ID: 1128115534

View in Genome Browser
Species Human (GRCh38)
Location 15:65102537-65102559
Sequence CAGGCGCCAGCCCATGTTCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128115525_1128115534 8 Left 1128115525 15:65102506-65102528 CCGGCCTCCGGGTCTCTGATTGT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1128115534 15:65102537-65102559 CAGGCGCCAGCCCATGTTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1128115518_1128115534 28 Left 1128115518 15:65102486-65102508 CCTCCGGCCTCTCCTGGTGTCCG 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1128115534 15:65102537-65102559 CAGGCGCCAGCCCATGTTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1128115530_1128115534 1 Left 1128115530 15:65102513-65102535 CCGGGTCTCTGATTGTGGTGGGC 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1128115534 15:65102537-65102559 CAGGCGCCAGCCCATGTTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1128115524_1128115534 16 Left 1128115524 15:65102498-65102520 CCTGGTGTCCGGCCTCCGGGTCT 0: 1
1: 0
2: 0
3: 13
4: 123
Right 1128115534 15:65102537-65102559 CAGGCGCCAGCCCATGTTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1128115520_1128115534 25 Left 1128115520 15:65102489-65102511 CCGGCCTCTCCTGGTGTCCGGCC 0: 1
1: 0
2: 3
3: 35
4: 278
Right 1128115534 15:65102537-65102559 CAGGCGCCAGCCCATGTTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1128115521_1128115534 21 Left 1128115521 15:65102493-65102515 CCTCTCCTGGTGTCCGGCCTCCG 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1128115534 15:65102537-65102559 CAGGCGCCAGCCCATGTTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1128115527_1128115534 4 Left 1128115527 15:65102510-65102532 CCTCCGGGTCTCTGATTGTGGTG 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1128115534 15:65102537-65102559 CAGGCGCCAGCCCATGTTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128115534 Original CRISPR CAGGCGCCAGCCCATGTTCG GGG Exonic
900632281 1:3643621-3643643 AAGGCGCGACCCCATGTCCGGGG - Intronic
900632299 1:3643672-3643694 AAGGCGCGACCCCATGTCCGGGG - Intronic
900632317 1:3643723-3643745 AAGGCGCGACCCCATGTCCGGGG - Intronic
900632335 1:3643774-3643796 AAGGCGCGACCCCATGTCCGGGG - Intronic
900632353 1:3643825-3643847 AAGGCGCGACCCCATGTCCGGGG - Intronic
900632371 1:3643876-3643898 AAGGCGCGACCCCATGTCCGGGG - Intronic
900632389 1:3643927-3643949 AAGGCGCGACCCCATGTCCGGGG - Intronic
900632407 1:3643978-3644000 AAGGCGCGACCCCATGTCCGGGG - Intronic
900632425 1:3644029-3644051 AAGGCGCGACCCCATGTCCGGGG - Intronic
900632443 1:3644080-3644102 AAGGCGCGACCCCATGTCCGGGG - Intronic
900632461 1:3644131-3644153 AAGGCGCGACCCCATGTCCGGGG - Intronic
900632479 1:3644182-3644204 AAGGCGCGACCCCATGTCCGGGG - Intronic
900632497 1:3644233-3644255 AAGGCGCGACCCCATGTCCGGGG - Intronic
900632515 1:3644284-3644306 AAGGCGCGACCCCATGTCCGGGG - Intronic
900632533 1:3644335-3644357 AAGGCGCGACCCCATGTCCGGGG - Intronic
900632550 1:3644386-3644408 AAGGCGCGACCCCATGTCCGGGG - Intronic
902932778 1:19743129-19743151 CTGGCTCCAGCCCATATTCTTGG - Intronic
903176904 1:21586877-21586899 CTGGCTCCAGCCCTTGTTAGTGG - Intergenic
903265393 1:22155010-22155032 CAGGCCCCAGCCCAGGTGCTGGG + Intergenic
904586717 1:31584807-31584829 CAGGCGCCAGCCCTTGCCCTTGG - Intronic
908555761 1:65254944-65254966 CAGGCGCCAGGCCAGGTGCTGGG - Intronic
910394581 1:86779027-86779049 CAGGCCCCAGGCCAAGTTCCAGG + Intergenic
911206925 1:95101048-95101070 CAGGCGCCCGCCAATGTGCCCGG + Intergenic
912800101 1:112714999-112715021 CAGGCGGCGGCCCGTGTCCGGGG + Exonic
917090542 1:171349335-171349357 CAGGTGCGAGCCAATGTTCATGG - Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
921218912 1:212959680-212959702 CAGGCGCCAGCCCCAGTGTGAGG - Intronic
922744571 1:228036990-228037012 CTGGGCCCAGCCCATGTTAGAGG - Intronic
1063436365 10:6035354-6035376 CTGGCGCCAGGCCAAGTTCTAGG + Intronic
1063955468 10:11261494-11261516 GCGGCCCCAGCCCATGTTCCAGG + Intronic
1067878582 10:50024953-50024975 CAGGCCCCGGCCCGGGTTCGCGG + Intergenic
1067883595 10:50068119-50068141 CTGGCGCCAGCTCCTGGTCGGGG - Exonic
1067893143 10:50152979-50153001 CAGGCCCCGGCCCGGGTTCGCGG - Intergenic
1069545547 10:69325498-69325520 CAGGCACCAGCCAATGCTCCTGG + Intronic
1070817301 10:79332783-79332805 CAGAGGCCAGCCCATATTCAAGG - Intergenic
1070818158 10:79338278-79338300 CAGAGGCCAGCCCATATTCAAGG + Intergenic
1071177534 10:82943628-82943650 CAGGCACCATCCCATCTTCTGGG - Intronic
1073429888 10:103479187-103479209 CAGGCCCCAGCCCAGGCTCCCGG + Exonic
1073636856 10:105208062-105208084 TAGGCGTGAGCCCATGTTCCTGG - Intronic
1076329867 10:129656327-129656349 CAGGAGCCCTCCCATGCTCGGGG - Intronic
1077481765 11:2818337-2818359 CAGGCTGCAGCCCGTGTTCCTGG + Intronic
1081106643 11:39078652-39078674 CAGGGGCCAGCACGTGTTCAGGG + Intergenic
1082133836 11:48524528-48524550 CAGGTGCCAGCCAGTGTTCTAGG + Intergenic
1082138514 11:48578745-48578767 CAGGTGCCAGCCAGTGTTCCAGG + Intergenic
1082140940 11:48608476-48608498 CAGGTGCCAGCCAGTGTTCTAGG + Intergenic
1082566854 11:54690911-54690933 CAGGTGCCAGCCAGTGTTCTAGG + Intergenic
1082568106 11:54705298-54705320 CAGGTGCCAGCCAGTGTTCTAGG + Intergenic
1083566903 11:63726716-63726738 CAGGCGCCTGCCAATGTGCCCGG - Intronic
1083881501 11:65551181-65551203 CAGGAACCAGCGCATGGTCGGGG + Exonic
1084920540 11:72465962-72465984 CAGGCGCCAGCCACTGTGCCCGG - Intergenic
1087027329 11:93662103-93662125 CAGGTGGCAGGCCATGTCCGCGG - Intronic
1096181587 12:49554165-49554187 CAGGCGTCAGGCCATGTCCCAGG + Intronic
1103973037 12:124683970-124683992 CAGCAGCCAGCACATGTTGGAGG + Intergenic
1104730773 12:131104189-131104211 CAGGCGGCAGCCATTGTGCGGGG + Intronic
1106936666 13:34729936-34729958 CATTGGCCAGCCCATGTTCAAGG - Intergenic
1109683430 13:65783583-65783605 CAGGCGCCAACCCAGGTGCCAGG + Intergenic
1111654002 13:91130205-91130227 CAGGAGACAGCCCAGGTTCTGGG - Intergenic
1113721324 13:112559855-112559877 CAGGCGTGAGCCCCTGTTCCCGG - Intronic
1114778919 14:25516611-25516633 CATGCGCCAGGCCATGTTCTAGG - Intergenic
1115355206 14:32439434-32439456 CTGGTGCCAGCCCAGGTTCCAGG - Intronic
1116003453 14:39267654-39267676 CCGGCTCCCGCCCGTGTTCGAGG + Intronic
1120953599 14:90062653-90062675 CAGGCGACAGCTCATGTCAGTGG - Intronic
1121914346 14:97822434-97822456 CAGGCTCCAGCTCATGTTTCTGG + Intergenic
1122262786 14:100532650-100532672 CAGGCCTCAGCACATGTTTGTGG + Intergenic
1122649956 14:103220757-103220779 CAGGCGCCCGCCCAGGCTTGGGG + Intergenic
1123107215 14:105847580-105847602 CAGGCCCCAGCCCTTGTTAATGG - Intergenic
1123109872 14:105861377-105861399 CAGGCCCCAGCCCTTGTTAATGG - Intergenic
1123433632 15:20238889-20238911 CAGGCGCCTGCCAATGTGCCTGG - Intergenic
1124578166 15:30927586-30927608 CAGGCCCCAACCCATCTGCGTGG - Intronic
1124902512 15:33837392-33837414 CAGGCCCCAGGCCATGTTAAAGG + Intronic
1128115534 15:65102537-65102559 CAGGCGCCAGCCCATGTTCGGGG + Exonic
1128906768 15:71474360-71474382 CAGGCGCCTGCCCCTGTGCCTGG + Intronic
1131015379 15:89053486-89053508 CTGGCCCCAGGCCATGTTAGAGG - Intergenic
1132478399 16:153761-153783 CAGGCCCCAGCCCCTCCTCGCGG - Intronic
1132480484 16:164351-164373 CAGGCCCCAGCCCCTCCTCGCGG - Intronic
1132672635 16:1108031-1108053 CAGGGGCCACCCCATGTCCAAGG - Intergenic
1145312281 17:21707298-21707320 CAGGGGCCAGCCCAAGATCAAGG - Intergenic
1147358175 17:39913750-39913772 CAGTTGCCACCCCAGGTTCGTGG + Intronic
1150840452 17:68601291-68601313 CCGGCGCCAGGCCAGGCTCGGGG - Exonic
1153298561 18:3571801-3571823 CAGGCGTGAGCCAATGTTCCCGG + Intronic
1158884717 18:61816101-61816123 CAGGCGGCAGCCCATGTCTCCGG + Exonic
1160025526 18:75212092-75212114 CACGCGCCGGCCCAGGTTGGGGG - Intronic
1160731484 19:643493-643515 CCGCGGCCAGCCCATGTTCCTGG + Exonic
1161537116 19:4826600-4826622 CAGGCGTGAGCCACTGTTCGCGG + Intronic
1161978518 19:7619056-7619078 CAGGCGCCAGACCTTGTGCACGG - Intergenic
1164974175 19:32559508-32559530 CAGGGGATAGCCCAGGTTCGAGG - Intergenic
1167177940 19:47878790-47878812 CAGGCGCCAGCCAACGTGCCTGG + Intronic
1168351616 19:55679376-55679398 CCGGCCCCAGCCCATGTCCTTGG - Intronic
933849363 2:86353106-86353128 CAGCTGCCAGCCCACGTTTGAGG - Intergenic
934607856 2:95711392-95711414 CAGGCTCCAGACAATGTTCAAGG + Intergenic
947611918 2:231530114-231530136 CAGGCGCCAGCCCGGGTTCAAGG + Intronic
948895811 2:240926357-240926379 CAGGCACCAGCCCCTGTGGGAGG + Intronic
1170569898 20:17626792-17626814 CCAGCGCCAGGCCATGTTCGGGG - Intronic
1171340080 20:24420668-24420690 CAGGCCCCAGCCCATGCACCTGG + Intergenic
1173165297 20:40683425-40683447 CAGGCGCCAGCCTGTCTACGTGG + Intergenic
1173339723 20:42142305-42142327 CAGTGCCCAGCCCATGTTAGGGG - Intronic
1176216865 20:63952154-63952176 CAGGAGACAGCCCAGGGTCGGGG + Intronic
1177129697 21:17240955-17240977 AAGGCACCAGCCCCTGTTAGGGG + Intergenic
1178565507 21:33680606-33680628 CAGGCGTGAGCCGATGTGCGTGG + Intronic
1179568498 21:42263970-42263992 CAGGCTCCATTCCAGGTTCGCGG + Intronic
1179618651 21:42598251-42598273 CAGGCCCCAGTCCATGTTCTTGG - Intergenic
1179726878 21:43345845-43345867 CAGGCGCTAACCCACGTCCGTGG - Intergenic
1183320750 22:37163749-37163771 CAGGCTCAAGCCCATGTGGGTGG - Intronic
950703227 3:14764868-14764890 CTGGGGCCAGCCCATATTCAAGG + Intronic
954886759 3:53881859-53881881 CAGGCCCCAGCCCCTGGTGGGGG - Intronic
962056614 3:131878870-131878892 CAGGTGCCAGGCCTTGTTCTAGG + Intronic
968574786 4:1360559-1360581 CAGGCGCCAGCCTCTGGGCGCGG - Intronic
968890289 4:3365107-3365129 CAGGCTCCAGCCCAGGCTCCTGG - Intronic
969223072 4:5773943-5773965 CAGGGGCCAGACCATGTCCAGGG + Intronic
969645008 4:8423013-8423035 CAAGCGCCAGCCCATGCCCCAGG + Intronic
969717282 4:8873845-8873867 CACGCGCCTGCCCAGGTTGGTGG + Intergenic
973979364 4:56294494-56294516 GAGGAGTCAGCCCATGTTCATGG + Intronic
974179005 4:58360645-58360667 CAGTCTCCCTCCCATGTTCGTGG + Intergenic
986214232 5:5703487-5703509 CAGGCACCAGCCCATATTTATGG + Intergenic
986513390 5:8533502-8533524 CTGGCTCCAGCCCATGCTCAAGG - Intergenic
990524077 5:56607770-56607792 GATGAGTCAGCCCATGTTCGTGG + Intergenic
991159877 5:63485739-63485761 CAGCCCCCAGCCTATGTTCCAGG - Intergenic
1001248043 5:170120323-170120345 CAGGCGCGAGCCACTGTGCGTGG + Intergenic
1001328740 5:170747498-170747520 CAGGCGCCAGGCCAGGTCCTGGG - Intergenic
1013013216 6:106138254-106138276 CTGGTGCCAGCCCATGGTCTAGG - Intergenic
1019524414 7:1474341-1474363 CAGGCACCTGCCCATGATCGCGG - Exonic
1020133847 7:5574963-5574985 CAGCCGCCAGCCCATTGTCCAGG - Intergenic
1023966792 7:44967032-44967054 CAGGTTCCAGCCCCTGGTCGGGG + Intronic
1027156643 7:75773056-75773078 CAGGTGCCAGCCCATCTTCTTGG + Intronic
1029695278 7:102208911-102208933 CAACCGCCAGTCCATCTTCGAGG - Intronic
1032840115 7:135706617-135706639 CAAGCTCCAGCCAATGTCCGTGG - Intronic
1034969844 7:155412133-155412155 CAGGCCCCAGCACTTGTTGGTGG - Intergenic
1040548350 8:48419671-48419693 CAGGCTCCGGCCCAAGGTCGAGG + Intergenic
1045252464 8:100493378-100493400 TAGGGGCCAGCCCAGGTTCTGGG + Intergenic
1045507918 8:102791494-102791516 AACTTGCCAGCCCATGTTCGGGG - Intergenic
1046024983 8:108711723-108711745 CTGGCACCAGCCCATGTAAGAGG + Intronic
1047994428 8:130320276-130320298 CAGGCGACAGCCACTGTTCCTGG - Intronic
1049619902 8:143593417-143593439 CAGCCACCAGCCCATGTCCTGGG + Intronic
1051589990 9:18768099-18768121 CAGGAGCCAGCCCATGATTCAGG - Intronic
1052579253 9:30332948-30332970 CAAGCGTCAGCCAATGTTTGGGG + Intergenic
1057918034 9:99072543-99072565 CAGCTGCCAGCCCATGTCAGGGG + Intergenic
1060597218 9:124855835-124855857 CAGGCACCAGCCCGGGGTCGGGG - Intronic
1061754345 9:132802351-132802373 CTGGGGCCAGCCCAGGTTCCAGG - Intronic
1187907709 X:24083167-24083189 CAGGCGCGAGCCACTGTTCCTGG + Intergenic
1202058383 Y:20859839-20859861 CAGGGGCCTGCCCATGTACCAGG + Intergenic