ID: 1128111304

View in Genome Browser
Species Human (GRCh38)
Location 15:65077793-65077815
Sequence GACCGACGCGTGGCTGCCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128111301_1128111304 -1 Left 1128111301 15:65077771-65077793 CCGTGGTGGAGTACGCAGTGCGG 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1128111304 15:65077793-65077815 GACCGACGCGTGGCTGCCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 64
1128111296_1128111304 15 Left 1128111296 15:65077755-65077777 CCGGCCGACACCACCGCCGTGGT 0: 1
1: 0
2: 1
3: 7
4: 59
Right 1128111304 15:65077793-65077815 GACCGACGCGTGGCTGCCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 64
1128111294_1128111304 25 Left 1128111294 15:65077745-65077767 CCTGTGGCGGCCGGCCGACACCA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1128111304 15:65077793-65077815 GACCGACGCGTGGCTGCCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 64
1128111300_1128111304 2 Left 1128111300 15:65077768-65077790 CCGCCGTGGTGGAGTACGCAGTG 0: 1
1: 0
2: 2
3: 2
4: 224
Right 1128111304 15:65077793-65077815 GACCGACGCGTGGCTGCCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 64
1128111298_1128111304 11 Left 1128111298 15:65077759-65077781 CCGACACCACCGCCGTGGTGGAG 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1128111304 15:65077793-65077815 GACCGACGCGTGGCTGCCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 64
1128111299_1128111304 5 Left 1128111299 15:65077765-65077787 CCACCGCCGTGGTGGAGTACGCA 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1128111304 15:65077793-65077815 GACCGACGCGTGGCTGCCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128111304 Original CRISPR GACCGACGCGTGGCTGCCAG TGG Exonic