ID: 1128138233

View in Genome Browser
Species Human (GRCh38)
Location 15:65280131-65280153
Sequence ATGGCTAACCTTTCTAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128138233_1128138240 20 Left 1128138233 15:65280131-65280153 CCTTCCTTAGAAAGGTTAGCCAT 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1128138240 15:65280174-65280196 CGCCTGTAATCCCAGCATTTTGG 0: 4469
1: 137853
2: 283836
3: 246810
4: 275164
1128138233_1128138236 -10 Left 1128138233 15:65280131-65280153 CCTTCCTTAGAAAGGTTAGCCAT 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1128138236 15:65280144-65280166 GGTTAGCCATGAGCCAGGTGTGG 0: 1
1: 0
2: 1
3: 21
4: 234
1128138233_1128138242 24 Left 1128138233 15:65280131-65280153 CCTTCCTTAGAAAGGTTAGCCAT 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1128138242 15:65280178-65280200 TGTAATCCCAGCATTTTGGAAGG 0: 604
1: 24329
2: 323900
3: 265228
4: 199769
1128138233_1128138237 -7 Left 1128138233 15:65280131-65280153 CCTTCCTTAGAAAGGTTAGCCAT 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1128138237 15:65280147-65280169 TAGCCATGAGCCAGGTGTGGTGG 0: 1
1: 2
2: 33
3: 336
4: 4912

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128138233 Original CRISPR ATGGCTAACCTTTCTAAGGA AGG (reversed) Intronic
910555814 1:88531521-88531543 TTGGCTAACCTTTCAAACAAAGG + Intergenic
920712395 1:208307613-208307635 ACGGATAACTTTTATAAGGATGG - Intergenic
921565314 1:216710648-216710670 ATGGCTAACCTTTCTACTCATGG + Intronic
924080590 1:240393614-240393636 ATGGTTAACCTTAATGAGGAAGG + Intronic
1063955952 10:11267237-11267259 ATTGCTCATCTTTTTAAGGAAGG - Intronic
1067722419 10:48738819-48738841 ATGGGAAACCTTTATAAGAAGGG - Intronic
1068090971 10:52431669-52431691 ATGGATTACCTCTGTAAGGATGG + Intergenic
1073231154 10:101971406-101971428 CTGGCTAACTTTTGTAAAGATGG - Intronic
1077475236 11:2785803-2785825 TAGGTTAACCTTTCCAAGGATGG - Intronic
1081212013 11:40347527-40347549 ATGACTAAGCTTAGTAAGGAAGG - Intronic
1085928035 11:81045601-81045623 ATGGCTCACCCATCTCAGGAAGG + Intergenic
1087914634 11:103795791-103795813 ATGGAACACATTTCTAAGGATGG - Intergenic
1090427908 11:126622525-126622547 CTGGCTAACTTTTGTAATGAAGG - Intronic
1090905796 11:131073601-131073623 ATGGCTGAGATTTCTGAGGAGGG + Intergenic
1092980023 12:13785331-13785353 AGGTCTAAACTTTTTAAGGAGGG - Intronic
1095662515 12:44753937-44753959 ATGGCTAACATTTTGAAAGAGGG - Intronic
1097497959 12:60366082-60366104 AAGGCAAACCTTGTTAAGGATGG - Intergenic
1099003514 12:77209534-77209556 ATGATTAAGCTTTGTAAGGAAGG - Intergenic
1100791181 12:98131896-98131918 ATGGTTAAACTTAGTAAGGAAGG - Intergenic
1101080258 12:101174156-101174178 ATGGCACCCATTTCTAAGGAAGG - Intronic
1101218670 12:102612744-102612766 ATGCCTAACCTTTCACAGTATGG - Intergenic
1101672105 12:106885020-106885042 ACTGCTGACCTTTCTAGGGATGG + Intronic
1102058922 12:109917481-109917503 TTGGCTAACCTTTTAAAGGCAGG + Exonic
1111065234 13:83082472-83082494 ATGGCTAAACTTAGTGAGGAAGG - Intergenic
1111163978 13:84433087-84433109 AGGCCTAACCTTTCTAAGGGAGG + Intergenic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1116327153 14:43544683-43544705 ATGGATAACCTGTTTCAGGAAGG + Intergenic
1128138233 15:65280131-65280153 ATGGCTAACCTTTCTAAGGAAGG - Intronic
1128881732 15:71250016-71250038 ATTTCTAACCTTGCAAAGGAAGG - Intronic
1129223110 15:74145934-74145956 ATGGATAACTTTTCTTAAGAAGG + Intergenic
1130748812 15:86687185-86687207 ATGGCCAACTTTTCTATTGAAGG - Intronic
1132076821 15:98828391-98828413 ATGGCCAACCATCCTATGGATGG - Intronic
1132755735 16:1484112-1484134 ATTGCTACACTTTTTAAGGAAGG + Intergenic
1139531021 16:67542798-67542820 AGGGCTTACATTTATAAGGATGG - Exonic
1148503623 17:48110499-48110521 AAGGCTAACATTTCAAAAGAAGG - Intronic
1148829783 17:50424192-50424214 ATTGCAAACCTTTTTTAGGAGGG - Intergenic
1155831239 18:30516967-30516989 ATGGCCAAACTTCCAAAGGATGG + Intergenic
1156282281 18:35651209-35651231 ATGGCTAATCTTTCTGAACAAGG + Intronic
1160206216 18:76835707-76835729 ATAGTTAACTTTTCTAAGTATGG + Intronic
1168489637 19:56797402-56797424 CTCTCTCACCTTTCTAAGGATGG - Intronic
925463810 2:4088580-4088602 GTGGCTGATCTTTCTAATGAGGG - Intergenic
931235051 2:60406069-60406091 ATGGATTCCCTTTCTCAGGAGGG + Intergenic
932993745 2:76821787-76821809 ATGGCTCACCTTAATAAGGTGGG - Intronic
935295195 2:101643474-101643496 ATGGTTAAGCTTTGTAAAGAAGG - Intergenic
939509161 2:143085324-143085346 ATGACTAACCTTAGTGAGGAAGG + Intergenic
939836734 2:147138452-147138474 AGGGACAACCTTTCTAAAGAAGG - Intergenic
943672336 2:190676556-190676578 CTGGCTAATTTTTGTAAGGATGG - Intronic
945364153 2:208930130-208930152 CTAGATAACCTTTGTAAGGAGGG - Intergenic
945411083 2:209507962-209507984 AAGGCTGACCTTTCAAAGAATGG + Intronic
945654084 2:212602810-212602832 AAGCCCAACCTTTCTAATGAAGG + Intergenic
946960211 2:224977027-224977049 ATGGCAAACATTTCTGAGTAAGG - Intronic
1169975584 20:11323643-11323665 ATGGATCACCATTCTGAGGAAGG - Intergenic
1169990623 20:11498827-11498849 ATGGCTGAACTTTCTCTGGATGG - Intergenic
1174693650 20:52535341-52535363 TTGGTTAACCTTTTAAAGGAAGG - Intergenic
1178588781 21:33891971-33891993 ATCGCTAACCTTGAAAAGGAAGG - Exonic
1179100117 21:38349073-38349095 CTAGCTAACCTTTCTCAGGATGG + Intergenic
1179163359 21:38915989-38916011 ATGGATAAGCTTTCCAATGAAGG - Intergenic
1179994314 21:44967024-44967046 ATGGCTTCGATTTCTAAGGAAGG - Exonic
1181894131 22:26092113-26092135 ATGAATAAGCTTTCTAATGAGGG - Intergenic
1182963572 22:34500820-34500842 ATGGATATCCAGTCTAAGGAGGG - Intergenic
1184446777 22:44552268-44552290 ATGGCTAAGCTTGGTGAGGAAGG + Intergenic
949326314 3:2868880-2868902 ATGGAAAGCCTTTCTAAGGAGGG + Intronic
951409961 3:22351284-22351306 ATTGCTATGCTTTCTAGGGAGGG - Intronic
954463509 3:50640991-50641013 CTGGCTAACCGGTCCAAGGATGG - Intronic
955065868 3:55533306-55533328 ATGACTAACCATTCTAACCAGGG + Intronic
961618485 3:128204082-128204104 GTGGTTAACTTTTGTAAGGAAGG + Intronic
962128064 3:132643549-132643571 GTGACTGACCATTCTAAGGAGGG + Intronic
965803354 3:172516782-172516804 ATGCAAAACCTTTCCAAGGAAGG + Intronic
967474478 3:189900624-189900646 ATGAAAAACCTTTCTAAAGAAGG - Intergenic
970806993 4:20048809-20048831 ATGGATAACCTTGCTAACTATGG - Intergenic
970949273 4:21733841-21733863 ATGGCTAAACTTTCTGAATAAGG - Intronic
970988513 4:22186349-22186371 CTGGCTAACATTTATAAGTATGG - Intergenic
980578969 4:134723833-134723855 ATGGTTTACCTTTCTTAGAATGG + Intergenic
985035092 4:185830792-185830814 ATGGCTAACCGCCCTCAGGAGGG - Intronic
986417370 5:7542717-7542739 ATGGCTACCCTTGATAATGAAGG - Intronic
987010100 5:13754431-13754453 ATGGCTCACATGTCTCAGGAAGG - Intronic
987441263 5:17959984-17960006 GTGGCTTACCTTTCTAAGTAAGG + Intergenic
988955177 5:36309130-36309152 CTGGCTAACATTTGAAAGGAGGG - Intergenic
994760970 5:103853606-103853628 ATGATTAATCTTTCTGAGGAAGG - Intergenic
996646044 5:125818081-125818103 ATGTCTAACCTTTGTAAGATGGG + Intergenic
1003384220 6:5652563-5652585 ATGGCTCACCTCTCTCAGAATGG + Intronic
1013381898 6:109581288-109581310 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1017822102 6:158056995-158057017 AGGGCTAACCTTTCACAGGGCGG + Intronic
1021265324 7:18513763-18513785 ATCCCTAACATTTTTAAGGATGG - Intronic
1022674655 7:32487827-32487849 AAGGATAACCTTTTTAGGGAGGG - Intronic
1022982181 7:35614299-35614321 AGTTCTAACCTTTCTAATGAAGG + Intergenic
1024931660 7:54670639-54670661 ATTGCTAATCTCTCAAAGGAAGG + Intergenic
1026890404 7:73978494-73978516 ATGGCCCACCTTTCAGAGGAAGG + Intergenic
1037424667 8:18742821-18742843 ATGGATAACCTAGGTAAGGATGG - Intronic
1038465451 8:27758328-27758350 ATGACTAACCTCTTTAAAGAGGG - Intronic
1039148954 8:34481270-34481292 AGAGCTGACCTTTCTCAGGAAGG - Intergenic
1045468695 8:102491835-102491857 ATGGCTGGCCTTTCTGGGGAGGG + Intergenic
1045512817 8:102826737-102826759 ATGCCAAACCTTTTTAAAGATGG - Exonic
1047178175 8:122561774-122561796 ATGACTAAACTTAGTAAGGAAGG - Intergenic
1048708492 8:137182047-137182069 ATTGCCAACATTTCAAAGGAGGG - Intergenic
1186158274 X:6748925-6748947 ATCGCCAACCTTTCTAAGAATGG - Intergenic
1187180758 X:16941614-16941636 ATGGCCAACCATTCTAATAAAGG - Intergenic
1188145975 X:26613842-26613864 ACGACAAACCTTTCTAAAGAAGG + Intergenic
1190189494 X:48265315-48265337 ATGGCTAAGCTTAGTGAGGAAGG - Intronic
1190658254 X:52631816-52631838 ATGGCTAAGCTTAGTGAGGAGGG - Intergenic
1190660187 X:52646834-52646856 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1190663396 X:52675978-52676000 ATGGCTAAGCTTAGTGAGGAAGG - Intronic
1190676027 X:52782504-52782526 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1190902493 X:54691443-54691465 ATGGGTAGCATTGCTAAGGATGG - Intergenic
1199980680 X:152918785-152918807 CTGGGTAACCTTTCTGGGGAAGG + Intronic
1201551769 Y:15225101-15225123 ATCGCCAACCTTTCTAAGAATGG - Intergenic