ID: 1128139435

View in Genome Browser
Species Human (GRCh38)
Location 15:65287954-65287976
Sequence ACTAGGGGCCTTGTGGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128139435_1128139441 -6 Left 1128139435 15:65287954-65287976 CCTAGAACCACAAGGCCCCTAGT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1128139441 15:65287971-65287993 CCTAGTGCTTCAAAAGCCATGGG 0: 1
1: 0
2: 0
3: 24
4: 155
1128139435_1128139443 -4 Left 1128139435 15:65287954-65287976 CCTAGAACCACAAGGCCCCTAGT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1128139443 15:65287973-65287995 TAGTGCTTCAAAAGCCATGGGGG 0: 1
1: 0
2: 2
3: 27
4: 260
1128139435_1128139444 6 Left 1128139435 15:65287954-65287976 CCTAGAACCACAAGGCCCCTAGT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1128139444 15:65287983-65288005 AAAGCCATGGGGGTTCTCATAGG 0: 1
1: 0
2: 1
3: 10
4: 125
1128139435_1128139447 23 Left 1128139435 15:65287954-65287976 CCTAGAACCACAAGGCCCCTAGT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1128139447 15:65288000-65288022 CATAGGACCCAGGAACTCTAAGG 0: 1
1: 0
2: 0
3: 6
4: 133
1128139435_1128139439 -7 Left 1128139435 15:65287954-65287976 CCTAGAACCACAAGGCCCCTAGT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1128139439 15:65287970-65287992 CCCTAGTGCTTCAAAAGCCATGG 0: 1
1: 0
2: 11
3: 248
4: 234
1128139435_1128139442 -5 Left 1128139435 15:65287954-65287976 CCTAGAACCACAAGGCCCCTAGT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1128139442 15:65287972-65287994 CTAGTGCTTCAAAAGCCATGGGG 0: 1
1: 0
2: 0
3: 15
4: 160
1128139435_1128139446 13 Left 1128139435 15:65287954-65287976 CCTAGAACCACAAGGCCCCTAGT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1128139446 15:65287990-65288012 TGGGGGTTCTCATAGGACCCAGG 0: 1
1: 0
2: 0
3: 2
4: 117
1128139435_1128139448 26 Left 1128139435 15:65287954-65287976 CCTAGAACCACAAGGCCCCTAGT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1128139448 15:65288003-65288025 AGGACCCAGGAACTCTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128139435 Original CRISPR ACTAGGGGCCTTGTGGTTCT AGG (reversed) Intronic
901180324 1:7337144-7337166 CGTAGTGGCCTGGTGGTTCTAGG + Intronic
902171134 1:14612198-14612220 ACTAGGGGTGTTGTGGTTAATGG + Intronic
902580596 1:17405117-17405139 ACTAGGATCTTTGTGGTTCCAGG + Intergenic
903121876 1:21221503-21221525 CCCAGGGCCCTTCTGGTTCTAGG - Intronic
906656456 1:47551919-47551941 ACCAGGGACCTGGTGGTTCCTGG + Intergenic
912465934 1:109873842-109873864 ACTAGGGGTCTTGTGGATATGGG + Intergenic
912943041 1:114061631-114061653 CTTTGGGGCCTTGTGGTTCCTGG + Intergenic
914380416 1:147110794-147110816 ACCTGGGGCATTGTGGGTCTTGG + Intergenic
924454592 1:244208947-244208969 ACTAAGAGCCTTTTGGGTCTAGG - Intergenic
1063535317 10:6877083-6877105 TCTCGGGGCCTTGTGAATCTGGG - Intergenic
1067018126 10:42772616-42772638 CTTTGGGGCCTTGTGGTTCCTGG + Intergenic
1069591320 10:69644097-69644119 TCTAGGAGCCTTGTGGTCCAGGG + Intergenic
1075973321 10:126673345-126673367 GCTAGGGGGCTTGTGGTTAAAGG - Intergenic
1076299681 10:129415509-129415531 CCTAGGGGCATTGTGATTCCGGG + Intergenic
1076788412 10:132763286-132763308 GCTAGGTGCCATGCGGTTCTTGG - Intronic
1077234432 11:1473055-1473077 CCTAGGGCCCTGGTGGTGCTGGG - Intronic
1086815589 11:91366678-91366700 AATTGGGGACTTGTGGTGCTAGG - Intergenic
1087145072 11:94802693-94802715 CAAAGGGGCCTTGTGGCTCTGGG - Intronic
1090514531 11:127411561-127411583 CCTTGGGGCCCTGTGGTTCCTGG - Intergenic
1090576636 11:128112128-128112150 TCTAGGGTTCTTGTGGTTTTAGG - Intergenic
1092005201 12:5063596-5063618 ATAAGGGGCCTTGTAGTTCCAGG - Intergenic
1092159453 12:6308129-6308151 GCTAGGGGCCATCTGGTCCTTGG - Intergenic
1096006557 12:48178065-48178087 AATAGGGGCCTCGGGGTTCTAGG + Intronic
1096626369 12:52898569-52898591 ACTTGGGGTCCTGTTGTTCTGGG - Intronic
1102710444 12:114921550-114921572 TCTGGGGACCTTGTGGTTATAGG - Intergenic
1104076286 12:125392711-125392733 CCTAGTGGTCTTGTGGTTATTGG - Intronic
1104805635 12:131587588-131587610 CTTTGGGGCCCTGTGGTTCTTGG + Intergenic
1104811164 12:131621156-131621178 ACAAGGGCCCTTGTTGTTCCTGG + Intergenic
1105041969 12:132967724-132967746 CTTAGGGGCCCTGTGGTCCTTGG + Intergenic
1112075911 13:95913117-95913139 TCTAGGGGTTTTGTGGTTTTAGG - Intronic
1112504340 13:99966765-99966787 ACTAGAGGCCTTGTGTTTAAAGG - Intronic
1120245703 14:82003700-82003722 ACCAGGGGGCTTATTGTTCTGGG + Intergenic
1121105248 14:91275084-91275106 ATTAGGGGCCTTGTGTGTCAGGG + Intronic
1121644618 14:95509308-95509330 GCTAGGGGCTTTATGGTCCTTGG + Intergenic
1124801258 15:32835100-32835122 ACTAGCAGCCTTGTGCTTTTAGG - Intronic
1124801383 15:32836179-32836201 ACTAGCAGCCTTGTGCTTTTAGG + Intronic
1128139435 15:65287954-65287976 ACTAGGGGCCTTGTGGTTCTAGG - Intronic
1128857043 15:71027054-71027076 TCTAGGGGTTTTGTGGTTTTAGG + Intronic
1129641389 15:77382249-77382271 ATTAGGGGCCTTGTGTTACCAGG - Intronic
1132384532 15:101390664-101390686 ACTCAGGTCCCTGTGGTTCTGGG - Intronic
1133293884 16:4740600-4740622 ACGAGGGGCATTTTGGATCTGGG - Exonic
1134672834 16:16068331-16068353 AGAGGGGGCCTTGGGGTTCTAGG + Intronic
1138508933 16:57496790-57496812 ACTGGGGGCCCTGAGGTTCCAGG - Intergenic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1152073512 17:78145531-78145553 ACCAGGGGCCTCGTCGGTCTGGG + Intergenic
1152923818 17:83078919-83078941 ACGCGGGGCCGGGTGGTTCTTGG - Intergenic
1153179205 18:2413855-2413877 ACATGTGGCCTGGTGGTTCTTGG + Intergenic
1158176404 18:54661768-54661790 ACTAGGGTTCTTGTGTATCTTGG - Intergenic
1160191920 18:76721877-76721899 CATGGGGGCCTTGTGGTTCCAGG - Intergenic
1160568918 18:79803554-79803576 ACGAGGGGGCCTGTGATTCTGGG + Intergenic
924966623 2:82349-82371 AATAGGGGACTTGTGTTTCTAGG + Intergenic
926872332 2:17435597-17435619 AAAAGGGGCCTTCTGGTTCAAGG + Intergenic
927226274 2:20768316-20768338 CTTTGGGGCCTTGTGGTTCCTGG + Intronic
929922711 2:46183961-46183983 ACTGTGTGCCTTATGGTTCTTGG - Intronic
929923201 2:46188394-46188416 ACTATAGGCCTTGGGGTTCCAGG + Intergenic
930160125 2:48146349-48146371 ACTAAGGGCCAGGTGGGTCTGGG - Intergenic
930323451 2:49883245-49883267 ACAAGGGGCATTCTGGTTTTAGG - Intergenic
933103185 2:78286062-78286084 AGTAGGTGCCTTGTCTTTCTTGG - Intergenic
933801053 2:85960803-85960825 CTTTGGGGCCCTGTGGTTCTTGG - Intergenic
937206710 2:120241234-120241256 ACCTTGGGCCTTGTGGCTCTTGG - Intronic
938066470 2:128284355-128284377 ACTTGGGGCCTTGTGTGACTGGG - Intronic
941295907 2:163737065-163737087 AGTAGGGGCTTTGTGGTGCTGGG + Intergenic
941575032 2:167219500-167219522 ACTATGGGGCTTGTGGATCTGGG + Intronic
948243286 2:236456520-236456542 ACTCGGGGGCTTGAGGTTATCGG - Intronic
1169475446 20:5927000-5927022 AATAGGGGGCTTGGGGTTCCTGG + Intergenic
1173658392 20:44716529-44716551 AATAGGGGACTTGGGGCTCTAGG + Intronic
1173970148 20:47146304-47146326 AATAGGCGCCTTGTGGATCTTGG + Intronic
1175001265 20:55632881-55632903 CTTTGGGGCCTTGTGGTTCCTGG - Intergenic
1180077629 21:45471051-45471073 GCTACGGGCCTTGTGCTGCTGGG + Intronic
1180077647 21:45471121-45471143 ACTACGGGCCTTGTGCTGCTGGG + Intronic
1182619868 22:31613174-31613196 AGTGCGGGCCCTGTGGTTCTGGG + Exonic
949273518 3:2249782-2249804 GCAAGGGGCATTGTGGTACTAGG - Intronic
950377759 3:12585562-12585584 ACTAGGGGTCATGTGGATTTCGG + Intronic
952037580 3:29221206-29221228 TCCAGGAGCCTTGAGGTTCTGGG - Intergenic
953788602 3:45929503-45929525 GCTGGGGGCCTGGTGGGTCTGGG + Intronic
956159933 3:66339969-66339991 TCTAGGGGTTTTGTGGTTTTAGG + Intronic
957638229 3:82815054-82815076 ATTTGGGGCCCTGTGGTTCCTGG - Intergenic
957669119 3:83277862-83277884 AGTTGGGGCATTGTTGTTCTGGG + Intergenic
957776615 3:84762084-84762106 AAAAGGGGCCTTCTGGTTTTGGG - Intergenic
962698613 3:137975246-137975268 AGCAGAGGCCATGTGGTTCTGGG + Intergenic
963390955 3:144663841-144663863 TCTATGAGGCTTGTGGTTCTTGG + Intergenic
963688645 3:148470815-148470837 ACTAGGGGCCTTGTTGTCAAAGG - Intergenic
964050037 3:152379963-152379985 AATAGCAGTCTTGTGGTTCTAGG - Intronic
965252125 3:166355472-166355494 TCTAGGGTCTTTGTGGTTTTAGG - Intergenic
966749566 3:183309318-183309340 ACTAGGGGGCTGGGGGTTGTGGG - Intronic
967214507 3:187199020-187199042 ACTACAGGCCTTGGGGATCTGGG + Intronic
968620319 4:1600983-1601005 TCTAGGAGCCTTGAGCTTCTCGG - Intergenic
975584212 4:75934177-75934199 TCTAGAGGCCTTGTGATTCGGGG + Intronic
976488559 4:85639984-85640006 ATTAAGGGCCTTGTGAATCTTGG + Intronic
977135880 4:93303438-93303460 AGTAGGGTCCTTGTCATTCTTGG + Intronic
977956564 4:103034335-103034357 TCTAGGGGCTTTGTAGTTTTCGG - Intronic
979540791 4:121879133-121879155 ACTTGGGGCTCAGTGGTTCTAGG + Exonic
991006446 5:61832700-61832722 ACGAGTGGCCTAGTGGTTCAGGG + Intergenic
991908679 5:71538339-71538361 ACTGGGGGCCTTGTATTTTTGGG + Intronic
997465764 5:134087159-134087181 ACACCGGGCCTTGTGGTTGTGGG + Intergenic
1001537538 5:172508708-172508730 TCCAGGGGCCTTGGGGATCTTGG + Intergenic
1002623400 5:180507104-180507126 ACTAGGGGCCTTTTGGTGTCTGG + Intronic
1004070550 6:12293258-12293280 ATTAGGCTCCTTGTGGTTTTTGG - Intronic
1015616967 6:135087540-135087562 ACTAGGGGGCTCAGGGTTCTAGG - Intronic
1017818439 6:158031562-158031584 ACCACGGGCAGTGTGGTTCTGGG + Intronic
1020195217 7:6032873-6032895 ACTCTGGGCCTTGTGGTACTTGG - Exonic
1020494836 7:8836857-8836879 ACTAAGGACTGTGTGGTTCTTGG + Intergenic
1020949793 7:14661083-14661105 TCTAGGGTCTTTGTGGTTTTAGG - Intronic
1027787643 7:82599943-82599965 ACTAGGGGGCTAATTGTTCTAGG + Intergenic
1034405759 7:150901513-150901535 AGCAGGGGCCTTGAGGTTGTGGG - Intergenic
1038239357 8:25793919-25793941 ACCTGGGGCCATGTGATTCTGGG + Intergenic
1040889956 8:52306734-52306756 ACCAGGGGCCCTGAGGATCTTGG + Intronic
1040968692 8:53111549-53111571 AGTAGAGGCCTTCTGGTTTTTGG + Intergenic
1041837072 8:62228473-62228495 ACTAGGGTTTTTATGGTTCTAGG - Intergenic
1041935740 8:63329978-63330000 TCTAGGGGCCTTGTGGTAGGTGG - Intergenic
1043492947 8:80767334-80767356 ACTGGTGGCCATGTGTTTCTCGG - Intronic
1045407542 8:101881576-101881598 ATTAAGGGCCTTTTGGTCCTTGG - Intronic
1050313025 9:4372356-4372378 TCTTGGGGCTTTGTGGATCTGGG + Intergenic
1052249234 9:26377847-26377869 TCTAGGGTCCTTATGGTTTTAGG + Intergenic
1057547581 9:96029819-96029841 CCTTGGGGCCTTGTGGTCTTAGG + Intergenic
1061378673 9:130241301-130241323 ACTAGGGACCTAGAGGCTCTAGG + Intergenic
1062459410 9:136656639-136656661 ACTGGGGTCCCTGTGGCTCTGGG + Intergenic
1203753753 Un_GL000218v1:104421-104443 ATTTGGGGCCCTGTGGTTCCTGG - Intergenic
1186316820 X:8379570-8379592 AGTATGGGCTTTGTGGTTCTGGG + Intergenic
1189233657 X:39471479-39471501 AGGAGGGGCGTTGTGGTCCTTGG - Intergenic
1190768845 X:53498453-53498475 ACTAGGGGTTATGTGATTCTGGG - Intergenic
1195068144 X:101255687-101255709 AGAAGGGGCCTTGTGTCTCTAGG + Intronic
1196532581 X:116806306-116806328 AATAGGGTCCTTGTGACTCTGGG + Intergenic
1200983380 Y:9282311-9282333 ACTAGGGGACTGGTGATTATTGG + Intergenic