ID: 1128134410

View in Genome Browser
Species Human (GRCh38)
Location 15:65252185-65252207
Sequence TTTCCCACTCTCATTGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128134410_1128134415 -1 Left 1128134410 15:65252185-65252207 CCAAGACCAATGAGAGTGGGAAA 0: 1
1: 1
2: 0
3: 15
4: 164
Right 1128134415 15:65252207-65252229 AGGGAGTTGGTTCCCCAGAGAGG 0: 1
1: 0
2: 0
3: 20
4: 188
1128134410_1128134416 8 Left 1128134410 15:65252185-65252207 CCAAGACCAATGAGAGTGGGAAA 0: 1
1: 1
2: 0
3: 15
4: 164
Right 1128134416 15:65252216-65252238 GTTCCCCAGAGAGGAAGTTGAGG 0: 1
1: 0
2: 3
3: 25
4: 268
1128134410_1128134421 20 Left 1128134410 15:65252185-65252207 CCAAGACCAATGAGAGTGGGAAA 0: 1
1: 1
2: 0
3: 15
4: 164
Right 1128134421 15:65252228-65252250 GGAAGTTGAGGTATGGTACCAGG 0: 1
1: 0
2: 0
3: 5
4: 93
1128134410_1128134422 24 Left 1128134410 15:65252185-65252207 CCAAGACCAATGAGAGTGGGAAA 0: 1
1: 1
2: 0
3: 15
4: 164
Right 1128134422 15:65252232-65252254 GTTGAGGTATGGTACCAGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 101
1128134410_1128134420 13 Left 1128134410 15:65252185-65252207 CCAAGACCAATGAGAGTGGGAAA 0: 1
1: 1
2: 0
3: 15
4: 164
Right 1128134420 15:65252221-65252243 CCAGAGAGGAAGTTGAGGTATGG 0: 1
1: 0
2: 2
3: 29
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128134410 Original CRISPR TTTCCCACTCTCATTGGTCT TGG (reversed) Intronic
902665967 1:17938536-17938558 TTTCCCACTGACTTTGGACTTGG + Intergenic
904459431 1:30666983-30667005 TTTTCCCTTCTAATTGGTCTTGG - Intergenic
906278072 1:44533086-44533108 TTGCCCCCTCTCTTTGGTCTTGG + Intronic
908162848 1:61427997-61428019 TTTCCCCCTCTCATTGAACTTGG - Intronic
909485136 1:76164249-76164271 TTTCCCTCTCTCCTTGGAATGGG - Intronic
912342167 1:108927521-108927543 TTTCCCCCACTGAATGGTCTTGG - Intronic
914691945 1:150037383-150037405 TCTCCCATTCTCTTTGTTCTTGG - Intergenic
914921358 1:151849818-151849840 CTTCCCACTCCCCATGGTCTAGG + Intronic
915721466 1:157988815-157988837 TCTCTCACTCTCACTGCTCTGGG + Intergenic
915986433 1:160470128-160470150 TCTCCCACTCTGTTTGGTGTTGG + Intergenic
918108461 1:181434011-181434033 ATTTCCACGCTCATTGGTCTAGG + Intronic
920539507 1:206767527-206767549 TCACCCACTCTCTTTTGTCTTGG + Intergenic
923561160 1:235043055-235043077 TTTCCCACTCACTGAGGTCTTGG + Intergenic
1064284497 10:13980805-13980827 TTTTCTACTATCGTTGGTCTGGG - Intronic
1065486868 10:26244265-26244287 ATTCCCACTCTCAGTGGACGAGG - Intronic
1067053055 10:43036186-43036208 ATTCCCACTCTCATCTGTCCTGG - Intergenic
1067525335 10:47035202-47035224 TTTCCCACCCTCACTGCTCCCGG + Intergenic
1069827602 10:71263566-71263588 TTTTCCTCTCTGATTGTTCTCGG - Intronic
1070810808 10:79296844-79296866 GTTCCTATTCTCATTCGTCTCGG + Intronic
1071744244 10:88397963-88397985 TTTCCCCCACTGAGTGGTCTTGG - Intronic
1073182732 10:101594958-101594980 ACTCCCTCTCTCATTTGTCTGGG - Intronic
1073285083 10:102382694-102382716 TTTCCCACTCCCATTAGCCCTGG + Exonic
1075302447 10:121337435-121337457 TTTCTCACTTTCATTTCTCTGGG - Intergenic
1077899724 11:6478707-6478729 TCCCCCACCCTCTTTGGTCTGGG + Intronic
1078721481 11:13888669-13888691 TTTCCCAGTCTCCTTGATCATGG - Intergenic
1084183057 11:67456073-67456095 TTTCCTACTCTGATGGGGCTGGG + Intronic
1085437143 11:76516712-76516734 TTTCTAACTCTAATTGGTCTTGG - Intronic
1085582873 11:77670741-77670763 TTTCCCTTTCTCTTTTGTCTTGG + Intronic
1086405228 11:86493717-86493739 TTTCCAAATCTCCTTGGTATTGG + Intronic
1086445836 11:86869474-86869496 TTTGCCTCTCTCATTAGGCTCGG - Intronic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1087599893 11:100300448-100300470 TTTACCACACTTATTGGTATGGG - Intronic
1087956013 11:104288916-104288938 TTTTCTACTCCCATTAGTCTAGG - Intergenic
1089649706 11:119904825-119904847 TTTCCCTCTCTGCTTGGTCACGG + Intergenic
1092707960 12:11305332-11305354 CTTCCAACTCTATTTGGTCTTGG - Intergenic
1093973609 12:25397344-25397366 CTCCCCACTCTCATTGTCCTCGG - Intergenic
1094168429 12:27465978-27466000 TTTCCCTCTCCCATTATTCTTGG - Intergenic
1094228410 12:28074143-28074165 TTTCCAACTCACATTGTCCTTGG - Intergenic
1095378385 12:41558943-41558965 TTTCTCACTCTCATCTCTCTGGG - Intronic
1097616485 12:61890309-61890331 TTTGCCACTCTCATTACTCCAGG + Intronic
1098373114 12:69780739-69780761 CTGCCCACTGACATTGGTCTTGG - Intronic
1100879776 12:99003902-99003924 TTTCCCACTCTCATGCTGCTGGG + Intronic
1101800573 12:108018264-108018286 TTTCCCAGTCTCCTTGGAGTTGG + Intergenic
1103253386 12:119520271-119520293 TGTCCCACTTTCCATGGTCTGGG - Intronic
1107966546 13:45603136-45603158 TTTCTCATTCTTCTTGGTCTGGG - Intronic
1108567381 13:51713950-51713972 TTTCCCCCTCTCCTGGGCCTTGG - Intronic
1109140894 13:58713167-58713189 TTTCTGACTCTCATTGTTTTAGG + Intergenic
1109158109 13:58936459-58936481 TTTCCCACTCTCTCTCGTCCTGG + Intergenic
1109165811 13:59033407-59033429 TTTCCTATTGTCATTGGTGTCGG + Intergenic
1112646118 13:101334057-101334079 TTTCTCGCTCTCATTGAACTCGG - Intronic
1114887251 14:26869134-26869156 TTTCCCCATCTCATTGATATTGG - Intergenic
1115283819 14:31695434-31695456 TTTCCCACTCACTATGGTTTGGG + Intronic
1115480197 14:33852929-33852951 TTTCCCACACTCATGGTTATTGG + Intergenic
1117130812 14:52685266-52685288 TTTCCCACTCTTACTTGTTTTGG + Intronic
1117658370 14:57979627-57979649 TTTCCCTCTTGCATTGGTCAAGG - Intronic
1119267394 14:73271175-73271197 GTTCCCACTATGATGGGTCTTGG + Intronic
1123147500 14:106147111-106147133 TTTCCAGCTCTCATTCTTCTTGG - Intergenic
1127713696 15:61626558-61626580 TTTCCCACTTACATGTGTCTGGG - Intergenic
1128134410 15:65252185-65252207 TTTCCCACTCTCATTGGTCTTGG - Intronic
1128212274 15:65910989-65911011 TTTCCCACTCTGCCTGGTATGGG + Intronic
1129144595 15:73635129-73635151 TTTCCCATACTCTTTCGTCTTGG + Intergenic
1130796213 15:87212454-87212476 TTTCCCTCTATCATTGCCCTTGG - Intergenic
1131598882 15:93827200-93827222 CTTCCCACTCTCCATTGTCTAGG + Intergenic
1133490402 16:6262614-6262636 TTTCCCACTTTCATTCGGCCTGG + Intronic
1134891610 16:17846171-17846193 TTTCAGTCTCTCATTGGCCTTGG - Intergenic
1135825738 16:25726924-25726946 TTTTCCATTCTCAGTGGTCATGG + Intronic
1139875864 16:70145478-70145500 TTTCTCACTCTCAGCAGTCTCGG + Intronic
1141529343 16:84635393-84635415 TTTCACACTCCCATTGGTCAAGG - Intergenic
1143064344 17:4232889-4232911 TTTGCCACTCTCATTCATTTTGG + Intronic
1146904925 17:36612184-36612206 TTTCCCTGTCCCAGTGGTCTGGG + Intergenic
1147937446 17:44020747-44020769 TATCCCACTCCCATTGGTATTGG + Intronic
1150327419 17:64268247-64268269 GTTCCCACTTTCATTCCTCTTGG - Intergenic
1150615203 17:66764949-66764971 TCTCTGGCTCTCATTGGTCTAGG - Intronic
1151136666 17:71952833-71952855 TTTCCCGCTTTGAATGGTCTTGG - Intergenic
1154257665 18:12798050-12798072 TTTCTCACTCTCAGTGATCTGGG + Intronic
1160318867 18:77871888-77871910 TTTCTCCTTCTCTTTGGTCTCGG - Intergenic
1164947353 19:32307631-32307653 TGTCCCACTCTCATTGTTGGTGG - Intergenic
1165876367 19:39010367-39010389 TTTCCCCCACTGAATGGTCTTGG + Intronic
929374343 2:41267082-41267104 TTTCCCACTCTCTTCAGTTTTGG - Intergenic
929904460 2:46034035-46034057 TTACCCACTGTCAGTGGGCTGGG - Intronic
932266662 2:70373346-70373368 CTTTCCATTCTCATTGGTTTAGG + Intergenic
934555628 2:95285700-95285722 TTTCCCACTCACTTGGGCCTGGG - Exonic
934746798 2:96764539-96764561 TTCCCCATTCTCAGAGGTCTTGG + Intronic
937746503 2:125421850-125421872 TTTCACACTCTCATTGTTTAAGG - Intergenic
938196797 2:129335729-129335751 TTCCCCACTGTCATTGGTTGGGG + Intergenic
941665232 2:168238058-168238080 TTTCCTACTCTGTTTAGTCTGGG - Intronic
946390512 2:219413299-219413321 TTTCCCCCACTGAATGGTCTGGG - Intergenic
947457264 2:230266143-230266165 TTTCCTTCAGTCATTGGTCTTGG + Intronic
1171120686 20:22566743-22566765 TTTCCTACTCTTCTTTGTCTTGG - Intergenic
1174229761 20:49036761-49036783 TTTCCCCCTTTCATTGGTGAGGG - Intergenic
1174996647 20:55577179-55577201 CTTCCAATTCTTATTGGTCTAGG + Intergenic
1177296050 21:19177125-19177147 TTTCCCAATCTCATTTCCCTTGG - Intergenic
1178999519 21:37443680-37443702 TTTCCCATTCTGGTTGGTGTGGG + Intronic
1180891930 22:19295216-19295238 TTTAACACTCTCATTGCCCTAGG + Intergenic
1180942850 22:19671004-19671026 TTTCCCACTGTGATATGTCTTGG + Intergenic
1183133236 22:35860159-35860181 TTTGTGACTCACATTGGTCTTGG + Intronic
1183787754 22:40040696-40040718 TTTCCCTGCCTCATTGCTCTTGG + Exonic
1184858265 22:47158346-47158368 TTTAGCACTGTCATTCGTCTTGG + Intronic
1185252012 22:49807494-49807516 TTTTCCCCTCTGAATGGTCTTGG - Intronic
950110618 3:10416547-10416569 GTTCCAACTCTAATAGGTCTGGG - Intronic
952040897 3:29260522-29260544 TTTCCCACTCCCACTGATTTTGG - Intergenic
952115367 3:30173711-30173733 TTACCCACTTTTATTTGTCTTGG - Intergenic
952358760 3:32609006-32609028 TTTTCCTCTCTCATAGCTCTTGG + Intergenic
952582540 3:34851650-34851672 TTACCCAGTCTGATTGTTCTTGG - Intergenic
952942596 3:38455229-38455251 TTTCCCTCTCTCAGTGGTGCCGG + Intronic
954522779 3:51243957-51243979 TTTCCCCCACTGAATGGTCTTGG + Intronic
957112746 3:75986831-75986853 TTTCCCACATTCAATGGTCTTGG + Intronic
958265242 3:91430495-91430517 TTTCCCTCTCTCCTGGCTCTAGG + Intergenic
960252487 3:115471392-115471414 TTTTCCATTCTAATTGTTCTAGG - Intergenic
960966111 3:123105913-123105935 TCTGCCACTCTCACTGGTCCAGG - Intronic
961066712 3:123882755-123882777 TCTCCCACTCTCAGTGGGCCAGG - Intronic
961559314 3:127717788-127717810 TTTCCCACCCTTAGTTGTCTGGG - Intronic
962581722 3:136804097-136804119 ATCCCCACTCTCTTTGGTCTAGG - Intergenic
963962316 3:151323149-151323171 TCCCCCACTTTCAATGGTCTTGG + Intronic
966737884 3:183203999-183204021 TTCCCCACTTTGAATGGTCTTGG - Intronic
966799680 3:183751206-183751228 TTTCCCCCACTGAATGGTCTTGG + Intronic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
973257636 4:48129068-48129090 TTTTCCCCTCTCCTTGGTGTGGG - Intronic
974411488 4:61546504-61546526 TTTACTATTCTCATTGCTCTTGG + Intronic
975842361 4:78488422-78488444 ATGGCCACTCACATTGGTCTTGG - Intronic
976105543 4:81613308-81613330 TCTCCCCTTCTCATTGGTCTTGG + Intronic
976312888 4:83629963-83629985 TTTCCCACTCAAATGGTTCTTGG - Intergenic
977301580 4:95273793-95273815 TCTCCCACTCCCAGTGGCCTTGG + Intronic
979934776 4:126678264-126678286 TTTTCCACTCTCATTTTTCTGGG - Intergenic
979964007 4:127055627-127055649 CTGCCCACTGACATTGGTCTTGG + Intergenic
981379574 4:144057236-144057258 TTTCCCAGTCTCATAGTCCTTGG + Intergenic
982861034 4:160449359-160449381 TTTCTCACTCACTTTGCTCTAGG - Intergenic
982922500 4:161293219-161293241 TTTCCCTCTCTCCATGGTTTTGG + Intergenic
982922815 4:161297287-161297309 TTTCCCTCTCTCCATGGTTTTGG - Intergenic
985066398 4:186126456-186126478 ATGCCCACTCTCATTGGTGAGGG - Intronic
985373710 4:189312977-189312999 TTTCCCACATTGAATGGTCTTGG - Intergenic
986716892 5:10531232-10531254 TTTCCCCTTTTCATTGGTGTTGG - Intergenic
987268542 5:16280721-16280743 TTGGCCACTCTCATTGCTTTTGG - Intergenic
987573193 5:19692112-19692134 TTTCCCTCTATCAGTGTTCTTGG - Intronic
989296550 5:39834281-39834303 TTTCCCACCCTCTTTTGTATTGG + Intergenic
989715007 5:44452814-44452836 CTTACCACTCTCATTTGACTAGG + Intergenic
995703038 5:114956922-114956944 TTTCCCCCTCTCATTTGCTTTGG + Intergenic
999003777 5:147953441-147953463 TTTCCCAATATCATTGTTCCTGG - Intergenic
1001537494 5:172508489-172508511 TTTCCCACTCTCAGTCCTCAGGG - Intergenic
1002545116 5:179936837-179936859 TTTCCCCCACTGAGTGGTCTTGG - Intronic
1008395688 6:51004036-51004058 TTTCTCTCTCCCATTGGTCAGGG - Intergenic
1008470951 6:51884281-51884303 TTTCCCACATTGAATGGTCTTGG + Intronic
1008964182 6:57297888-57297910 TTTCTCAGTCTCCTTTGTCTGGG - Intergenic
1009178712 6:60490701-60490723 TTTCCCTCTCTCCTGGCTCTAGG - Intergenic
1010168977 6:72952308-72952330 TTTTCCATTCTACTTGGTCTAGG + Intronic
1011089377 6:83578996-83579018 TTTCCCTCACTGAATGGTCTTGG + Intronic
1012122848 6:95388626-95388648 TTTCCCACTTTCTTTGGATTAGG - Intergenic
1012307602 6:97677696-97677718 CTTCCCACTCTCATTGGTCTGGG + Intergenic
1012347314 6:98206701-98206723 TATCCCACTCTCTTTGTTCTTGG - Intergenic
1014375119 6:120662445-120662467 TTTACCACACTCATTTTTCTAGG + Intergenic
1018879144 6:167858515-167858537 TTTCCCACTTTCAGTGAACTTGG + Intronic
1019160128 6:170063830-170063852 TTTCCCACTCTCCTGGTTCCAGG - Intergenic
1020580158 7:9987690-9987712 TTTACCTCTCTCATGTGTCTGGG - Intergenic
1023087814 7:36589583-36589605 TCTCCCACGCTCATTGGGCATGG - Intronic
1024342253 7:48278831-48278853 TTTCACACTGTCCTTGGTATTGG - Exonic
1024494497 7:50029214-50029236 TTTTCCACACTGAATGGTCTTGG - Intronic
1029988435 7:104941850-104941872 CTTGCCACTCTCATTAGACTGGG + Intergenic
1030033103 7:105387571-105387593 TTTCCCCTTCTCGTTGGCCTTGG - Intronic
1030672216 7:112350180-112350202 TCACCCACTCCCATTGGTCATGG + Intergenic
1031940140 7:127779844-127779866 TTACCCACTCTCATTATTCAAGG + Intronic
1032500261 7:132394753-132394775 TTTCCCACTGTCCTTGCCCTGGG + Intronic
1036727048 8:11229837-11229859 ATTCCCACTCTCACAGGGCTGGG + Intergenic
1036729772 8:11252158-11252180 TTTCCCCCACTGAATGGTCTTGG - Intergenic
1043494712 8:80787913-80787935 TTTCCTCCTCTCATTGGAGTAGG - Intronic
1043539811 8:81248063-81248085 TTTCCCCCACTGAATGGTCTTGG - Intergenic
1045264669 8:100609068-100609090 TTTCAGACTCTCATTGTTCCTGG + Intronic
1050373009 9:4941672-4941694 TTTCCCTCTCTCATTGATGTTGG - Intergenic
1051135201 9:13912286-13912308 TTGCCCACTCGCATTGGTGAGGG + Intergenic
1051523421 9:18015798-18015820 TATCCTAATCTCATTGGTCTCGG - Intergenic
1051838135 9:21363672-21363694 TTTCCCACTGTCTCTGGTCTTGG + Intergenic
1051845584 9:21448143-21448165 TTGCCCACTGTCTCTGGTCTTGG - Intergenic
1051927284 9:22344334-22344356 TTTCCAACTCTCCATGCTCTAGG - Intergenic
1052996204 9:34552756-34552778 TGTCCCAATCTCATTGTCCTTGG + Exonic
1188375638 X:29424717-29424739 TTTTCCAAGATCATTGGTCTTGG + Intronic
1191576545 X:62712902-62712924 TTTCACAATCTGATTTGTCTAGG + Intergenic
1193450273 X:81656966-81656988 TTTTCCCCTCTCTTTGCTCTTGG + Intergenic
1193775913 X:85641755-85641777 GCTCACACTCTCATTGGGCTGGG + Intergenic
1196474033 X:116061660-116061682 CTGCCCACTGACATTGGTCTTGG - Intergenic
1197078048 X:122376888-122376910 TGTCCCACTATCATTGTACTGGG + Intergenic
1199200882 X:145087865-145087887 TTTCCCTTTCTCACTGCTCTAGG - Intergenic
1200491882 Y:3835856-3835878 TTTTCCATCCTCCTTGGTCTTGG + Intergenic