACTTGGCAATAAGCTGG + Intergenic
1178653284 21:34442544-34442566 CCTGCTACTTGGCAACAAACAGG - Intergenic
1179103412 21:38376766-38376788 CCAGCTGCTGGGCCATAACCTGG - Intergenic
1179486716 21:41715280-41715302 CCTGCTGATGGGAAACAAAGCGG + Intergenic
1179654470 21:42836903-42836925 CCCGCTGCTGAGCACGAAGCAGG - Intergenic
1180693593 22:17738115-17738137 CCTGCTGCTGGCCAAGAAGGTGG - Exonic
1180800309 22:18628595-18628617 GCTGCTGCTGGGCACCATGGAGG - Intergenic
1180851543 22:19024159-19024181 GCTGCTGCTGGGCACCATGGAGG - Intergenic
1180880136 22:19197717-19197739 CCTGCTGCTGAGCAGACAGCAGG - Intronic
1181221407 22:21366671-21366693 GCTGCTGCTGGGCACCATGGAGG + Intergenic
1181461665 22:23089443-23089465 CCTGCTGCTAGGCATAGAGCTGG - Intronic
1181480926 22:23198627-23198649 CGTGATGCTGGGCACCATGCTGG + Intronic
1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG + Intergenic
1181618400 22:24070934-24070956 ACTGCTGATGGGCATCGAGCAGG + Exonic
1182296486 22:29313519-29313541 CCTCGTGGTAGGCAACAAGCGGG - Exonic
1182699318 22:32221781-32221803 ACTCCAGCTGGGCAACAAGATGG - Intronic
1183332983 22:37231327-37231349 CATCCTGGTGGGCACCAAGCTGG - Exonic
1183387811 22:37525177-37525199 CCTTGGGCTGGGCAAGAAGCTGG + Intergenic
1184309067 22:43629460-43629482 CCTGATGCTGGGCAGCGAACTGG - Intronic
1184329579 22:43818698-43818720 CCTACACCTGGGCAACAGGCAGG + Intergenic
951708385 3:25566554-25566576 GCTGCAGCTGGGCACCAAGTTGG - Intronic
953257365 3:41304881-41304903 CCTGCAGCTGGGCCAAATGCAGG - Intronic
954410226 3:50367362-50367384 CCTGCTGCTGGGCACACTGCGGG + Intronic
954782699 3:53072930-53072952 CCTGCCGCACAGCAACAAGCAGG + Intronic
957297861 3:78355225-78355247 GCTGCTTCTGGGCAACTGGCAGG + Intergenic
960635566 3:119781419-119781441 CCTGCTGCTAGGGAATAAGAAGG + Intronic
961039062 3:123664141-123664163 ACTGCTGGTGGAGAACAAGCTGG - Exonic
961073599 3:123961399-123961421 CCTGCCGGTGGGTGACAAGCCGG - Exonic
961282432 3:125774523-125774545 CCAGCTGCTGGTCTACAAGATGG + Intergenic
962251631 3:133839522-133839544 CATGCTGGTGGGCAACAAGACGG - Exonic
962789668 3:138799719-138799741 CATGCTGCTGCACAACAGGCTGG - Intronic
963635851 3:147794717-147794739 TCTGCTCCTGTGCAGCAAGCAGG + Intergenic
965991341 3:174822281-174822303 CCAGCTCCTGTGCAATAAGCAGG - Intronic
968693537 4:2008908-2008930 CCTGTGGCTGCACAACAAGCTGG - Exonic
968985020 4:3870282-3870304 CCTGGTGCTGGGGAACTCGCAGG + Intergenic
969015301 4:4099873-4099895 CCAGCTGCTGGTCTACAAGACGG - Intergenic
969068166 4:4507177-4507199 GCTGCTGCTGAGCATCAAGAGGG - Intronic
969091979 4:4701622-4701644 CCAGCAGCTGCCCAACAAGCTGG - Intergenic
969612750 4:8236325-8236347 GCTGCGGCTGTGCAACAAGCTGG + Exonic
969868304 4:10089611-10089633 CCTGCAGGTGGGCAGCAAGAGGG - Intronic
970984214 4:22136670-22136692 CCTGGAGCTGTGCAACAAGGTGG + Intergenic
975472637 4:74787962-74787984 CCTACAGCTGGGGGACAAGCTGG - Intronic
975986195 4:80203001-80203023 GCTGGTGCTGGGCCAGAAGCTGG + Exonic
976732518 4:88278484-88278506 CCTGCTGCAGGACGACAGGCGGG - Exonic
979779596 4:124633693-124633715 GCAGCTGCTGGCAAACAAGCAGG - Intergenic
980545185 4:134252186-134252208 CCTGCTTCTGAGCAACAAATGGG - Intergenic
981234845 4:142403202-142403224 CCTGCTCTTGGGCAACAACATGG + Intronic
983936137 4:173503887-173503909 CCTCCTGCAGGGGAAGAAGCGGG + Intergenic
985368125 4:189255309-189255331 ACTGCTGCTGGGCCACTAACAGG + Intergenic
985745932 5:1647744-1647766 GATGCTGGTGGGCACCAAGCAGG - Intergenic
991207485 5:64066156-64066178 AGTGCTTCTGGGCAACCAGCAGG - Intergenic
994312600 5:98292356-98292378 CCTTCTCCTGGGCAAAGAGCAGG + Intergenic
997591710 5:135077164-135077186 CCTGGTGCTGTGGGACAAGCTGG + Intronic
998139459 5:139691632-139691654 CCAGCTGCAGGGCCACAGGCTGG + Intergenic
999254916 5:150204855-150204877 CATGATGCTGGGCTTCAAGCCGG + Exonic
1002467409 5:179414466-179414488 CCTGCTGTCGGGCCACAGGCAGG + Intergenic
1004647152 6:17573619-17573641 AGTGCTTCTGGGCAACCAGCAGG + Intergenic
1006672569 6:35738410-35738432 CGTGTTGCTGGGCTACATGCTGG + Exonic
1006795329 6:36728726-36728748 CCTTCTCCTGGGAAACAAGATGG + Exonic
1012370646 6:98502541-98502563 ACTGCTTTTGGCCAACAAGCTGG + Intergenic
1012379283 6:98600764-98600786 CCTGTTCCTAGGCACCAAGCAGG + Intergenic
1015579486 6:134707951-134707973 CCTGCTGCTGGCCAAAGATCAGG - Intergenic
1015589592 6:134810223-134810245 CCTGCTGCTGGGCAGAATGTGGG + Intergenic
1019062109 6:169263892-169263914 CATGCTGGTGGGCAAGAAGCCGG - Intergenic
1019571724 7:1715952-1715974 CCTGCTGTTTGGCACCCAGCAGG + Intronic
1019650626 7:2156005-2156027 GCTGATGCTGGGCAAAAAGGTGG + Intronic
1023315582 7:38932731-38932753 CCTGCTGCTAGGCAGCCAACAGG + Intergenic
1023709114 7:42973259-42973281 TCTGCTGCTGAGCCAAAAGCAGG + Intergenic
1024417271 7:49121337-49121359 GCTGCAGCTGGGTACCAAGCAGG - Intergenic
1026071278 7:67122734-67122756 CCTACTACTGGCCAACAAGCAGG - Intronic
1026705614 7:72689551-72689573 CCTACTACTGGCCAACAAGCAGG + Intronic
1028483130 7:91329738-91329760 CCTGCTGCTGGGCAAGGGGTGGG - Intergenic
1028789180 7:94834267-94834289 CCTGGTGTTTGCCAACAAGCAGG + Intergenic
1029073968 7:97921533-97921555 CCAGCTGCTGGTCTACAAGATGG - Intergenic
1029379552 7:100204101-100204123 CCTGCTGCTGAGCCTCAAGCAGG + Exonic
1032066263 7:128773870-128773892 CCTGCTGCTGAGCTGCAACCTGG + Exonic
1032089597 7:128904593-128904615 CCTGCTGCTGGGCAGACTGCCGG - Intronic
1034343400 7:150371811-150371833 CCCGCTTGTGGGCAACTAGCTGG - Exonic
1035594271 8:842939-842961 CCGGCTGCTGTAAAACAAGCTGG - Intergenic
1035874930 8:3177769-3177791 CTTACTGCTGGCCAACAAGGTGG - Intronic
1036243738 8:7099762-7099784 CCAGCTGCTGGTCTACAAGACGG + Intergenic
1036257064 8:7214295-7214317 CCAGCTGCTGGTCTACAAGATGG - Intergenic
1036309114 8:7672894-7672916 CCAGCTGCTGGTCTACAAGATGG - Intergenic
1036360421 8:8073225-8073247 CCAGCTGCTGGTCTACAAGATGG + Intergenic
1036898105 8:12651662-12651684 CCAGCTGCTGGTCTACAAGACGG - Intergenic
1037649042 8:20820019-20820041 CCTTCTGCAGGGAAACAAGAAGG - Intergenic
1038421684 8:27437758-27437780 CCTGCAGCTGGGCCACTACCTGG + Exonic
1038538245 8:28369823-28369845 CCTGCTGCTATGCAACATGTGGG + Intronic
1039577898 8:38639529-38639551 CATGCTGCTGTGCTCCAAGCTGG + Intergenic
1041201932 8:55458347-55458369 AGTGCTTCTGGGCAACCAGCAGG + Intronic
1048764845 8:137832674-137832696 CCTGGGGCTGGTCAGCAAGCAGG + Intergenic
1048858035 8:138700530-138700552 CCATCTGCTGGGCATCAGGCAGG + Intronic
1048968783 8:139632499-139632521 CCTGCTCCTGGGCACACAGCTGG + Intronic
1049201665 8:141343487-141343509 CCTGCTGCTGGCCAAGAAGCTGG - Intergenic
1052343463 9:27385086-27385108 CCTGCTACAGGGCAGGAAGCAGG + Intronic
1055724113 9:79209215-79209237 GCTGCTGCAGGTAAACAAGCAGG + Intergenic
1055782669 9:79836219-79836241 CCAGGTGTTGGGCAACAAACAGG + Intergenic
1056102024 9:83308967-83308989 CCTGCTGATGGGCAAAGAGGTGG - Intronic
1056441542 9:86627042-86627064 CCTGGTGCTGGGCACATAGCCGG - Intergenic
1057711182 9:97446344-97446366 CCTACTGGTAGGCAACCAGCAGG + Intronic
1060641257 9:125241131-125241153 CCTGCTGCTGCCCAACTGGCTGG - Exonic
1060881991 9:127123800-127123822 CCTGCTGCCGGGCACCCTGCGGG + Intronic
1060998866 9:127890974-127890996 CCACCTGCTGGGCACCAAGCTGG - Exonic
1061203943 9:129152421-129152443 CCTGAGGCTGGAGAACAAGCAGG - Intergenic
1061212391 9:129201394-129201416 CCTGCTGCTGGGTGCCAACCAGG - Intergenic
1061673809 9:132204116-132204138 CCTGCTCCTGGGCAGAAAGGGGG - Intronic
1061880372 9:133565949-133565971 CCTGCTCCTGGGCAGGGAGCTGG + Intronic
1062008928 9:134256764-134256786 CCTGGTGCTGGGCAGGAAGGTGG + Intergenic
1062284928 9:135768627-135768649 CCTGCTGCTGAGGATGAAGCAGG - Exonic
1062392295 9:136338681-136338703 CCAGCTCCTGGGCAATGAGCAGG - Exonic
1062405791 9:136395611-136395633 CCTGCTGCTGGCCCAGAACCGGG - Exonic
1185643459 X:1600826-1600848 CATCCTGCTGAGCAAGAAGCCGG + Exonic
1187278476 X:17837351-17837373 CCTGTGGATGGGCAACAGGCTGG + Intronic
1187360350 X:18620641-18620663 CCTGCTGCTGTCCTACAGGCCGG - Intronic
1187413320 X:19070049-19070071 AGTGCTTCTGGGCAACCAGCAGG - Intronic
1187742645 X:22373112-22373134 CTTGCTGCTTGGTGACAAGCAGG + Intergenic
1189010501 X:37042375-37042397 CTTGCTTCTGGGCAGCAAGCTGG - Intergenic
1189035908 X:37493174-37493196 CTTGCTTCTGGGCAGCAAGATGG + Intronic
1196316279 X:114228448-114228470 CCTGCTCCTAGGTAACAAGGAGG - Intergenic
1198312301 X:135434966-135434988 CCTCCAGCTGGGCGACAAGGCGG - Intergenic
1199712937 X:150484571-150484593 CCAGCTGCTGTGGAACAAGCTGG - Intronic
1202378445 Y:24257905-24257927 CCTGGTGCTGGGCATACAGCAGG + Intergenic
1202492337 Y:25412216-25412238 CCTGGTGCTGGGCATACAGCAGG - Intergenic