ID: 1128135511

View in Genome Browser
Species Human (GRCh38)
Location 15:65260340-65260362
Sequence CACACTGCAGAGATGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 222}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128135502_1128135511 8 Left 1128135502 15:65260309-65260331 CCCCAACGCTGGTGAGCCCCACA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG 0: 1
1: 0
2: 2
3: 23
4: 222
1128135504_1128135511 6 Left 1128135504 15:65260311-65260333 CCAACGCTGGTGAGCCCCACACT 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG 0: 1
1: 0
2: 2
3: 23
4: 222
1128135503_1128135511 7 Left 1128135503 15:65260310-65260332 CCCAACGCTGGTGAGCCCCACAC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG 0: 1
1: 0
2: 2
3: 23
4: 222
1128135507_1128135511 -10 Left 1128135507 15:65260327-65260349 CCACACTTACTCCCACACTGCAG 0: 1
1: 0
2: 2
3: 30
4: 305
Right 1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG 0: 1
1: 0
2: 2
3: 23
4: 222
1128135501_1128135511 9 Left 1128135501 15:65260308-65260330 CCCCCAACGCTGGTGAGCCCCAC 0: 1
1: 0
2: 1
3: 4
4: 88
Right 1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG 0: 1
1: 0
2: 2
3: 23
4: 222
1128135506_1128135511 -9 Left 1128135506 15:65260326-65260348 CCCACACTTACTCCCACACTGCA 0: 1
1: 0
2: 1
3: 29
4: 269
Right 1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG 0: 1
1: 0
2: 2
3: 23
4: 222
1128135505_1128135511 -8 Left 1128135505 15:65260325-65260347 CCCCACACTTACTCCCACACTGC 0: 1
1: 0
2: 9
3: 55
4: 451
Right 1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG 0: 1
1: 0
2: 2
3: 23
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128135511 Original CRISPR CACACTGCAGAGATGGAACT AGG Intronic
900854392 1:5169309-5169331 CACAATGAATAGAAGGAACTTGG + Intergenic
903976168 1:27151736-27151758 CACACTGCAAAGGTGAAGCTGGG + Intronic
905785664 1:40755195-40755217 AACACTGTAGAGATGGCCCTAGG + Intronic
906946611 1:50300182-50300204 CACCAGGCAGAGATGGAACAGGG + Intergenic
907499314 1:54866788-54866810 CACTCTGCAGGGAGGAAACTGGG + Intronic
910711811 1:90189896-90189918 CCCACTGCAGAGAGGGAAAGAGG - Intergenic
911753502 1:101525943-101525965 CAAAATGCAGAGATGGAAAAGGG - Intergenic
914730655 1:150366897-150366919 CACACAGCAGAGACGGGACAGGG - Intronic
917405506 1:174702204-174702226 CACCATGCAGAGTGGGAACTTGG - Exonic
917954995 1:180086138-180086160 CACAATACAGAGATGGAATAGGG + Intronic
918956248 1:191211631-191211653 CACACACCAGAGGTGGGACTGGG + Intergenic
921307903 1:213815281-213815303 CACACTGCATCGAAGAAACTGGG - Intergenic
924258372 1:242204651-242204673 CATGCTGCAGTGATGGCACTAGG + Intronic
924734684 1:246745278-246745300 CACAGTGCAGACCTAGAACTGGG - Intronic
924824875 1:247528893-247528915 TCCACTGCAGAGATGGATCTTGG + Intronic
1062971878 10:1654517-1654539 CACACTGCACAGGTGGAAAGAGG - Intronic
1063061233 10:2555599-2555621 CAGACTCCAGAGAAAGAACTTGG - Intergenic
1063146330 10:3298180-3298202 CAGACAGCAGAGGTGGAAATGGG + Intergenic
1063585356 10:7347303-7347325 CACCATGCAGACATGGAATTTGG + Intronic
1064498641 10:15943696-15943718 TACTCTGCAGAGATGAAATTAGG - Intergenic
1064833569 10:19499552-19499574 CACCCTGCAGATATTGGACTTGG + Intronic
1064949507 10:20832232-20832254 CACACTGCAGAATTGGTTCTGGG + Intronic
1065770435 10:29073194-29073216 CCCACTGCAGCCATGGAACTTGG - Intergenic
1066644897 10:37596442-37596464 CACACTGGTGAGATGGAATGTGG - Intergenic
1067574261 10:47398383-47398405 CACATTGCAGAAATGGAAGTGGG - Intergenic
1070674800 10:78405202-78405224 CACATTGCACAGATGAAACTCGG + Intergenic
1071201326 10:83222728-83222750 CAAACTGCAGAAATGTTACTAGG - Intergenic
1073139928 10:101240288-101240310 CACACAGTAGAGCTGGGACTAGG - Intergenic
1076252657 10:128996246-128996268 CACTCTGCAGAGAAGGAAACTGG + Intergenic
1076287132 10:129311355-129311377 CACACACCAGAGAGGGAGCTGGG + Intergenic
1077134935 11:993783-993805 GACGCTGCACAGGTGGAACTTGG - Exonic
1083311314 11:61785238-61785260 CACACAGCAGACATGGTGCTCGG + Intronic
1083752109 11:64766510-64766532 GAGACTGCAGAGGTGGGACTGGG - Intronic
1084695048 11:70748104-70748126 CACACAGCAGAGAAGGACCCTGG + Intronic
1084899187 11:72297079-72297101 CTCACTGGAGAGATGCAACTGGG + Intronic
1085394846 11:76202047-76202069 AGAACTGCAGAGAGGGAACTTGG - Intronic
1085627307 11:78083311-78083333 GTCACTGCACAGATGGAACATGG - Intergenic
1085760154 11:79234607-79234629 CACTCTGCAGAGGTGGAAGAAGG - Intronic
1086007524 11:82055490-82055512 CACACTGCTGTGGTGGAAATAGG + Intergenic
1086782827 11:90929203-90929225 CAAACTGCAGAAATGCTACTAGG + Intergenic
1089914713 11:122142424-122142446 GACAGTGCAGAGATAGAATTGGG + Intergenic
1091345781 11:134853065-134853087 CACAGTGCAAAGAGGGAACAAGG + Intergenic
1093706430 12:22279614-22279636 CAGAATGCAGAGATGAAAATGGG - Intronic
1094309123 12:29058384-29058406 CACAGTGAAGAAATTGAACTTGG + Intergenic
1095594023 12:43938547-43938569 CACACTGAGGAAATGGAGCTGGG + Intronic
1096611609 12:52805692-52805714 CAGACTGCAGAGCAGGAGCTGGG + Intergenic
1096719502 12:53510480-53510502 GACACTGCAGAGCTGGTTCTGGG + Intronic
1097223356 12:57462847-57462869 GACACTGCAGAGATTGTACACGG + Intronic
1097747689 12:63317779-63317801 CAAACTGCAGAAATGTTACTAGG - Intergenic
1101816333 12:108148903-108148925 CACACAGCAGATGTGGAGCTGGG + Intronic
1103083593 12:118044323-118044345 CATACTGCAGGTTTGGAACTAGG + Intronic
1104165723 12:126227686-126227708 CACACTGCATAGCTTAAACTGGG - Intergenic
1105881194 13:24607815-24607837 TGCACTGCAGTTATGGAACTCGG - Intergenic
1105951681 13:25234814-25234836 CCCATTGCAGAGCTGGAACTAGG + Intergenic
1107762472 13:43695283-43695305 CACACTGCAGGGATCTAAGTAGG + Intronic
1108557251 13:51605997-51606019 CACAATGCAGAGATGGCAAAAGG + Intronic
1112032434 13:95470097-95470119 AACCCTGCAAATATGGAACTAGG + Intronic
1114272097 14:21107153-21107175 CCCATTGCAGAGGAGGAACTTGG - Intergenic
1114318306 14:21526233-21526255 CAGACTGCGGAGATGGAGATCGG + Intronic
1117050690 14:51856788-51856810 TTCAATGCAGAAATGGAACTAGG + Intronic
1117053224 14:51883270-51883292 CTTTCTGCAGAGATGTAACTAGG + Intronic
1117208431 14:53469903-53469925 CACCCTTCAGGGAGGGAACTGGG + Intergenic
1117502791 14:56370729-56370751 CACCCTCCTGAGATGGAACCAGG - Intergenic
1117823092 14:59671810-59671832 CACTCTACAGAGCTGGACCTGGG + Intronic
1118251956 14:64170561-64170583 CACACTGCAGAGAGCCCACTTGG - Intronic
1118877652 14:69798242-69798264 CCCACTGCAGAGGTGGGACAAGG + Intergenic
1119783919 14:77298292-77298314 CACCCTCCAGAGATGGAGCCTGG - Intronic
1121427443 14:93862603-93862625 CACCCTGCAGAGAAGGGTCTGGG + Intergenic
1122703739 14:103607483-103607505 CAGACTCCAGAGCTGGAACCTGG + Intronic
1123771896 15:23537400-23537422 CACACTGGACAGATGCAACAAGG - Intergenic
1124090921 15:26599249-26599271 CACATTCCAGAGATGGAAAGGGG + Intronic
1124149161 15:27161382-27161404 CACACTGCCCCCATGGAACTTGG - Intronic
1124354486 15:28984766-28984788 CAAACTCCAGAGATGGCAGTGGG - Intronic
1127199534 15:56628888-56628910 AACACTGAAGAGATGGAAAGGGG + Intergenic
1127723815 15:61728171-61728193 CCCTCTTCAGAGATGGAGCTTGG + Intergenic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1129693720 15:77728635-77728657 CACATTGCAGACATGGAAACGGG - Intronic
1131482879 15:92797025-92797047 CATATAGCAGAGATGGAACAAGG - Intronic
1131749255 15:95488919-95488941 CCCACTGCAGAAATGGAAAAGGG - Intergenic
1133601282 16:7342660-7342682 GACAGTGCAGAGATACAACTGGG + Intronic
1134131477 16:11653242-11653264 CACACTGCAGAGTTTGAACCAGG - Intergenic
1140801631 16:78493757-78493779 CATACAGAAGAGATGGAACTAGG + Intronic
1141032819 16:80604344-80604366 CACAGGGCAGAGCTGGAAGTTGG + Exonic
1141459341 16:84168215-84168237 CACACTGCTGGCATGGAAGTTGG - Intronic
1141869652 16:86775906-86775928 CCCACTGCAGTGATGAATCTGGG - Intergenic
1142029565 16:87831801-87831823 CCGCCTGCAGAGAGGGAACTAGG - Exonic
1144667708 17:17112984-17113006 CAGACAGCTGGGATGGAACTTGG + Intronic
1146000753 17:29128939-29128961 GACACAGCAGAGATGGAGCATGG + Intronic
1146000755 17:29128961-29128983 GACACAGCAGAGATGGAGCATGG + Intronic
1146008637 17:29177969-29177991 CACCCTGCTGAGGTGGAGCTGGG - Intronic
1146886593 17:36474930-36474952 CAAACTGCAGAAATGTTACTAGG - Intergenic
1146943176 17:36857997-36858019 CTCACTCCAGAGAAGGAACGCGG - Intergenic
1151144995 17:72032180-72032202 CAAAGGGAAGAGATGGAACTGGG - Intergenic
1151237812 17:72734321-72734343 CAGGCTGCAGAGAAGGAACGAGG - Intronic
1151783244 17:76261664-76261686 CGCACTGCAGAGATGGAGGTTGG + Intergenic
1153589079 18:6654197-6654219 CCCACTGCAGAGAAGGACCTTGG - Intergenic
1153718688 18:7879195-7879217 CTCACTGCAGAGAGGAAACCCGG - Intronic
1154435959 18:14341681-14341703 CACACTGCAGAGCTGGAGTGGGG - Intergenic
1155335624 18:24762725-24762747 CTAACTGCAGAGATGGAAAGTGG - Intergenic
1156952372 18:42918037-42918059 CACAATGCAAAAATGGTACTAGG - Intronic
1160350062 18:78170533-78170555 CCCACTACAGAGTGGGAACTCGG + Intergenic
1163333454 19:16656551-16656573 CACACTGCAGAGACCCAACATGG + Intronic
1166657559 19:44623341-44623363 CACATAGCAGAGAGGGAGCTGGG + Intronic
1167326936 19:48832466-48832488 CACACAGGAGGGATGGAACAGGG + Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG + Intronic
925584306 2:5447976-5447998 CAAATTGCAGAGATGGAATGAGG - Intergenic
925689918 2:6511334-6511356 CCCACTGCAGAGCTCCAACTGGG + Intergenic
926879890 2:17533207-17533229 GAAATTGCAGGGATGGAACTTGG - Intergenic
927684788 2:25162791-25162813 CTTAGTGCAGAGATGGAGCTGGG - Intronic
928177278 2:29043276-29043298 CAAACAGCAGAGATGTACCTGGG + Intronic
928862982 2:35882624-35882646 CACCCTGAAGAGAAAGAACTAGG + Intergenic
928865732 2:35915761-35915783 CACACTGCAGAGAGGGAATTAGG - Intergenic
931223505 2:60309385-60309407 CCATCTGCAGGGATGGAACTTGG + Intergenic
931864756 2:66397455-66397477 AACACTGAAGAGATGGATCCAGG + Intergenic
933782554 2:85812415-85812437 CACTTGGCAGAGCTGGAACTGGG - Intergenic
934014581 2:87866492-87866514 CAAACTGCAGAAATGTTACTAGG + Intergenic
936048107 2:109202267-109202289 GACGCTGCCGAGATGGACCTGGG - Intronic
937503621 2:122511489-122511511 TGAACTGAAGAGATGGAACTGGG - Intergenic
937882705 2:126880499-126880521 CCCACTGCAGTGGTGCAACTTGG + Intergenic
937910196 2:127071938-127071960 CACAAGGCAGAGAGGGGACTCGG + Intronic
938374407 2:130796326-130796348 CACAATGGAGAGATGGGCCTGGG - Intergenic
938722823 2:134081432-134081454 CCAGATGCAGAGATGGAACTGGG - Intergenic
945002981 2:205371485-205371507 CACTGTGCTGACATGGAACTAGG + Intronic
945571326 2:211471587-211471609 CACAGTTAAGAGGTGGAACTGGG + Intronic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
947542502 2:230988609-230988631 CACACTGAAGCCATGGAACGGGG - Intergenic
948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG + Intergenic
1170817494 20:19727090-19727112 CACTCTGCAGAGATGGAAGCAGG + Intergenic
1170818966 20:19739782-19739804 CACACAGCAGAGTGGGAAATGGG - Intergenic
1171228053 20:23457788-23457810 CACACTTCAAAAAGGGAACTTGG - Intergenic
1172571553 20:35974751-35974773 CACACTCCAGACACGGAATTGGG + Intronic
1173049485 20:39545553-39545575 CACACTGCTGGGATGGTTCTTGG + Intergenic
1173297884 20:41775409-41775431 CAGACCGCAGAGATGGAAGTTGG + Intergenic
1175164814 20:57035962-57035984 CACAGTACAGAGGTGGAACTTGG - Intergenic
1176308893 21:5139356-5139378 CACACTGGAGACCTGGCACTTGG - Intronic
1177207178 21:18023404-18023426 CACCCTGCAGAGATGGTAGCAGG + Intronic
1178613730 21:34111426-34111448 AACACTTCAGAGGTAGAACTTGG - Intronic
1178689072 21:34736151-34736173 CACAGAGCAGAGAAGCAACTAGG - Intergenic
1179848168 21:44122677-44122699 CACACTGGAGACCTGGCACTTGG + Intronic
1180031507 21:45211805-45211827 CAGCCTGCAAAGAGGGAACTAGG - Intronic
1182557349 22:31136509-31136531 CCAACTGCAGAGCTGGACCTGGG + Intronic
949619041 3:5789400-5789422 AACTCTGCAGAGATGTTACTTGG - Intergenic
950427021 3:12929846-12929868 CACACAGCAGGGATGGAGCCAGG - Intronic
953839602 3:46378805-46378827 CACACTGCAGAGATTGGTCTGGG - Intergenic
955025969 3:55167819-55167841 CAAACTGCAGAGCTGCAGCTGGG + Intergenic
956452176 3:69385890-69385912 CACGCTGCGGAGATGGTACACGG - Exonic
956641800 3:71422721-71422743 CACACTTCAGAGAAGGATCTAGG + Intronic
956760209 3:72435921-72435943 CACAGCGGAGAGATGGAACCAGG - Intronic
957228272 3:77476803-77476825 CACACTGCCCAGATGTCACTCGG + Intronic
957739887 3:84250832-84250854 TACACTGCATAGATGGAAGCTGG - Intergenic
961212300 3:125135087-125135109 GTCACTGCAGAGCAGGAACTTGG + Intronic
961556905 3:127702100-127702122 CACACTGAGGAGATGGAGCGGGG + Intronic
961918474 3:130401585-130401607 AACACTGCAGAGAAGGTACCAGG - Intronic
962050740 3:131812302-131812324 CAAACTAAAGAGATTGAACTTGG + Intronic
962642853 3:137406559-137406581 CACACTGCAGGAATGGACTTTGG + Intergenic
964263228 3:154864728-154864750 CACAGTGCTGAGATTGATCTTGG + Intergenic
966148989 3:176845295-176845317 CATACTGTAGAGATGGGACCTGG - Intergenic
969405760 4:6990601-6990623 TCCCATGCAGAGATGGAACTTGG + Intronic
971893980 4:32565693-32565715 CAGTCTGCAAAGATGGCACTAGG - Intergenic
973631787 4:52826446-52826468 CACAGTGCAGAGAATGAATTGGG - Intergenic
974165140 4:58191575-58191597 CACCCAGCAGAGCTGGTACTGGG - Intergenic
975743504 4:77453438-77453460 CCCACTGCTGAGATGGAAATTGG - Intergenic
976138989 4:81970829-81970851 CACACTACAGAGATGGCCCCTGG + Intronic
980773131 4:137404597-137404619 CACAATTAAGAGATGGAATTGGG - Intergenic
982239261 4:153282328-153282350 CACACTTAAGATATTGAACTAGG + Intronic
984346520 4:178534860-178534882 AACACTTCAGAAATGTAACTTGG + Intergenic
985819878 5:2152436-2152458 CTCACTGCACAGATGGAAGATGG + Intergenic
985819881 5:2152471-2152493 CTCACTGCACAGATGGAAGATGG + Intergenic
985819884 5:2152506-2152528 CTCACTGCACAGATGGAAGATGG + Intergenic
985819887 5:2152541-2152563 CTCACTGCACAGATGGAAGATGG + Intergenic
985819890 5:2152576-2152598 CTCACTGCACAGATGGAAGATGG + Intergenic
986580759 5:9263415-9263437 CGCACTGCAGTGAGGGATCTAGG + Intronic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
988988434 5:36644936-36644958 CACATTCCTGAGAGGGAACTTGG - Intronic
990046323 5:51436715-51436737 CACACTCAAGAAATGGAACTAGG + Intergenic
990344135 5:54854735-54854757 AACACTCCAGACAGGGAACTTGG - Intergenic
992552670 5:77874118-77874140 CCCACTGCACTGATGGAAATGGG - Intergenic
995903301 5:117094198-117094220 CACACTGCAGGGAAGGAGCTGGG - Intergenic
997607102 5:135182892-135182914 CACACAGCAGAGCTGGTGCTGGG + Intronic
998884646 5:146681463-146681485 CACACTTCAGAAATGGGACCTGG + Intronic
1001748961 5:174113449-174113471 CACACTGAAGATATGGATTTTGG + Intronic
1002171325 5:177376278-177376300 CACACAGCAGACAAAGAACTGGG + Intergenic
1003149145 6:3533982-3534004 TGCACTGCAGAGATGCAACATGG - Intergenic
1003810002 6:9768557-9768579 CAGAGTCCAGAGATGGAATTAGG - Intronic
1004060852 6:12196657-12196679 CACAATTCAGAGCTGTAACTGGG - Intergenic
1004564050 6:16779238-16779260 CACTCTGAAGAGATGGAAAGAGG - Intergenic
1005807094 6:29484317-29484339 CCTACTGCAGAGATGCATCTGGG - Intergenic
1008558226 6:52696089-52696111 TACACTGCAGGGATGTAATTTGG + Intergenic
1009700661 6:67174495-67174517 TAAACTGAAGAGATGGAAGTTGG + Intergenic
1012533167 6:100263212-100263234 CACACTGCAGTCATGCAATTAGG + Intergenic
1013648116 6:112165392-112165414 CACACAGCAAGGATGGAGCTGGG - Intronic
1016206335 6:141472495-141472517 CAAACTGCAGAGATATTACTAGG - Intergenic
1017956543 6:159182949-159182971 CACACAGCAGAGCTGGCATTTGG - Intronic
1017995994 6:159532169-159532191 CACATGTCAGTGATGGAACTCGG + Intergenic
1018943587 6:168328973-168328995 CACACTGCTTAGTTGGAGCTCGG - Intergenic
1019377279 7:699545-699567 CTCCCTGCAGAGCTGGGACTTGG + Intronic
1021083529 7:16391689-16391711 CATTCTGCAGTGATGGAAATAGG - Intronic
1021202334 7:17741104-17741126 CACACTTCAGCCATGGATCTTGG + Intergenic
1021892900 7:25204336-25204358 CACACGTCAGAGCTGGAACTAGG + Intergenic
1023150482 7:37197119-37197141 CACACTCCCGAGATGGTGCTTGG - Intronic
1025263730 7:57439396-57439418 CACAATGCAGACATTTAACTGGG + Intergenic
1026542472 7:71292122-71292144 CCCACTGCAGAAGGGGAACTGGG - Intronic
1026958159 7:74391174-74391196 CAAATTGCAAAGATGGAACATGG - Intronic
1028368904 7:90068690-90068712 GACACTGAAGAGAAGGAAATAGG + Intergenic
1029285372 7:99462112-99462134 CATAATACAGAGATAGAACTAGG - Intronic
1029982856 7:104895533-104895555 GACACTGCAGAGGTGCAACAGGG + Intronic
1030079193 7:105762721-105762743 CACACTGCAGGAAGGGAATTGGG - Intronic
1030789687 7:113708290-113708312 CACTCTGCAGATATGCAGCTGGG + Intergenic
1031669561 7:124526093-124526115 CAGAGGGCAAAGATGGAACTGGG - Intergenic
1033314460 7:140285981-140286003 CACACTGCACACATGGGAATGGG - Intergenic
1035485490 7:159220810-159220832 CACACTGCAGCGAAAGCACTGGG - Intergenic
1037667102 8:20979338-20979360 CCCACTGCTGAGATCCAACTTGG - Intergenic
1037781417 8:21871754-21871776 CAAACTGCAGAGATGGGAGAGGG + Intergenic
1038403949 8:27308060-27308082 CACACTTCAGAGCTGGAAGAAGG + Intronic
1039484633 8:37900826-37900848 CCCTCTGCAGAGCTGGGACTGGG + Intergenic
1040362898 8:46684256-46684278 CACACTGCAGAGTTGGCAAAGGG + Intergenic
1041802621 8:61816063-61816085 CAAACTCTAGAAATGGAACTGGG + Intergenic
1041990101 8:63977190-63977212 CACACTGCAATGGTGGGACTGGG + Intergenic
1043415083 8:80039659-80039681 CACATTGCAGAGTTTGAACTTGG - Intronic
1043834166 8:85027600-85027622 TAAAATGCAGAGCTGGAACTAGG - Intergenic
1044016055 8:87049931-87049953 CAGACTGCTGGGATGGACCTTGG + Intronic
1048874012 8:138822555-138822577 AACCTTGCAGAGATGGAACAAGG - Intronic
1050346227 9:4690935-4690957 CACTCTCCACTGATGGAACTTGG - Intronic
1051349512 9:16185635-16185657 CACATTTCAGAGAGGGAATTAGG + Intergenic
1054925496 9:70584829-70584851 CACATGGCAGAGAGGGAACAGGG - Intronic
1056503964 9:87239144-87239166 CACACTGTAAACATGGAAGTGGG - Intergenic
1056682769 9:88733692-88733714 CACTCTGCAGAGGTTGAAGTGGG + Intergenic
1056709093 9:88976318-88976340 CACAATGCAGAGAAAGAACAAGG - Intergenic
1058812457 9:108654296-108654318 TACACTGCAGCTATAGAACTTGG - Intergenic
1059425501 9:114218421-114218443 CAAACTCCAGAGGTGGACCTGGG + Intronic
1059438389 9:114289571-114289593 CACACTGTAGAGAGAAAACTGGG + Intronic
1060204580 9:121675003-121675025 CCCACTGCAGTTATGGAACCTGG - Intronic
1062065209 9:134523077-134523099 CACGCTGCAGAGAGGGAGCCGGG - Intergenic
1187007183 X:15244026-15244048 CATATAGCAGAGATGGAACCAGG + Exonic
1188220214 X:27532238-27532260 CAGATTGCAGGGCTGGAACTGGG + Intergenic
1190930598 X:54946555-54946577 CACACTGCAGAGATGTTTGTGGG - Intronic
1192036398 X:67567480-67567502 CTCCGTGCAGAGATGGAAGTGGG + Intronic
1192163001 X:68802657-68802679 TAGGCTGCAGATATGGAACTGGG + Intergenic
1192820104 X:74636485-74636507 CAAACTGCAGAAATGGGAATGGG + Intergenic
1193207129 X:78762321-78762343 CACAATGCATAGATTGCACTGGG - Intergenic
1194252156 X:91589230-91589252 CACCCTCCAAAGATGGAACCAGG + Intergenic
1195853934 X:109310393-109310415 CAAACTGCAGAAATGTTACTAGG - Intergenic
1197495446 X:127173773-127173795 CAAACTGCAGAGATATTACTAGG - Intergenic
1199129896 X:144172019-144172041 CAAACTGCAGAAATGTTACTAGG - Intergenic
1199482026 X:148308266-148308288 AAGTCTGCAGAGATGGAACGGGG + Intergenic
1200411763 Y:2868283-2868305 CAGAGTGCAGAGATGGTATTGGG + Intronic
1200571087 Y:4830469-4830491 CACCCTCCAAAGATGGAACCAGG + Intergenic