ID: 1128119148

View in Genome Browser
Species Human (GRCh38)
Location 15:65133276-65133298
Sequence GGCCCGGCATGCGTGCGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128119137_1128119148 29 Left 1128119137 15:65133224-65133246 CCGCACCAGGCGCAGAGCCCGGA 0: 1
1: 0
2: 0
3: 17
4: 188
Right 1128119148 15:65133276-65133298 GGCCCGGCATGCGTGCGCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 101
1128119138_1128119148 24 Left 1128119138 15:65133229-65133251 CCAGGCGCAGAGCCCGGAGCAAT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1128119148 15:65133276-65133298 GGCCCGGCATGCGTGCGCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 101
1128119140_1128119148 11 Left 1128119140 15:65133242-65133264 CCGGAGCAATCGCGCGCGCACTT 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1128119148 15:65133276-65133298 GGCCCGGCATGCGTGCGCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 101
1128119139_1128119148 12 Left 1128119139 15:65133241-65133263 CCCGGAGCAATCGCGCGCGCACT 0: 1
1: 0
2: 0
3: 2
4: 12
Right 1128119148 15:65133276-65133298 GGCCCGGCATGCGTGCGCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128119148 Original CRISPR GGCCCGGCATGCGTGCGCTG GGG Exonic