ID: 1128142629

View in Genome Browser
Species Human (GRCh38)
Location 15:65312776-65312798
Sequence TGTCCTGGAGCCTGGCCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128142629_1128142634 1 Left 1128142629 15:65312776-65312798 CCGCTGGGCCAGGCTCCAGGACA No data
Right 1128142634 15:65312800-65312822 CAGGCATCTCTTCAAGCCTAGGG No data
1128142629_1128142633 0 Left 1128142629 15:65312776-65312798 CCGCTGGGCCAGGCTCCAGGACA No data
Right 1128142633 15:65312799-65312821 ACAGGCATCTCTTCAAGCCTAGG No data
1128142629_1128142635 16 Left 1128142629 15:65312776-65312798 CCGCTGGGCCAGGCTCCAGGACA No data
Right 1128142635 15:65312815-65312837 GCCTAGGGAGCTCCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128142629 Original CRISPR TGTCCTGGAGCCTGGCCCAG CGG (reversed) Intergenic