ID: 1128109550

View in Genome Browser
Species Human (GRCh38)
Location 15:65067936-65067958
Sequence GCGCGCGGCCCCGGACCCGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128109544_1128109550 7 Left 1128109544 15:65067906-65067928 CCAGGGGAGCGGGATGCAGGCTT 0: 1
1: 0
2: 0
3: 16
4: 165
Right 1128109550 15:65067936-65067958 GCGCGCGGCCCCGGACCCGTCGG 0: 1
1: 0
2: 1
3: 10
4: 94
1128109536_1128109550 22 Left 1128109536 15:65067891-65067913 CCCGCCCGTCGGGGCCCAGGGGA 0: 1
1: 0
2: 1
3: 16
4: 156
Right 1128109550 15:65067936-65067958 GCGCGCGGCCCCGGACCCGTCGG 0: 1
1: 0
2: 1
3: 10
4: 94
1128109540_1128109550 17 Left 1128109540 15:65067896-65067918 CCGTCGGGGCCCAGGGGAGCGGG 0: 1
1: 0
2: 1
3: 34
4: 236
Right 1128109550 15:65067936-65067958 GCGCGCGGCCCCGGACCCGTCGG 0: 1
1: 0
2: 1
3: 10
4: 94
1128109543_1128109550 8 Left 1128109543 15:65067905-65067927 CCCAGGGGAGCGGGATGCAGGCT 0: 1
1: 0
2: 2
3: 28
4: 198
Right 1128109550 15:65067936-65067958 GCGCGCGGCCCCGGACCCGTCGG 0: 1
1: 0
2: 1
3: 10
4: 94
1128109537_1128109550 21 Left 1128109537 15:65067892-65067914 CCGCCCGTCGGGGCCCAGGGGAG 0: 1
1: 0
2: 2
3: 17
4: 149
Right 1128109550 15:65067936-65067958 GCGCGCGGCCCCGGACCCGTCGG 0: 1
1: 0
2: 1
3: 10
4: 94
1128109538_1128109550 18 Left 1128109538 15:65067895-65067917 CCCGTCGGGGCCCAGGGGAGCGG 0: 1
1: 0
2: 0
3: 14
4: 201
Right 1128109550 15:65067936-65067958 GCGCGCGGCCCCGGACCCGTCGG 0: 1
1: 0
2: 1
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128109550 Original CRISPR GCGCGCGGCCCCGGACCCGT CGG Exonic
900526216 1:3130089-3130111 GCACGCAGCCCAGGACCTGTTGG - Intronic
901007910 1:6180504-6180526 CCGCGCGCCCGCGGACCCGACGG + Intergenic
901109552 1:6784686-6784708 GCGGGCGGCGCCGGGGCCGTGGG + Intergenic
901526097 1:9824145-9824167 GCGCGCGCCTCCGAGCCCGTCGG + Exonic
904753946 1:32757885-32757907 GCCTGCGGCCCCGGCCCCGGGGG + Intronic
906168883 1:43707503-43707525 GCGCGCGGCCGCGACCCGGTCGG - Intronic
906263072 1:44407593-44407615 GCGCCCGGCCCCGGCCCTGTCGG - Intronic
907364083 1:53945666-53945688 GCGCGCGACCCCGGACTCCACGG - Exonic
908128201 1:61050699-61050721 CCGCGCGGCCGCTGTCCCGTGGG - Intronic
918216057 1:182392317-182392339 GCGCGGGGCGCGGGACCCGAGGG + Intergenic
919748652 1:201023565-201023587 GCGCGCGGGCCCAGCCCCGGGGG - Exonic
924242868 1:242057245-242057267 GCTCCCTGCCCCGGACCCGGTGG + Intergenic
1072656536 10:97334209-97334231 GCACGCGGCCGCGGTCCCCTAGG + Exonic
1079135119 11:17772084-17772106 GCGTGTGGCCCAGGACCCGCAGG - Exonic
1082986054 11:59172240-59172262 GCGCGCGGCCCGAGCCCCGGCGG - Intronic
1083457135 11:62786814-62786836 CCGGGCGGCCGCGGAGCCGTGGG - Exonic
1083618116 11:64036220-64036242 GCCCCCGGCCCCCGCCCCGTCGG - Intronic
1084758347 11:71252651-71252673 GCGTGCGGCCCAGGACCCGCGGG + Intergenic
1090758657 11:129816289-129816311 GCGCGCGTCCCCGGACTCACCGG - Intronic
1091108472 11:132943913-132943935 GCGCGCGGGCCCGGACCGCCGGG + Intronic
1092108889 12:5945233-5945255 GCGCGCGGCCGCGGGCCGGCGGG - Exonic
1094041189 12:26122909-26122931 GGGGGCGGCCGCGGACCCGGCGG + Exonic
1101409731 12:104458082-104458104 GCGCGGAGCCCGGGACACGTGGG - Intronic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1103779576 12:123389590-123389612 GCTCGCGGCCCCGGCCCGGCGGG - Intronic
1103889610 12:124228566-124228588 GCTCACGGCCTTGGACCCGTGGG - Intronic
1107940750 13:45378569-45378591 CCGGGCGGCATCGGACCCGTCGG + Intergenic
1113082873 13:106535728-106535750 GCGCGCGGCCGCGGAGCCGCGGG - Intergenic
1115761993 14:36584115-36584137 GCTCGACGCCCCGGACCTGTTGG + Intergenic
1118186536 14:63543119-63543141 GCTCGTTGCCCCGGACCCGGCGG + Exonic
1119601917 14:75982345-75982367 GCGGGCGGCCCCGGGACCGGGGG - Intronic
1124340400 15:28886342-28886364 CCGCGAGGACCCGGACGCGTGGG + Intronic
1124966691 15:34437312-34437334 CCGCGGGGACCCGGACGCGTGGG - Intronic
1124999458 15:34755101-34755123 GCGCGCGTCCCCGGCCCCTCGGG - Intergenic
1128067776 15:64775358-64775380 GAGCGCGGCGCCGGCCCCGCGGG + Exonic
1128109550 15:65067936-65067958 GCGCGCGGCCCCGGACCCGTCGG + Exonic
1129483214 15:75843852-75843874 GCGCCCGGCCGCGGCCCCGCGGG + Intronic
1132556641 16:575520-575542 GGGCGAGGCCCTGGGCCCGTGGG + Intronic
1136365191 16:29806437-29806459 GCCCCCGGCCCCGGCCCCGCGGG + Intronic
1141839719 16:86567008-86567030 GCGGGCGGCCGCGGACCCAGCGG - Intergenic
1141841413 16:86576563-86576585 GCGCGCGGCCCCGGAGAGGTTGG + Intronic
1142136314 16:88453470-88453492 GCGCCCAGCCCCGGAGCCGCTGG - Exonic
1142810696 17:2394242-2394264 GCGCGCGACCCGGGCCCCGGCGG - Intronic
1143174937 17:4950119-4950141 GCGCGCTGCCCCGGCGCCGACGG + Intronic
1144585021 17:16482565-16482587 GCGCTAGGCCCAGGACCTGTGGG - Intronic
1147389531 17:40100657-40100679 GCGTGCGGCCCGGGAACCCTGGG - Exonic
1148685128 17:49496619-49496641 GCGCGCAGCCCCAGACTCGCAGG - Intronic
1152352031 17:79789638-79789660 GAGCTCGGCCCGGCACCCGTCGG - Intergenic
1152823781 17:82450742-82450764 GCGCGCGGCCCCGCCCCCGCCGG - Intronic
1160566150 18:79787955-79787977 GGGCGCTTCCCCGGACCCGGGGG + Intergenic
1160775306 19:852719-852741 GCGAACGGCCCCGATCCCGTGGG + Intronic
1161084547 19:2328778-2328800 GAGCGCGGCACCGGTCCCGACGG + Intronic
1161086999 19:2339967-2339989 GTGCGCGGCCCCGGGCGGGTGGG + Intronic
1162470984 19:10871882-10871904 GCGCGCCGGCCCGGACTCGGCGG + Exonic
1166363696 19:42268177-42268199 GCGCGCGGCCTGGGGCCCGGGGG - Intergenic
1166723684 19:45012286-45012308 GCGAGCGGCCCCGGGCGGGTGGG + Intronic
1167074290 19:47239616-47239638 GCGCGCGGCCCCCGCCCCGCCGG - Intergenic
927652346 2:24920211-24920233 GCGCGTGGCCCCGGAGCCGCCGG - Intergenic
927667453 2:25042334-25042356 GCGCCCGGGCCCGGGCCCGCGGG + Intronic
935059303 2:99593818-99593840 GCCCGCGGCCGCGGACGCGCTGG - Exonic
936556933 2:113503985-113504007 GCCTGTGGCCCCGGACCCGCCGG - Intergenic
942178155 2:173354833-173354855 GCGCGCCGACCCGGGCCCGGAGG - Intronic
947593085 2:231396004-231396026 GTACGCGGCCCCGGACCCGTGGG + Intronic
948140734 2:235670343-235670365 GCGCGCGGCCGGGGACCCTCCGG - Intronic
1172587046 20:36092469-36092491 GCGCGCGGCCCCAGCTCCGGCGG + Intronic
1176033247 20:63023999-63024021 GCCCGCGGCCCCGGAGCCTAGGG + Intergenic
1176157065 20:63627197-63627219 GCACGCGCCCCGGGGCCCGTCGG - Intergenic
1176237982 20:64063152-64063174 GCGCGCGGCCGCGGGGCCGAGGG + Exonic
1178951489 21:36989788-36989810 GCACGCGGCCAGGGGCCCGTGGG + Intronic
1181017668 22:20080468-20080490 GCCCGCGGCCTCGGTCCCGGAGG - Intronic
1182211324 22:28679725-28679747 GGACGCGGCCCGGGCCCCGTGGG - Exonic
1182885817 22:33773156-33773178 TCGCGTGGCCCCAGACCCGGAGG - Intronic
1184141812 22:42581959-42581981 GCTCGCGGCGCGGGACCCGGAGG - Intergenic
1184522969 22:45007019-45007041 GCGCGCGGCCCCGGCGAAGTCGG - Intronic
1185336167 22:50271756-50271778 GAGCGCAGCCCCGGAGCTGTGGG + Intergenic
950007964 3:9703760-9703782 GCGGGCGGCCCCCGCCCCATTGG - Intergenic
950479325 3:13235017-13235039 GAGCCCGTCCCCAGACCCGTGGG - Intergenic
953027516 3:39153516-39153538 GCGCTCGGCCCGGCAGCCGTCGG + Exonic
954110275 3:48429551-48429573 GCGCGCGGCCCCGAACCGCCCGG + Intronic
954717526 3:52533912-52533934 GCGGGAGGCCCCGGACCCGGCGG + Intronic
961340423 3:126213522-126213544 GCGCGCTGCCCGGGCCCCGCAGG + Intergenic
968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG + Intergenic
968642298 4:1720899-1720921 GCGCCCAGTCCCGGACCTGTCGG + Exonic
970617527 4:17781707-17781729 GCGCGCGGCCCTGGACTTGGTGG + Intergenic
986330774 5:6714488-6714510 CCGCGCGGCCCCGCGCCCGCCGG + Intergenic
987374017 5:17217834-17217856 CCGCGCCGCCGCGGACCCGGGGG + Intronic
998517705 5:142770706-142770728 GCGGGCGGCCCGGGCCCCGGCGG + Exonic
1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG + Exonic
1004272892 6:14211147-14211169 GCGCGCGGCTCCGGTCACGTGGG - Intergenic
1012510283 6:99993870-99993892 GGGCGCGCCCCAGGGCCCGTGGG - Intronic
1019343041 7:517517-517539 GCCCGCGGCCCCGACCCCGCCGG + Intronic
1019343614 7:519607-519629 GAGCGCGGCGCCGGAGCCGAGGG - Intronic
1020080398 7:5283277-5283299 AAGCGCGGACCCGGACCCCTGGG + Intronic
1022375528 7:29807489-29807511 GAGCGCCGCCCGGGCCCCGTGGG + Intronic
1022942534 7:35254200-35254222 GCCCGCGGCCCCGCCCCCGGCGG - Intergenic
1023700561 7:42888418-42888440 GCGCGCGGCCCCAGACCTGCTGG - Intergenic
1039903129 8:41767187-41767209 GCGCGCGCACCCGCACCCGCCGG + Intronic
1046445405 8:114311737-114311759 GCGCCCGGCGCCGGACTGGTAGG + Intergenic
1049109793 8:140635640-140635662 GCCCGCCGCCCCGGCCGCGTCGG - Intergenic
1049585501 8:143430796-143430818 GCGCGCGCCCCCGGGCCAATCGG + Intergenic
1049896068 9:113316-113338 GCCTGTGGCCCCGGACCCGCCGG + Intergenic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1053250817 9:36572806-36572828 GCGCGCGGCGCCGGATCCCAGGG - Intergenic
1061128199 9:128689724-128689746 GCGCGCGCCCCGGGCCCCGCCGG - Intronic
1062005247 9:134235575-134235597 GCGCCTGGCCCTGGACCAGTGGG + Intergenic
1200155386 X:153972224-153972246 GCGCTCGGCCCCGCCCCCTTGGG + Intergenic