ID: 1128134711

View in Genome Browser
Species Human (GRCh38)
Location 15:65254336-65254358
Sequence GGATGCTCCAAATGTCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128134711 Original CRISPR GGATGCTCCAAATGTCAGGT TGG Intronic
901621147 1:10588598-10588620 GGATGATCCACATCTCAGGTAGG - Intronic
901883620 1:12208135-12208157 GGAGGGTGCAAATGGCAGGTGGG - Exonic
903424756 1:23245501-23245523 TGAGGCTGCAAATGCCAGGTTGG + Intergenic
904398101 1:30236553-30236575 GGATTCTCCAAGAGTCAGGTGGG - Intergenic
908044390 1:60152924-60152946 GAATGCTACATTTGTCAGGTGGG - Intergenic
908140312 1:61177754-61177776 GGATGGTTCAAATTTGAGGTGGG - Intronic
908359697 1:63357045-63357067 GGTTCCTCCAAATATAAGGTTGG - Intergenic
909680468 1:78286086-78286108 GGATGCTCTACAAATCAGGTGGG + Intergenic
910569963 1:88688819-88688841 GAATGCTCCATTTGTCACGTAGG + Intronic
911765538 1:101670204-101670226 GGGTTCTCCAAATGTTAGCTGGG - Intergenic
916959828 1:169877866-169877888 AGATTCTCCAAATATCATGTTGG - Intronic
920343093 1:205287978-205288000 GGATGCTCCAGAAATCAGGCTGG - Intergenic
1064007245 10:11708396-11708418 GTATGACCCAAATGTGAGGTGGG + Intergenic
1067225222 10:44371933-44371955 GAACACTCCAAATGTCAGGCAGG + Intronic
1067279876 10:44863103-44863125 GGCTGCTCCAGATGTCAGAAAGG + Intergenic
1072724026 10:97800563-97800585 TGCTGCTCCAAAGGTCAGGCAGG - Intergenic
1073114652 10:101084857-101084879 GGATGCTCCAAACAGCAGCTTGG - Intergenic
1073442453 10:103560423-103560445 GGCTGCTAGAAATGTCAGGATGG + Intronic
1081118928 11:39239805-39239827 GGATGATTCACATCTCAGGTGGG + Intergenic
1085549975 11:77360076-77360098 GGAGGCTCCAGGTGTCAGGCAGG - Intronic
1087206277 11:95398990-95399012 GGCTGCTCCAGCTGTGAGGTGGG - Intergenic
1088328769 11:108628838-108628860 GGATGTGCCAAATGGCAGGACGG - Intergenic
1089573988 11:119428494-119428516 GAATGCTCCAAGTGTCATTTGGG + Intergenic
1090249925 11:125244195-125244217 TCATGCTCCAAATGTCAGCAAGG + Intronic
1091435185 12:466478-466500 GAAAACTCCAAATGTCTGGTTGG - Intronic
1093088059 12:14888831-14888853 GGATTCTCCTCATGTGAGGTTGG + Intronic
1094169461 12:27477589-27477611 TGGTGTCCCAAATGTCAGGTAGG + Intronic
1095848096 12:46769095-46769117 GGTGGCTCCCAATGTCAGTTAGG + Intronic
1097480340 12:60116295-60116317 GGCTGCTCCAAATCTCTTGTTGG - Intergenic
1097652208 12:62313916-62313938 GGAGGCTCCAAATGACCGTTGGG - Intronic
1098273798 12:68793788-68793810 GGGTGCTTTAAATGACAGGTCGG - Intronic
1098841427 12:75482764-75482786 TCATGCTGCAAATGTGAGGTAGG - Intronic
1099768406 12:87020766-87020788 GGGTGTTCCAAATGTCTGGATGG - Intergenic
1101438253 12:104682641-104682663 AGATTCTCCCAATGTCAGTTTGG - Intronic
1108102385 13:46970451-46970473 GGATCCTCGAAATGTCAGAGTGG + Intergenic
1109180782 13:59211988-59212010 GGATGCTTCACCTGCCAGGTGGG + Intergenic
1111840204 13:93440561-93440583 GGAAGCTCCACAAGCCAGGTGGG - Intronic
1112878549 13:104077154-104077176 GGATTCTATAAATGTCAAGTGGG - Intergenic
1118142464 14:63099435-63099457 GGATTCTCCATATCTGAGGTAGG + Intronic
1121170102 14:91846591-91846613 GGATGCTCCACAGGGCACGTGGG - Intronic
1121602552 14:95216798-95216820 TGCTGGTCCAGATGTCAGGTTGG - Intronic
1126166973 15:45661840-45661862 CGATGCTCTAAAGGTCAGGAGGG + Intronic
1128134711 15:65254336-65254358 GGATGCTCCAAATGTCAGGTTGG + Intronic
1129881368 15:79008608-79008630 GGATGCAGCAAATGGCAGATCGG + Intronic
1130243720 15:82222889-82222911 CGAAGATTCAAATGTCAGGTTGG + Intronic
1130456756 15:84118386-84118408 TGAAGATTCAAATGTCAGGTTGG - Intergenic
1132134839 15:99325732-99325754 TGATGCTAGAAATGTAAGGTTGG - Intronic
1137561989 16:49508705-49508727 GGATGCTCCTGAAGTCAGGGAGG + Intronic
1139312804 16:66041570-66041592 GGTTCCTTCAAATGTCAAGTGGG - Intergenic
1141548398 16:84787551-84787573 GGTTGCTGCAAATCTGAGGTTGG - Intergenic
1146521801 17:33531358-33531380 GTCTGCTCAAGATGTCAGGTCGG - Intronic
1162590219 19:11586563-11586585 GGTTTCTCCAGATGGCAGGTCGG - Intronic
1163777558 19:19227161-19227183 GGAAGCTCCAAATCCCAGCTGGG + Intronic
1164266737 19:23625831-23625853 GGTTTCTCCATGTGTCAGGTCGG - Intronic
1165419350 19:35715400-35715422 GGATGCTCCACAGGGCAGGCTGG - Exonic
925334996 2:3090688-3090710 GTATCCTCCAAAGGTAAGGTGGG - Intergenic
926240367 2:11080657-11080679 GGATGCTTCAGAGGTCAGGGAGG - Intergenic
927443931 2:23141311-23141333 GGATTCTCCAAATATGAGGGCGG + Intergenic
929056301 2:37879833-37879855 GGAGGCACCAAATGGCAGGCAGG + Intergenic
929754079 2:44749299-44749321 GGATGAACCAACTTTCAGGTAGG - Intronic
935388858 2:102529745-102529767 GCATTCTCCAAGTTTCAGGTGGG - Intronic
942104542 2:172619813-172619835 GGATGCTGCAAATTACAGATTGG + Intergenic
944355886 2:198787477-198787499 GGTTTCTCCAAATCTCAGCTTGG + Intergenic
946414421 2:219532460-219532482 GGATGGTGCACATGCCAGGTGGG + Exonic
949017397 2:241721037-241721059 GGCAGCTCAAGATGTCAGGTCGG + Intronic
1170732172 20:18985008-18985030 GGAAGCTCCAACAGTCAGGCAGG + Intergenic
1170905643 20:20513502-20513524 GGATGTTCCAGATCTCAGGGAGG + Intronic
1171006477 20:21470676-21470698 AGATGCTCCAAATCTTAGGCTGG + Intergenic
1179099690 21:38345890-38345912 TGATGACTCAAATGTCAGGTAGG - Intergenic
1181868812 22:25881544-25881566 GACTGCTTCAAATGTCAGCTCGG - Intronic
952607045 3:35160720-35160742 GGATCCTATAAATGTCAGTTAGG - Intergenic
953350213 3:42209801-42209823 GGATGCCCCCAAGGTGAGGTTGG - Exonic
959752266 3:109852428-109852450 GAATGCTATAAATGTCAGTTAGG - Intergenic
959815147 3:110666046-110666068 GGGTGCTCAAAATGTAAGGGAGG + Intergenic
960959225 3:123057433-123057455 GGATGCTGCAAATATGAGGCAGG + Intergenic
966564946 3:181368253-181368275 GGATGCAGCAAAAGTCATGTAGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
974622785 4:64383412-64383434 TGATGCCCCATATGTCAGGCAGG + Intronic
984499717 4:180544447-180544469 GGATGGCCCAAATGTGAGGCAGG - Intergenic
987922506 5:24301879-24301901 GGATGTTACAAATTTCATGTGGG + Intergenic
998967310 5:147554593-147554615 AGTTCCTCCAAATGTCAGGCTGG - Intergenic
999120632 5:149206872-149206894 GGAAGCTTCCAGTGTCAGGTGGG + Intronic
1004807383 6:19219054-19219076 GGATGGTTCAAATCCCAGGTGGG - Intergenic
1007043179 6:38744417-38744439 CCATTCTCCATATGTCAGGTTGG - Intronic
1011488912 6:87871162-87871184 GGAAGCTGAAAATGTCATGTTGG - Intergenic
1011787160 6:90859810-90859832 CGATCCTCCAAATGCCAGGCGGG + Intergenic
1018239181 6:161755297-161755319 GGCTGCTCCCACTGTCACGTGGG - Intronic
1018850727 6:167588651-167588673 GGCTGGTCCACATGTCAGGCAGG - Intergenic
1019217518 6:170453395-170453417 GGCTGCTCCAATTGGCAGCTGGG - Intergenic
1022411564 7:30142357-30142379 GCCAGCTCCAAATCTCAGGTTGG - Intronic
1024807962 7:53169338-53169360 GGATATTCTAAATGTCAGGGTGG + Intergenic
1026934928 7:74249007-74249029 CAATGCTTCAAATGACAGGTAGG - Exonic
1027343128 7:77231088-77231110 GGATGATTCACATTTCAGGTGGG - Intronic
1032099205 7:128959172-128959194 TCATGCTCCCAATGTCAGGAAGG + Intronic
1034267501 7:149788374-149788396 GGATGCTGCTCATGGCAGGTGGG - Intergenic
1038431922 8:27507330-27507352 GCATGCTCGACATGCCAGGTAGG - Intronic
1039743743 8:40405272-40405294 GGATGCTCTAAAAGCCAGGCAGG + Intergenic
1041524512 8:58790247-58790269 GGATAATGAAAATGTCAGGTCGG - Intergenic
1049915938 9:318704-318726 GGAAGCTCCCACTGCCAGGTTGG - Intronic
1050364921 9:4864955-4864977 TGATGCCCCAAAGGTAAGGTCGG + Intronic
1050764683 9:9117519-9117541 GGACACTCCAAATGTAAAGTTGG + Intronic
1058980864 9:110168933-110168955 TGATGCTGCAAGTGACAGGTGGG - Exonic
1060284882 9:122241627-122241649 GGATGCTCTAATTGGCTGGTTGG - Exonic
1186372539 X:8961945-8961967 GGAGGCTCCAAATGCCAGGGTGG - Intergenic
1190874430 X:54449580-54449602 GGATCATCTAAAGGTCAGGTGGG + Intronic
1196258681 X:113552712-113552734 AGATTCTGCAAATGTCAAGTGGG - Intergenic
1198542176 X:137651793-137651815 GAGGGCTCCAAAAGTCAGGTAGG + Intergenic
1201291405 Y:12423778-12423800 GGGTGCTCCAGGTATCAGGTGGG - Intergenic